The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).     

An intracellular modulator of the 3'5'-cGMP hydrolysis in growing Dictyostelium discoideum amoebae

A heat-stable and acid-stable macromolecular factor present in the cytosol of growing Dictyostelium discoideum amoebae affects specifically the intracellular cGMP phosphodiesterase. It decreases the V of the enzyme but does not alter its Km. It has no effect on the cAMP or cGMP hydrolysis catalyzed by the intracellular cAMP-cGMP phosphodiesterases or by the extracellular phosphodiesterase. It is also expressed in a mutant (HPX235), defective in the synthesis of the cAMP-cGMP phosphodiesterases but capable of intracellular transduction of the chemotactic signal. This factor is resistant to several nucleases, proteases and phospholipases, and has an apparent molecular weight between 3500-10000. In contrast, the protein phosphodiesterase inhibitor secreted by the amoebae exerts an opposite inhibition on the intracellular phosphodiesterases. These two inhibitory factors may regulate intracellular cGMP hydrolysis during the chemotactic response.     

The trishanku gene and terminal morphogenesis in Dictyostelium discoideum

SUMMARY Multicellular development in the social amoeba Dictyostelium discoideum is triggered by starvation. It involves a series of morphogenetic movements, among them being the rising of the spore mass to the tip of the stalk. The process requires precise coordination between two distinct cell types—presumptive (pre-) spore cells and presumptive (pre-) stalk cells. Trishanku ( triA ) is a gene expressed in prespore cells that is required for normal morphogenesis. The triA⁻ mutant shows pleiotropic effects that include an inability of the spore mass to go all the way to the top. We have examined the cellular behavior required for the normal ascent of the spore mass. Grafting and mixing experiments carried out with tissue fragments and cells show that the upper cup, a tissue that derives from prestalk cells and anterior-like cells (ALCs), does not develop properly in a triA⁻ background. A mutant upper cup is unable to lift the spore mass to the top of the fruiting body, likely due to defective intercellular adhesion. If wild-type upper cup function is provided by prestalk and ALCs, trishanku spores ascend all the way. Conversely, Ax2 spores fail to do so in chimeras in which the upper cup is largely made up of mutant cells. Besides proving that under these conditions the wild-type phenotype of the upper cup is necessary and sufficient for terminal morphogenesis in D. discoideum , this study provides novel insights into developmental and evolutionary aspects of morphogenesis in general. Genes that are active exclusively in one cell type can elicit behavior in a second cell type that enhances the reproductive fitness of the first cell type, thereby showing that morphogenesis is a cooperative process.     

Changes in the polyadenylated messenger RNA population during development of Dictyostelium discoideum

The program of gene expression during the life cycle of Dictyostelium discoideum has been assessed by molecular hybridization of cDNA probes with polysomal RNA extracted at the following different stages of development: vegetative growth, interphase (2.5 hr), aggregation (8 hr), postaggregation (12 hr), and preculmination (18 hr). Several different cDNA probes were used. Two probes were prepared from vegetative stage poly(A⁺) RNA, one representing all species present and the other enriched for abundant species. A third cDNA probe was prepared from preculmination stage polysomal RNA and a fourth probe consisted of the preculmination stage cDNA depleted in those species also present at the vegetative stage. Hybridization of the various probes with the different polysomal RNA preparations has revealed developmental changes in the mRNA populations. These changes were not detected in an aggregation less mutant under similar conditions of starvation. Abundant RNA species of vegetative cells were found to drop to low levels, especially during the aggregation period. Fifty percent by mass of the RNA present in polysomes at 18 hr is not present during vegetative growth. Some of the new RNA species appeared during interphase and the remaining during the postaggregation period. A gradual increase in the number of copies per cell of certain RNA species comprising both new species as well as some shared with vegetative cells was observed throughout development. Other results indicated that the composition of polysomal and cytoplasmic RNA is similar during vegetative growth but differs markedly at 18 hr of development. Also, cytoplasmic RNA at 18 hr contained, in addition to polysomal RNA, a large proportion by mass of nonpolysomal RNA similar to vegetative RNA. The number of polysomal RNA species detected by this analysis during vegetative growth and during the preculmination stage were estimated to be 3000 and 3700, respectively. The number of copies of these RNA species ranged between 30 and 2000 per cell during vegetative growth and 3 to 300 per cell in polysomes at 18 hr. Developmentally induced RNAs which were preferentially distributed among abundant and intermediate classes were estimated to number 700–900 species.     

Induction of phosphodiesterase by cyclic adenosine 3':5'-monophosphate in differentiating Dictyostelium discoideum amoebae.

Cyclic adenosine 3':5'-monophosphate added to the starvation media of Dictyostelium discoideum amoebae induces both intracellular and extracellular phosphodiesterase activities of these cells. The induced enzyme activity appears several hours earlier than that in starved cells which have not been induced with cyclic nucleotide. In both cases, the appearance of enzyme is inhibited by cycloheximide, and actinomycin D, and daunomycin. The KmS for the extracellular enzyme(s) of nucleotide-induced and uninduced control cells are identical. The induction of enzyme activity seems specific for cyclic adenosine 3':5'-monophosphate since cyclic guanosine 3':5'-monophosphate, as well as other nucleotides, have no effect. No differences in the activity or excretion of either N-acetylglucosaminidase or the inhibitory of the extracellular phosphodiesterase are observed between cyclic adenosine 3':5'-monophosphate-induced and control cells. A direct activation of phosphodiesterase by cyclic adenosine 3':5'-monophosphate can be excluded, since the addition of this nucleotide to cell lysates has no effect on the enzyme activity.     

Interaction of the inhibitor of the 3',5' cyclic AMP phosphodiesterase of Dictyostelium discoideum with the Affi-Gel blue

Disodium ethylenediamine tetraacetic acid and/or allylisopropylacetamide administration to rat pups did not evoke a premature induction of hepatic δ-aminolevulinic acid synthetase. Administration of iron to adult rats did not alter δ-aminolevulinic acid synthetase activity and had little inductive effect on heme oxygenase activity. Both heme and cobalt/dextran rapidly induced microsomal heme oxygenase by 3–8 fold. Induction of heme oxygenase by heme could be totally blocked by concurrent administration of cycloheximide. These results argue against the hypothesis that iron is the physiological mediator of δ-aminolevulinic acid synthetase activity.     

Binding of adenosine 3':5'-monophosphate to plasma membranes of Dictyostelium discoideum amoebae

A plasma membrane preparation from Dictyostelium discoideum amoebae which contains the high affinity cAMP receptor is described. Ligand specificity and the kinetics of cAMP association and dissociation using isolated plasma membranes were similar to those of intact cells. The changes in cAMP binding activity which occur as cells proceed through their aggregation program were also reflected in the membrane preparations. However, neither the low affinity cAMP binding site nor the oscillatory cAMP binding behavior observed on intact cells was detected with the membrane preparations.     

Defective cyclic adenosine-3', 5'-phosphate-phosphodiesterase regulation in morphogenetic mutants of Dictyostelium discoideum

At the end of the growth phase, cells of the slime mould, Dictyostelium discoideum, release an inhibitor of extracellular cAMP-phosphodiesterase into the medium. Non-aggregating mutants or those with atypical cell aggregation were screened for defects in the regulation of the cAMP-phosphodiesterase-inhibitor system. This system was found to be defective in one-half of the mutants selected as morphogenetically aberrant. The mutants were classified as (1) mutants which did not release inhibitor or those with delayed inhibitor release, (2) mutants with excessive phosphodiesterase production and (3) mutants with deficient enzyme activity.     

The cyclic nucleotide phosphodiesterase inhibitory protein of Dictyostelium discoideum. Purification and characterization

We have purified the glycoprotein inhibitor of the extracellular cyclic nucleotide phosphodiesterase of Dictyostelium discoideum to apparent homogeneity. The inhibitor has a molecular weight of 47,000 measured by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The interaction of the inhibitor and the cyclic nucleotide phosphodiesterase occurs with 1:1 stoichiometry and with a dissociation constant of about 10(-10) M. Periodate oxidation of the inhibitor or of the enzyme destroys concanavalin A binding ability but does not affect the formation of the enzyme-inhibitor complex. Inhibitor is not produced by cells during logarithmic growth but appears in quantity during stationary phase and after transfer from growth medium to phosphate buffer.     

Developmental changes in messenger RNAs and protein synthesis in Dictyostelium discoideum

The pattern of proteins synthesized at different stages of differentiation of the slime mold Dictyostelium discoideum was studied by two-dimensional polyacrylamide gel electrophoresis. Of the approximately 400 proteins detected during growth and/or development, synthesis of most continued throughout differentiation. Approximately 100 proteins show changes in their relative rates of synthesis. During the transition from growth to interphase, the major change observed is reduction in the relative rate of synthesis of about 8 proteins. Few further changes are noticeable until the stage of late cell aggregation, when production of about 40 new proteins begins and synthesis of about 10 is reduced considerably. Thereafter, there are few changes in the pattern of protein synthesis. Major changes in the relative rates of synthesis of a number of proteins are found during culmination, but few culmination-specific proteins are observed. In an attempt to understand the molecular basis for these changes, mRNA was isolated from different stages of differentiation and translated in an improved wheat germ cell-free system; the products were resolved on two-dimensional gels. The ratio of total translatable mRNA to total cellular RNA is constant throughout growth and differentiation. Messenger RNAs for many, but not all, developmentally regulated proteins can be identified by translation in cell-free systems. Actin is the major protein synthesized by vegetative cells and by early differentiating cells. The threefold increase in the relative rate of synthesis of actin during the first 2 hr of differentiation and the decrease which occurs thereafter can be accounted for by parallel changes in the amount of translatable actin mRNA. Most of the changes in the pattern of protein synthesis which occur during the late aggregation and culmination stages can also be accounted for by parallel increases or decreases in the amounts of translatable mRNAs encoding these proteins. It is concluded that mRNAs do not appear in a translatable form before synthesis of the homologous protein begins, and that regulation of protein synthesis during development is primarily at the levels of production or destruction of mRNA.     

Localization of cyclic nucleotide phosphodiesterase in the multicellular stages of Dictyostelium discoideum

Cyclic 3',5'-adenosine monophosphate (cAMP) is secreted as the chemotactic signal by aggregating amoebae of the cellular slime mold Dictyostelium discoideum. We have used ultramicrotechniques in the biochemical analysis of cyclic nucleotide phosphodiesterase (PD) distribution in individual aggregates at various stages of development. With handmade constriction pipettes in microliter volumes, sections of lyophilized individuals weighing 20-100 ng could be assayed in a reaction coupled to 5'-nucleotidase. Phosphodiesterase activity was measured at pH 7.5 with 12 microM cAMP, cAMP-PD activity in aggregates ranged from 20-40 mmol/h/kg. In the pseudoplasmodium it had dropped to 5-10 mmol/h/kg and a difference in activity between the anterior prestalk cells and posterior prespore cells began to appear. The utmost posterior sections showed elevated phosphodiesterase from this stage onward. During culmination, activity rose to 40-60 mmol/h/kg associated with the developing stalk, while it declined in the spore mass. The papilla remained constant at 5-10 mmol/h/kg. The pattern of localization in the stalk was the same when cGMP was used as substrate. Extracellular phosphodiesterase inhibitor produced at the aggregation stage was found to reduce the localized activity in the culmination stage by 50-80%, with the most marked inhibition occurring in the center of the papilla. We found no evidence of endogenous heat-stable phosphodiesterase inhibitor within the culminating sorocarp.     

A slowly dissociating form of the cell surface cyclic adenosine 3':5'-monophosphate receptor of Dictyostelium discoideum.

Experiments using a phosphodiesterase-minus mutant of Dictyostelium discoideum indicate that ligand-induced loss of cell surface cyclic adenosine 3':5'-monophosphate binding sites (down regulation) can be evoked with concentrations of cyclic adenosine 3':5'-monophosphate as low as 10(-8) M. The loss of receptor sites is observed after 5 min of cell preincubation with cyclic adenosine 3':5'-monophosphate and can be as extensive as 75 to 80%. This decrease in binding sites is correlated with the appearance of a slowly dissociating cyclic adenosine 3':5'-monophosphate binding component. Radioactive cyclic adenosine 3':5'-monophosphate bound to this form of receptor cannot be competed for by nonradioactive cyclic adenosine 3':5'-monophosphate or adenosine 5'-monophosphate and is not accessible to hydrolysis by cyclic adenosine 3':5'-monophosphate phosphodiesterase. The extent of appearance of this binding component is dependent upon the concentration of cyclic adenosine 3':5'-monophosphate used to elicit the down regulation response and the temperature of the incubation medium.