共查询到20条相似文献,搜索用时 15 毫秒
1.
Eric Chwang 《Bioethics》2015,29(6):431-439
The Code of Federal Regulations permits harmful research on children who have not agreed to participate, but I will argue that it should be no more permissive of harmful research on such children than of harmful research on adults who have not agreed to participate. Of course, the Code permits harmful research on adults. Such research is not morally problematic, however, because adults must agree to participate. And, of course, the Code also permits beneficial research on children without needing their explicit agreement. This sort of research is also not problematic, this time because paternalism towards children may be justifiable. The moral problem at the center of this paper arises from the combination of two potential properties of pediatric research, first that it might be harmful and second that its subjects might not agree to participate. In Section 2 of this article I explain how the Code permits harmful research on non‐agreeing children. Section 3 contains my argument that we should no more permit harmful research on non‐agreeing children than on non‐agreeing adults. In Section 4, I argue that my thesis does not presuppose that pediatric assent has the same moral force that adult consent does. In Section 5, I argue that the distinction between non‐voluntary and involuntary research is irrelevant to my thesis. In Section 6, I rebut an objection based on the power of parental permission. In Section 7 I suggest how the Code of Federal Regulations might be changed. 相似文献
2.
Sandra L. Alfano 《The Yale journal of biology and medicine》2013,86(3):315-321
Biomedical research in international settings is undergoing expansive growth andmay potentially result in far-reaching benefits, such as direction of researchresources toward solving basic health care needs of world populations. However,key ethical concerns surround this expansion and must be carefully considered byinternational researchers. International research is impacted by differences inlanguage, culture, regulatory structures, financial resources, and possiblyethical standards. Local community leadership involvement in the planning stagesof research is imperative. Especially in resource-poor countries, the researchagenda must be designed to address local needs and provide local benefit.Capacity strengthening efforts, aimed at improving institutional support forethical conduct of human subjects research, must continue to be supported bywealthier nations. 相似文献
3.
Licia Carlson 《The Yale journal of biology and medicine》2013,86(3):303-314
This article examines the ethical issues surrounding the inclusion of people with
intellectual disabilities as research subjects. It explores subject selection,
competence, risk and benefits, and authority through three tensions that emerge
when considering these concepts in the context of the Disability Rights Movement
and critical disability scholarship. These tensions are defined as the double
dangers of inclusion and exclusion; the challenges of defining competence and
risk in terms of individuals vs. groups; and the conflicts that arise when
pursuing the dual goals of amelioration and elimination of disabilities. Though
these tensions are not resolved, they underscore the importance of researchers
engaging with critical disability perspectives in order to navigate these
complex ethical questions. 相似文献
4.
Greenhouse and laboratory experiments were performed to determine if an interaction exists between Meloidogyne incognita and Hoplolaimus columbus on Davis soybean. Greenhouse tests were performed with three population levels of M. incognita and H. columbus (0, 1,500, 6,000/1.5-liter pot) separately and in all combinations. Dry root weight (DRT) declined nonlinearly and dry shoot weight (DST) declined linearly with respect to increasing initial populations of M. incognita and H. columbus. When the two nematode species were added to the soil together, the amount of DRT and DST suppression by one species was dependent on the initial level of the concomitant species. The final root population of M. incognita or H. columbus declined linearly with increasing initial population density of the concomitant species. H. columbus suppressed M. incognita populations in the soil nonlinearly, but M. incognita had no effect on H. columbus. 相似文献
5.
J. P. Noe 《Journal of nematology》1991,23(4):468-476
Florunner peanut and three soybean cultivars, Centennial, Gasoy 17, and Wright, were inoculated with 48-hour age cohorts of Meloidogyne arenari race 1 second-stage juveniles and placed in a growth chamber set to simulate early season (low temperature) and midseason (high temperature) conditions. Percentages of the initial inoculum penetrating roots 4 and 8 days after inoculation were 2-3 times higher in soybean cultivars than in peanut; 25% on susceptible soybean and 9% on peanut. Penetration and early development of M. arenaria were greater in the higher temperature environment. Penetration percentages were expressed as a function of cumulative degree-days by regression models. Development of M. arenaria 10, 20, and 30 days after inoculation was more rapid on peanut than on soybean. The resistant soybean cultivar Wright had slower development rates than did the other two soybean cultivars. Nematode growth and development were dependent on temperature. In greenhouse experiments, production of eggs by M. arenaria was more than 10 times greater on peanut than on susceptible soybean. The reproductive factor for Wright soybean was less than one, but plant growth parameters indicated that this cultivar was intolerant of M. arenavia. 相似文献
6.
Osamu Suzuki Minako Koura Yoko Noguchi Kozue Uchio-Yamada Junichiro Matsuda 《Experimental Animals》2013,62(3):267-273
We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR
strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a
mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an
Hrhr allele. Using PCR with multiple pairs of primers
designed to amplify multiple overlapping regions covering the entire Hr
gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR
mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was
the same as that of Hrhr in the HRS/J strain. Based on the
sequence, we developed a genotyping method using PCR to determine zygosities. Three
primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and
R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the
Hrhr allele (275-bp amplicon), and S607 and R850
identified the wild-type Hr allele (244-bp amplicon). Applying PCR using
these three primers, we confirmed that it is possible to differentiate among homozygous
Hrhr (longer amplicons only), homozygous wild-type
Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and
Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains,
and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same
Hrhr gene mutation. Our genotyping method will facilitate
further research using hairless mice, and especially immature mice, because pups can be
genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age. 相似文献
7.
Pathogenicity and reproduction of single and combined populations of Meloidogyne arenaria and M. incognita on a susceptible soybean (Glycine max cv. Davis) were investigated. Significant galling and egg mass production were observed on roots of greenhouse-grown soybean inoculated with M. arenaria and M. incognita, in combination and individually. M. arenaria produced more galls and egg masses than M. incognita, whereas in combined inoculation with both nematode species, gall and egg production was intermediate. In growth chamber tests, inoculations with M. arenaria and M. incognita, singly or in combination, produced more galls and egg masses at 30 C than at 25 C. At 25 C, M. arenaria alone produced significantly more galls and egg masses than the combined M. arenaria plus M. incognita, while M. incognita produced the fewest. At 30 C, numbers of egg masses produced by M. arenaria did not differ significantly from combined M. arenaria and M. incognita. In temperature tank tests, M. incognita produced more galls and egg masses at 28 C than at 24 C soil temperature. In contrast, numbers of galls, egg masses, and eggs of M. arenaria were slightly higher at 24 C than at 28 C. Combined inoculum of both nematode species produced greater numbers of galls at 24 C than at 28 C. 相似文献
8.
Edward C. McGawley K. L. Winchell J. P. Jones W. Birchfield G. T. Berggren 《Journal of nematology》1985,17(1):69-76
Gliocladium virens was isolated from slash pine trees symptomatic and asymptomatic for pine wilt disease with frequencies of 24% and 10%, respectively. Populations of Bursaphelenchus xylophilus, the nematode incitant of this disease, reproduced on this fungus and inhibited its growth. Growth inhibition of the fungus was characterized by an absence of sporulation and by the formation of chains of dark, thick-walled, chlamydospore-like cells. Population increase during a 12-day period following infestation of cultures of the fungus with 10,000 nematodes averaged 3-fold at 16 C, 9-fold at 20 C, and 24-fold at 24 C. In greenhouse studies, nematode recovery from slash pine seedlings coinoculated with both organisms was significantly greater than that obtained from seedlings inoculated with the nematode alone. 相似文献
9.
An unmanaged pasture was sampled on four occasions (A, B, C, D) with five different quadrat sizes for Criconemella sphaerocephalus by removing a constant soil core volume of 75 cm³ (A) and 300 cm³ (C) from increasing quadrat areas of 0.5-8 m², and removing soil core volumes of increasing size - 75-1,200 cm³ (B) and 300-4,800 cm³ (D) - proportionally with an increase in quadrat area (0.5-8 m²). Frequency counts of C. sphaerocephalus were fitted to six probability distributions. The index of aggregation (b) for Taylor''s power law and Morisita''s index of dispersion were also calculated where appropriate. Twelve of nineteen of the sampling combinations were best described by negative binomial distribution (P = 0.05). Criconemella sphaerocephalus appeared more highly aggregated when sampled with constant soil core volumes (A and C) than from increasing soil core volumes (B and D) based on Taylor''s index of aggregation (b). Morisita''s index of dispersion indicated aggregation at the smallest quadrat area (0.5 m²) for all sampling occasions (A, B, C, D). 相似文献
10.
The yield response of Florunner peanut to different initial population (Pi) densities of Meloidogyne arenaria, M. javanica, and an undescribed Meloidogyne species (isolate 93-13a) was determined in microplots in 1995 and 1996. Seven Pi''s (0, 0.5, 1, 5, 10, 50, and 100 eggs and J2/500 cm³ soil) were used for each Meloidogyne species in both years. The three species reproduced abundantly on Florunner in both years. In 1995, mean reproduction differed among the three species; mean Rf values were 10,253 for isolate 93-13, 4,256 for M. arenaria, and 513 for M. javanica. In 1996, the reproduction of M. arenaria (mean Rf = 7,820) and isolate 93-13a (mean Rf = 7,506) were similar, and both had greater reproduction on peanut than did M. javanica (mean Rf = 2,325). All three nematode species caused root and pod galling, and a positive relationship was observed between Pi and the percentage of pods galled. Meloidogyne arenaria caused a higher percentage of pod galling than did M. javanica or isolate 93-13a. A negative linear relationship between log₁₀ (Pi + 1) and pod yield was observed for all three nematode species each year. The yield response slopes were similar except for that of M. javanica, which was less negative than that of isolate 93-13a in 1995, and less negative than that of M. arenaria and isolate 93-13a in 1996. 相似文献
11.
12.
Parental effort has a direct impact on individual fitness. Theoretical models exploring how parental effort evolves to cope with offspring demand and sexual conflicts may differ in the assumptions they make in respect to the genetic heritability of parental behaviours. Only a few attempts, however, have been made to estimate the heritability of parental behaviours and their possible co‐evolution with offspring solicitation behaviour. Analysing parent and offspring behaviours in four generations of cross‐fostered broods of house sparrows, we found that parental effort (food delivery rate) was repeatable across consecutive broods and heritable across generations. In contrast, parental response to experimentally induced changes in nestling begging was neither repeatable across broods nor heritable across generations or correlated to nestling begging. Thus, the results give no indication for genetic covariance between begging intensity and parental response, but provide the first cross‐fostering‐based evidence for the heritability of parental investment levels across generations. 相似文献
13.
Deborah A. Sampson Dennis Caldwell Andre D. Taylor Jacquelyn Y. Taylor 《The Yale journal of biology and medicine》2013,86(1):89-98
In this paper, we examine the implementation and difficulties when conductinggenetics research in a rural, traditional West African culture within the frameof the United States’ grounded research ethics. Research challenges arehighlighted by Western researchers following U.S. Institutional Review Board(IRB) guidelines and practices in a non-Western country. IRB concepts areculture bound in Western ideals that may not have synchronicity andcompatibility with non-Western cultures. Differences in sociocultural norms,traditions, language, and geography were influencing factors that can affectapplication of IRB principles. Suggestions for change are offered, which willpotentially aid researchers considering application of IRB requirements whenconducting research in non-Westernized, non-industrialized countries. 相似文献
14.
Double inoculations of sugar beet with larvae of Meloidogyne hapla resulted in a higher galling incidence in only one treatment than did a single inoculation using the same number of larvae. Double inoculations with larvae of Heterodera schachtii, however, resulted in three- to five-fold more cysts in most cases than did single inoculations using the same number of larvae. In general, plants died more quickly after double inoculations than after single inoculations of the same total number of either nematode. Ratios of total soluble carbohydrates to reducing carbohydrates were lower in multiple inoculated treatments than in other treatments. Plants infected with M. hapla had lower quantities of B, K, and P in leaf tissue than noninoculated plants, but no differences were correlated with type of inoculation. Plants inoculated with H. schachtii had lower quantities of B, K, and Mg than noninoculated plants. Also, quantities of Mn, Cu, and Zn were much lower in plants inoculated twice with H. schachtii larvae than in plants inoculated with the same total number of larvae in a single dose. 相似文献
15.
The influence of various factors on reproduction of concomitant Meloidogyne incognita (Mi) and Rotylenchulus reniformis (Rr) on sweet potato were studied in the greenhouse. Reproduction of Rr was reduced by Mi at all inoculum levels and experiment durations used, while Mi reproduction was not inhibited. Both species failed to affect each other when inoculated simultaneously onto root systems developed in separate pots from different nodes of the same plant. Reproduction of each species was not significantly greater when inoculation of the second species was delayed 1-2 weeks compared to simultaneous inoculation. After shoot excision, Rr increased in the soil but Mi decreased. Fibrous root weights of plants inoculated with Rr + Mi in some tests were higher than those inoculated with Mi alone, indicating an early suppression of Mi and/or root stintulation by Rr. Drought stress delayed Rr egg hatching and movement of larvae into the soil, but had little effect on Mi reproduction. 相似文献
16.
The morphology of a population of Sphaeronema rumicis Kir''yanova found on cottonwood in Utah is illustrated by light and scanning electron micrographs, as well as by drawings. This is the first report of males of S. rumicis, a species also not known previously to occur in North America. S. rumicis females on cottonwood in the United States were smaller than those found by Kir''yanova on sorrel in the USSR. Females and second-stage juveniles (J2) from the United States had slightly shorter stylets than did females and J2 from the USSR. Males were vermiform and had degenerate esophagi. On secondary cottonwood roots S. rumicis induces formation of a syncytium originating from proliferated pericyclic cells. Thick outer walls, wall protuberances, absence of cell wall ingrowths, dense cytoplasm, and hypertrophied nuclei were the main characteristics of syncytia observed in S. rumicis-infected cottonwood roots. 相似文献
17.
18.
A natural infestation of Meloidogyne javanica in an aggregated Oxisol declined at an exponential rate when aliquots of the soil were stored for 72 days in polyethylene bags at various soil water potentials (Ψ). Time periods required for reduction in soil infestations by 50% were 2.7, 4.9, 110, 10, and 2.6 days at Ψ of -0.16, -0.30, -1.1, -15, and -92 bars, respectively. In the wetter soils, at Ψ of -0.16, -0.30, and -1.1 bars, the predominant stage recovered was the second-stage larva. In the drier soils, at Ψ of -15 and -92 bars, both eggs and larvae were recovered with neither stage predominating. Incidence of coiled larvae was inversely related to the Ψ value of the soil, a greater incidence occurring in the drier soils. After 15-32 days, percentages of coiled larvae were 13, 27, 55, 65, and 88% in soil at Ψ of -0.17, -0.60, -1.9, -15, and -82 bars, respectively. 相似文献
19.
20.
Head shape and stylet morphology of males of 90 populations of M. arenaria, M. hapla, M. incognita, and M. javanica from geographic regions of the world were compared by light microscopy (LM). In addition, stylets of one population each of M. arenaria, M. incognita, and M. javanica and three different chromosomal forms of M. hapla race A and two of race B were excised and examined with a scanning electron microscope (SEM). Differences among species occurred in both head and stylet morphology. Head morphology differed in size and shape of the head cap, annulation of the head region, and width of the head region relative to the first body annule. Differences in stylets occurred in size and shape of the cone, shaft, and knobs. All populations of M. hapla, except one, had similar head morphology, but stylet morphology was different between cytological races A and B. Populations of M. javanica varied with respect to the presence of head annulations. Head shape and stylet morphology of males are recommended as additional characters useful in the identification of root-knot nematodes. 相似文献