Sequence and conformation of 5 S RNA from Chlorella cytoplasmic ribosomes: comparison with other 5 S RNA molecules

The sequence of Chlorella cytoplasmic 5 S RNA has been determined by fingerprinting techniques. Partial digests were fractionated by a two-dimensional acrylamide gel electrophoretic technique, which indicates whether specific fragments are paired in the molecule. In this way, the four main base-paired regions of the molecule were located. The sequence of Chlorella cytoplasmic 5 S RNA is related to, but different from, that of other eukaryotic 5 S RNAs: it shows approximately 60% homology with vertebrate 5 S RNA and 40% homology with yeast 5 S RNA. In some respects the conformation of the molecule in solution is quite different from that of other sequenced 5 S RNAs: in particular, the highly accessible region found around position 40 in all other 5 S RNAs (prokaryotic and eukaryotic) does not exist in this molecule.     

Characterization of the 7S RNA and its gene from halobacteria.

The 7S RNA is an abundant nonribosomal RNA in H. halobium and other halobacteria. A specific 7S RNA gene probe shows high homology to genomic DNA of all halobacteria tested but not to those of several other archaebacteria, eubacteria and eukaryotes. All halobacterial genomes seem to carry a single copy of the 7S RNA gene. The coding region of the 7S RNA gene is highly G+C rich whereas the 5'- and 3'-noncoding regions possess a rather low G+C content. An extended double stranded structure for the 7S RNA is deduced from its nucleotide sequence. The 7S RNA of H. halobium (304 nucleotides) resembles in size and structure the 7S-L RNA from mammalian cells and shares with it a sequence homology of about 50% when arranged in a colinear fashion. The similarities in sequence are found particularly at the 3'- and 5'-termini. No similarity was detected between the 7S RNA from H. halobium and the nonribosomal 6S RNA from Escherichia coli.     

Plant small nuclear RNAs. Nucleolar U3 snRNA is present in plants: partial characterization

Nuclei, isolated from a number of plant species by either of two independent, newly developed methods, regularly contained a common set of low-molecular-mass RNAs. Partial characterization of these RNAs, based on cell fractionation, polyacrylamide gel electrophoretic and chemical sequencing techniques, as well as comparison with literature data, revealed that, in addition to tRNA, 5S RNA and 5.8S RNA, plant nuclei contain two families of low-molecular-mass RNAs, that are counterparts of vertebrate U1 and U5 RNAs respectively, and three individual low-molecular-mass RNA species. One of these may be related to vertebrate U6 RNA. The two others are true eukaryotic U2 and U3 RNAs, respectively, on the basis of the following lines of evidence obtained from analyses of broad bean nuclear RNAs. The 3'-end portion (121 nucleotides sequenced) of broad bean U2 RNA shows a nearly perfect sequence homology with that of authentic pea U2 RNA. Broad bean U3 RNA is localized in the nucleolus and its 3'-end portion (164 nucleotides sequenced) (a) shows sequence homology with that of both rat U3 RNA (48%) and Dictyostelium D2 RNA (39%), (b) has a secondary structure which fits perfectly that proposed for both rat U3 RNA and Dictyostelium D2 RNA, and (c) contains the specific sequence which, in a model based on the primary structure of rat U3 RNA, is supposed to be involved in the processing of eukaryotic 32S pre-ribosomal RNA. This is the first report on the occurrence in plants of nucleolar U3 RNA.     

Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organisms

The nucleotide sequence of ribosomal 5 S RNA from a halophilic bacterium, Halobacterium cutirubrum, grown in 4 M sodium chloride is U-U-A-A-G-G-C-G-G-C-C-A-U-A-G-C-G-G-U-G-G-G-G-U-U-A-C-U-C-C-C-G-U-A-C-C-C-A-U-C-C-C-G-A-A-C-A-C-G-G-A-A-G-A-U-A-A-G-C-C-C-G-C-C-U-G-C-G-U-U-C-C-G-G-U-C-A-G-U-A-C-U-G-G-A-G-U-G-C-G-A-G-C-C-U-C-U-G-G-G-A-A-A-U-C-C-G-G-U-U-C-G-C-C-G-C-C-U-A-C-U. This nucleotide sequence is the longest prokaryotic 5 S rRNA to be reported and unlike other 5 S species does not contain a terminal mononucleoside diphosphate residue at its 5'-end. When compared to other 5 S rRNA's, the sequence homology is greatest (about 68%) with Bacillus subtilis; there is a lower but similar degree of homology (about 58%) with either Escherichia coli or human 5 S RNA. The comparisons further indicate that among 5 S RNA's, eleven of the nucleotide residues are unique to H. cutirubrum. Estimates of the secondary structure of the H. cutirubrum 5 S RNA molecule contain one additional stable hairpin loop which is not found in other 5 S rRNA species; this unusual structure is probably an adaptation to the high salt environment within H. cutirubrum cells.     

A new rice repetitive DNA shows sequence homology to both 5S RNA and tRNA.

Moderately repetitive DNA sequences are found in the genomes of all eucaryotes that have been examined. We now report the discovery of a novel, transcribed, moderately repetitive DNA sequence in a higher plant which is different from any of the known repetitive DNA sequences from any organism. We isolated a rice cDNA clone which hybridizes to multiple bands on genomic blot analysis. The sequence of this 352 bp cDNA contains four regions of homology to the wheat phenylalanine tRNA, including the polymerase III-type promoter. Unexpectedly, two regions of the same 352 bp sequence also show homology to the wheat 5S RNA sequence. Using the cDNA as a probe, we have isolated six genomic clones which contain long tandem repeats of 355 bp sequence, and have sequenced nine repeat units. Our findings suggest that the rice repetitive sequence may be an amplified pseudogene with sequence homology to both 5S RNA and tRNA, but organized as long tandem repeats resembling 5S RNA genes. This is the first example showing homology between the sequences of a moderately repetitive DNA with unknown function and 5S RNA.     

Sequence analysis and in vitro maturation of five precursor 5S RNAs from Bacillus Q.

Bacillus Q, which is closely related to B. subtilis, contains at least six different precursors of 5S rRNA. The complete nucleotide sequences of four of these precursors, as well as the major part of the sequence of a fifth one, have been determined. They all contain the same 5'-terminal non-conserved segment which is to a large degree homologous with the corresponding segment of the B. subtilis p5S RNAs (Sogin, M.L., Pace, N.R., Rosenberg, M., Weissman, S.M. (1976) J. Biol. Chem. 251, 3480-3488). On the other hand the 3'-terminal non-conserved sequences of the various Bacillus Q precursors show considerable differences both in length and in nucleotide sequence, while there is also little or no homology with the 3'-terminal non-conserved sequence of the B. subtilis precursors. Bacillus Q p5S RNAs do not possess tetranucleotide repeats around the sites which are cleaved during maturation, as does B. subtilis p5S RNA. Like in B. subtilis, however, the cleavage sites are contained within a double-helical region of the precursor molecules. Crude RNAse M5 isolated from various Bacillus strains can maturate the Bacillus Q p5S RNAs with high efficiency. Despite considerable differences in primary structure between the precursors from the various strains, each RNAs M5 preparation can maturate all these precursors with about the same efficiency.     

Characterization of a novel small RNA encoded by Dictyostelium discoideum mitochondrial DNA

In this study, we analyzed a mitochondrial small (ms) RNA in Dictyostelium discoideum, which is 129 nucleotides long and has a GC content of only 22.5%. In the mitochondrial DNA, a single-copy gene (msr) for the ms RNA was located downstream of the gene for large-subunit rRNA. The location of msr was similar to that of the 5S rRNA gene in prokaryotes and chloroplasts, but clearly different from that in mitochondria of plants, liverwort and the chlorophycean alga Prototheca wikerhamii, in which small-subunit rRNA and 5S rRNA genes are closely linked. The primary sequence of ms RNA showed low homology with mitochondrial 5S rRNA from plants, liverwort and the chlorophycean alga, but the proposed secondary structure of ms RNA was similar to that of cytoplasmic 5S rRNA. In addition, ms RNA showed a highly conserved GAAC sequence in the same loop as in common 5S rRNA. However, ms RNA was detected mainly in the mitochondrial 25?000?×?g supernatant fraction which was devoid of ribosomes. It is possible that ms RNA is an evolutionary derivative of mitochondrial 5S rRNA.     

Satellite RNA of cucumber mosaic virus forms a secondary structure with partial 3''-terminal homology to genomal RNAs.

Sat-RNA is one of several replicating satellite RNAs which have been isolated from RNA encapsidated in cucumber mosaic virus (CMV) and which are totally dependent on CMV for replication. The 336 residue sequence of Sat-RNA obtained using the dideoxynucleotide chain termination and partial enzymic digestion procedures shows only a few short stretches (up to 11 residues) of sequence homology with one of the three CMV genomal RNAs so far sequenced. Sat-RNA has 88% sequence homology with another, previously sequenced, satellite RNA of CMV, CARNA 5. Analysis of partial digests of 5'- or 3' -32P-Sat-RNA with nuclease S1 or RNase T1 under non-denaturing conditions showed that only about 10% of the residues in Sat-RNA were cleaved. Further data on base-paired segments of Sat-RNA were obtained using digestion with RNase T1 followed by electrophoretic fractionation of the resulting fragments under both non-denaturing and denaturing conditions. On the basis of this data, a complete secondary structure model is proposed for Sat-RNA with 52% of its residues involved in base pairs. A prominent hairpin at the 3'-terminus of Sat-RNA shows considerable sequence and structural homology with parts of the 3'-terminal tRNA-like structure of the CMV genomal RNAs.     

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.     

The complete nucleotide sequence of a 16S ribosomal RNA gene from tobacco chloroplasts: Recombinant plasmid; sequence homology; stem and loop structure

The complete nucleotide sequence of a 16S ribosomal RNA gene from tobacco chloroplasts has been determined. This nucleotide sequence has 96% homology with that of maize chloroplast 16S rRNA gene and 74% homology with that of Escherichia coli16S gene.The 3′ terminal region of this gene contains the sequence ACCTCC which is complementary to sequences found at the 5′ termini of prokaryotic mRNAs.The large stem and loop structure can be constructed from the sequences surrounding the 5′ and 3′ ends of the 16S gene. These observations demonstrate the prokaryotic nature of chloroplast 16S rRNA.     

Cloning and nucleotide sequence of a carbomycin-resistance gene from Streptomyces thermotolerans

Two plasmids (pOJ158 and pOJ159) containing DNA fragments from the carbomycin(Cb)-producing strain Streptomyces thermotolerans were identified in Streptomyces griseofuscus based on their ability to confer resistance to Cb. The Cb-resistance determinants on pOJ158 and pOJ159 were designated carA and carB, respectively. In S. griseofuscus, pOJ159 also confers resistance to spiramycin, rosaramicin, lincomycin, and vernamycin B, but not to tylosin; in Streptomyces lividans, pOJ159 additionally confers resistance to erythromycin and oleandomycin. The carB gene was localized on pOJ159 to a 1.25-kb region whose nucleotide sequence was determined. The sequence has a G + C content of 68% and contains the coding sequence for carB and portions of the 5' and 3' untranslated regions. A comparison of the amino acid sequence of the protein encoded by carB (as deduced from the nucleotide sequence) with the deduced amino acid sequence of the RNA methylase from Streptomyces erythraeus (encoded by ermE) revealed extensive homology, suggesting that carB also encodes an RNA methylase. The region 5' to the coding sequence does not contain a small ORF or regions of complementarity that are commonly associated with translationally regulated macrolide-lincosamide-streptogramin B resistance genes. The 3' untranslated region contains an inverted repeat sequence that potentially can form a stable RNA stem-loop structure with a calculated delta G of -70 kcal.     

Characterization of a novel small RNA encoded by Dictyostelium discoideum mitochondrial DNA

In this study, we analyzed a mitochondrial small (ms) RNA in Dictyostelium discoideum, which is 129 nucleotides long and has a GC content of only 22.5%. In the mitochondrial DNA, a single-copy gene (msr) for the ms RNA was located downstream of the gene for large-subunit rRNA. The location of msr was similar to that of the 5S rRNA gene in prokaryotes and chloroplasts, but clearly different from that in mitochondria of plants, liverwort and the chlorophycean alga Prototheca wikerhamii, in which small-subunit rRNA and 5S rRNA genes are closely linked. The primary sequence of ms RNA showed low homology with mitochondrial 5S rRNA from plants, liverwort and the chlorophycean alga, but the proposed secondary structure of ms RNA was similar to that of cytoplasmic 5S rRNA. In addition, ms RNA showed a highly conserved GAAC sequence in the same loop as in common 5S rRNA. However, ms RNA was detected mainly in the mitochondrial 25 000 × g supernatant fraction which was devoid of ribosomes. It is possible that ms RNA is an evolutionary derivative of mitochondrial 5S rRNA. Received: 17 May 1997 / Accepted: 26 August 1997     

5 S DNAs of Xenopus laevis and Xenopus mulleri: evolution of a gene family

The 5 S DNA which contains the genes for 5 S RNA has been purified from the frog Xenopus mulleri and compared with the 5 S DNA of Xenopus laevis. Both DNAs contain highly repetitive sequences in which the gene sequence that codes for 5 S RNA alternates with a spacer sequence. The 5 S DNAs of X. laevis and X. mulleri comprise about 0.7% of the total DNA or about 24,000 and 9000 repeating sequences, respectively. The average repeat length within native X. laevis and X. mulleri 5 S DNA is about 0.5 to 0.6 and 1.2 to 1.5 × 10⁶ daltons, respectively, each repeat of which contains a single gene sequence for 5 S RNA (0.08 × 10⁶ daltons). The two DNAs differ in the average length of their spacers and no cross homology can be detected by heterologous hybridization of the two DNAs, except within the 5 S RNA gene regions. Despite their differences, the spacer sequences of X. laevis and X. mulleri 5 S DNA resemble each other enough to conclude that they have diverged from a common ancestral sequence.The multiple repeating sequences of 5 S DNA in each species have evolved as a family of similar, but not identical sequences. It is known that 5 S DNA is located at the ends (telomeres) of the long arms of most, if not all, X. laevis chromosomes. It is proposed that multiple gene sequences located on the ends of many chromosomes can evolve together as a family if there is extensive and unequal exchange of DNA sequences between homologous and non-homologous chromosomes at their ends.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Heterogeneity of the genes coding for 5 S RNA in three related strains of the genus Bacillus.

Summary Three related strains of the genus Bacillus, viz. B. licheniformis, B. subtilis and Bacillus Q were all found to contain a minor species of 5 S RNA in an amount indicating that it is transcribed from only one of the multiple 5 S RNA cistrons known to be present in these strains. The major and minor types of 5 S RNA from each of the three strains could be separated from each other by polyacrylamide gel electrophoresis in the presence of urea. The complete nucleotide sequences of the minor B. subtilis and Bacillus Q 5 S RNAs have been determined. Comparison of these sequences to the previously determined sequence of the minor 5 S RNA from B. licheniformis (Raué et al., 1976) showed the three minor types of 5 S RNA to be identical except for the residues at positions 79, 85 and 95. Moreover, seven out of the eight sequence differences between the major and the minor 5 S RNA are the same in all three strains. Thus, the single cistron coding for minor 5 S RNA has been strongly conserved in all three strains, which may indicate a biological significance for the minor 5 S RNA species.