The nucleotide sequence at the 5'' end of foot and mouth disease virus RNA.

Foot and mouth disease virus RNA has been treated with RNase H in the presence of oligo (dG) specifically to digest the poly(C) tract which lies near the 5' end of the molecule (10). The short (S) fragment containing the 5' end of the RNA was separated from the remainder of the RNA (L fragment) by gel electrophoresis. RNA ligase mediated labelling of the 3' end of S fragment showed that the RNase H digestion gave rise to molecules that differed only in the number of cytidylic acid residues remaining at their 3' ends and did not leave the unique 3' end necessary for fast sequence analysis. As the 5' end of S fragment prepared form virus RNA is blocked by VPg, S fragment was prepared from virus specific messenger RNA which does not contain this protein. This RNA was labelled at the 5' end using polynucleotide kinase and the sequence of 70 nucleotides at the 5' end determined by partial enzyme digestion sequencing on polyacrylamide gels. Some of this sequence was confirmed from an analysis of the oligonucleotides derived by RNase T1 digestion of S fragment. The sequence obtained indicates that there is a stable hairpin loop at the 5' terminus of the RNA before an initiation codon 33 nucleotides from the 5' end. In addition, the RNase T1 analysis suggests that there are short repeated sequences in S fragment and that an eleven nucleotide inverted complementary repeat of a sequence near the 3' end of the RNA is present at the junction of S fragment and the poly(C) tract.     

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris

The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5' (sequence in text) 3'. Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV. Some of these unusual structural features are shared by several of the known 5S RNA sequences from mycoplasmas. However, the characteristic bloc of deletions found in helix V of these mycoplasma 5S RNAs is not present in the 5S RNA of S. cremoris.     

Two zinc finger proteins from Xenopus laevis bind the same region of 5S RNA but with different nuclease protection patterns.

Immature oocytes from Xenopus laevis contain a 42S ribonucleoprotein particle (RNP) containing 5S RNA, tRNA, a 43 kDa protein, and a 48 kDa protein. A particle containing 5S RNA and the 43 kDa protein (p43-5S) liberated from the 42S particle upon brief treatment with urea can be purified by anion exchange chromatography. The purified p43-5S RNA migrates as a distinct species during electrophoresis on native polyacrylamide gels. Radiolabeled 5S RNA can be incorporated into the p43-5S complex by an RNA exchange reaction. The resulting complexes containing labeled 5S RNA have a mobility on polyacrylamide gels identical to that of purified p43-5S RNPs. RNP complexes containing 5S RNA labeled at either the 5' or 3' end were probed with a variety of nucleases in order to identify residues protected by p43. Nuclease protection assays performed with alpha-sarcin indicate that p43 binds primarily helices I, II, IV, and V of 5S RNA. This is the same general binding site observed for TFIIIA on 5S RNA. Direct comparison of the binding sites of p43 and TFIIIA with T1 and cobra venom nucleases reveals striking differences in the protection patterns of these two proteins.     

Ribosomal RNA genes of Saccharomyces cerevisiae. I. Physical map of the repeating unit and location of the regions coding for 5 S, 5.8 S, 18 S, and 25 S ribosomal RNAs.

The organization of the ribosomal DNA repeating unit from Saccharomyces cerevisiae has been analyzed. A cloned ribosomal DNA repeating unit has been mapped with the restriction enzymes Xma 1, Kpn 1, HindIII, Xba 1, Bgl I + II, and EcoRI. The locations of the sequences which code for 5 S, 5.8 S, 18 S, and 25 S ribosomal RNAs have been determined by hybridization of the purified RNA species with restriction endonuclease generated fragments of the repeating unit. The position of the 5.8 S ribosomal DNA sequences within the repeat was also established by sequencing the DNA which codes for 83 nucleotides at the 5' end of 5.8 S ribosomal RNA. The polarity of the 35 S ribosomal RNA precursor has been established by a combination of hybridization analysis and DNA sequence determination and is 5'-18 S, 5.8 S, 25 S-3'.     

3'' Terminal labelling of RNA of RNA with beta-32P-pyrophosphate group and its application to the sequence analysis of 5S RNA from Streptomyces griseus.

Nucleotide pyrophosphate transferase isolated from Streptomyces griseus is used to transfer pyrophosphate group from gamma-32P-ATP to the 3'-OH of tRNA, generating a strictly terminal label at its 3' end. Using yeast tRNAPhe as model compound, it is demonstrated that the labelled molecule is suitable for rapid gel sequencing by both enzymatic and chemical methods. RNA molecules terminated by pyrimidine nucleoside are poor pyrophosphate acceptors. To label RNAs of this kind, first guanosine 5'-phosphate 3'-(beta-32P)-pyrophosphate (pGpp) is prepared from gamma-32P-ATP and GMP by nucleotide pyrophosphate transferase. pGpp is then ligated to the 3' end of RNA by T4 RNA ligase. The complete nucleotide sequence of 5S RNA from Streptomyces griseus is established by rapid gel sequencing methods performed on 3'-(beta-32P)-pyrophosphate labelled molecule.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Escherichia coli 23S ribosomal RNA truncated at its 5'' terminus.

In a strain of E. coli deficient in RNase III (ABL1), 23S rRNA has been shown to be present in incompletely processed form with extra nucleotides at both the 5' and 3' ends (King et al., 1984, Proc. Natl. Acad. Sci. U.S. 81, 185-188). RNA molecules with four different termini at the 5' end are observed in vivo, and are all found in polysomes. The shortest of these ("C3") is four nucleotides shorter than the accepted mature terminus. In growing cells of both wild-type and mutant strains up to 10% of the 23S rRNA chains contain the 5' C3 terminus. In stationary phase cells, the proportion of C3 termini remains the same in the wild-type cells; but C3 becomes the dominant terminus in the mutant. Species C3 is also one of the 5' termini of 23S rRNA generated in vitro from larger precursors by the action of purified RNase III. We therefore suggest that some form of RNase III may still exist in the mutant; and since no cleavage is detectable at any other RNase III-specific site, the remaining enzyme would have a particular affinity for the C3 cleavage site, especially in stationary phase cells. We raise the question whether the C3 terminus has a special role in cellular metabolism.     

Nucleotide sequence of the 5'- and 3'- domains for rabbit 18S ribosomal RNA.

By direct RNA sequence analysis we have determined the primary structures of both the 5' and 3' domains for rabbit 18S ribosomal RNA. Purified 18S rRNA was labeled in vitro at either its 5' or 3' terminus with 32P, base-specifically fragmented enzymatically and chemically, and the resulting fragments electrophoretically fractionated by size in adjacent lanes of 140 cm long polyacrylamide sequencing gels run in 90% formamide. A phylogenetic comparison of both the mammalian 5' proximal 400 residues and the 3' distal 301 nucleotides with the previously determined yeast and Xenopus laevis 18S rRNA sequence shows extensive conservation interspersed with tracts having little homology. Clusters of G + C rich sequences are present within the mammalian 5' domain which are entirely absent in both the Xenopus laevis and yeast 18S rRNAs. Most base differences and insertions within the mammalian 18S rRNA when compared with yeast or Xenopus rRNA result in an increase in the G + C content of these regions. We have found nucleotide sequence analysis of the ribosomal RNA directly permits detection of both cistron heterogeneities and mapping of many of the modified bases.     

Terminal structure mediates 5 S rRNA stability and integration during ribosome biogenesis

Formation of the eukaryotic ribosomal 5 S RNA-protein complex has been shown to be critical to ribosome biogenesis and has been speculated to contribute to a quality control mechanism that helps ensure that only normal precursors are processed and assembled into active ribosomes. To study the structural basis of these observations, the RNA-protein interface in the 5 S RNA-protein complex of the yeast (Saccharomyces cerevisiae) ribosome was examined based on a systematic introduction of targeted base substitutions in the RNA sequence. Most base substitutions had little or no effect on the efficiency of complex formation, but large effects were observed when changes disrupted helix I, the secondary structure formed between the interacting termini. Again, only modest effects were evident when the extended 3' end of the mature RNA molecule was altered, but essentially no complex was formed when the 5' end of the mature 5 S RNA sequence was artificially extended by one nucleotide. In vitro analyses demonstrated that this extension also dramatically altered the maturation of 5 S rRNA precursor molecules as well as the stability of the mature 5 S rRNA. Taken together, the results indicate that in the course of RNA maturation, the 5 S RNA-binding protein binds precisely over or "caps" the termini in a critical manner that protects the RNA from further degradation.