Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.     

Computer-aided detection and alignment of weakly homologous amino acid sequences of RNA replicase beta (MS2 phage) and DNA polymerases (T7 phage and E. coli)

Alignment of the amino acid (aa) sequences of T7 phage DNA polymerase (DPase), E. coli DNA polymerase I (Pol I) and MS2 phage RNA replicase beta subunit (MS2 Repl) were established by computer-aided methods. The results showed that the entire length (aa's 16-704) of T7 DPase is homologous to Pol I aa's 207-928(C-term) with 21.5% aa identity, and that domains I (aa's-1-311) and II (312-451(C-term] were found to be homologous to each other and to N-terminal region of T7 DPase (aa's 1-250). Thus these enzymes and domains are homologous to one another and must have evolved from a co-ancestral enzyme.     

The nucleotide sequence of the cloned rpoD gene for the RNA polymerase sigma subunit from E coli K12.

We have determined the nucleotide sequence of the rpoD gene which codes for the sigma subunit of RNA polymerase from E. coli K12. The gene, which we formerly cloned as a HindIII restriction fragment in the transducing phage, charon 25, was recloned into several plasmids. We have determined a 2600 base pair DNA sequence which includes the entire structural gene for sigma. The resulting amino acid sequence agrees with previous information obtained about sigma including the amino acid composition, partial sequence data for the N-terminus, the highly acidic nature of the polypeptide, and the cleavage pattern at cysteines. The molecular weight of 70,263 daltons calculated for the 613 amino acid polypeptides is significantly lower than had been determined previously by SDS polyacrylamide gel analysis.     

The beta subunit of the Escherichia coli DNA polymerase III holoenzyme interacts functionally with the catalytic core in the absence of other subunits

We have previously demonstrated that the addition of a stoichiometric excess of the beta subunit of Escherichia coli DNA polymerase III holoenzyme to DNA polymerase III or holoenzyme itself can lead to an ATP-independent increase in the processivity of these enzyme forms (Crute, J. J., LaDuca, R. J., Johanson, K. O., McHenry, C. S., and Bambara, R. A. (1983) J. Biol. Chem. 258, 11344-11349). Here, we show that the beta subunit can interact directly with the catalytic core of the holoenzyme, DNA polymerase III, generating a new form of the enzyme with enhanced catalytic and processive capabilities. The addition of saturating levels of the beta subunit to the core DNA polymerase III enzyme results in as much as a 7-fold stimulation of synthetic activity. Two populations of DNA products were generated by the DNA polymerase III X beta enzyme complex. Short products resulting from the addition of 5-10 nucleotides/primer fragment were generated by DNA polymerase III in the presence and absence of added beta subunit. A second population of much longer products was generated only in beta-supplemented DNA polymerase III reactions. The DNA polymerase III-beta reaction was inhibited by single-stranded DNA binding protein and was unaffected by ATP, distinguishing it from the holoenzyme-catalyzed reaction. Complex formation of the DNA polymerase III core enzyme with beta increased the residence time of the enzyme on synthetic DNA templates. Our results demonstrate that the beta stimulation of DNA polymerase III can be attributed to a more efficient and highly processive elongation capability of the DNA polymerase III X beta complex. They also prove that at least part of beta's normal contribution to the DNA polymerase III holoenzyme reaction takes place through interaction with DNA polymerase III core enzyme components to produce the essential complex necessary for efficient elongation in vivo.     

An inhibitor of host sigma-stimulated core enzyme activity that purifies with DNA-dependent RNA polymerase of E. coli following T4 phage infection

The content of the sigma subunit (as detected by gel electrophoresis) and activity with T4 DNA were examined with RNA polymerase fractions from both normal and T4 phage-infected $\text{E. coli}$. Sigma-containing fractions and core enzymes were obtained by phosphocellulose column chromatography. The sigma-containing fraction of the enzyme from infected cells, although somewhat stimulatory to both core enzymes alone, inhibits the normal sigma-stimulated activity of the core enzyme from infected cells at both low and high KCl concentration. Normal core enzyme activity is inhibited only at high KCl concentration.     

On the binding of tRNA to Escherichia coli RNA polymerase. Interactions between the core enzyme, DNA and tRNA

We have investigated the interplay between the binding of tRNA and DNA to core RNA polymerase. We show that the monomer core enzyme can bind stably to either DNA or tRNA, whereas the dimer core can fix both DNA and tRNA in a stable ternary complex. We have examined the kinetics of the exchange between DNA and tRNA bound to the core enzyme. DNA bound to monomer core can be rapidly displaced by tRNA without prior dissociation of the core from the DNA. Similarly tRNA bound to the core can be displaced by DNA without prior dissociation of the tRNA. We confirm the result of Hinkle and Chamberlin [J. Mol. Biol. 70, 157-185 (1972)] that, in contrast, the core enzyme must first dissociate from one DNA molecule before it can transfer to another DNA. As this dissociation is very slow we suggest that, in vivo, the tRNA can act as a 'porter' providing the core enzyme with a more kinetically favourable path to transfer from one DNA site to another.     

The relationship between the spoT gene, the synthesis of stable RNA, ribosomal proteins, and the beta beta' subunits of RNA polymerase following a nutritional shiftup of Escherichia coli.

The level of ppGpp and rates of synthesis of stable RNA, ribosomal protein, and the beta and beta' subunits of RNA polymerase were measured following a nutritional shiftup in Escherichia coli strains, NF 929 (spoT+) and NF 930 (spoT-). In the spoT+ strain, ppGpp levels decreased 50% within 2 min following shiftup, and the rates of synthesis of stable RNA, ribosomal proteins, and the beta and beta' subunits of RNA polymerase increased with little or no lag. In contrast, in the spoT- strain, ppGpp levels transiently increased 40% during the first 6 min following shiftup. An inhibition in the rate of stable RNA synthesis and a delay in the increased synthesis of ribosomal proteins and beta and beta' subunits occurred concurrently with the transient increase in ppGpp. In addition, the DNA-dependent synthesis in vitro of the beta and beta' subunits of RNA polymerase was inhibited by physiological levels of ppGpp. Because of the timing and magnitude of the changes in ppGpp levels in the spoT- strain versus the timing when the new rates of stable RNA, ribosomal protein, and beta and beta' subunits synthesis are reached, it is concluded that ppGpp is not the sole element regulating the expression of these genes.     

The nucleotide sequence of the atp genes coding for the F0 subunits a, b, c and the F1 subunit delta of the membrane bound ATP synthase of Escherichia coli

Summary The nucleotide sequence has been determined of a 2.500 base pair segment of the E. coli chromosome located between 3.75 and 6.25 kb counterclockwise of the origin of replication at 83.5 min. The sequence contains the atp genes coding for subunits a-, b-, c-, - and part of the -subunit of the membrane bound ATP synthase. The precise start positions of the atpE (c), atpF (b), atpH () and atpA () genes have been defined by comparison of the potential coding sequences with the known amino acid sequence of the c-subunit and the determined N-terminal amino acid sequences of the respective subunits. The genes are expressed in the counterclockwise direction. Their order (counterclockwise) is: atpB (a), atpE (c), atpF (b), atpH () and atpA (). The coding sequences for subunits b and yield polypeptides of 156 and 177 amino acids, respectively, in accordance with the established sizes of these subunits; the one for the c-subunit, the DCCD binding protein, fits perfectly with its known sequence of 79 amino acids. The a-subunit is comprised within a coding sequence yielding a polypeptide of 271 amino acids. It is suggested, however, that the a-subunit (atpB) contains only 201 amino acids, in accordance with its known size, starting from a translation initiation site within the larger coding sequence. The stoichiometry of the F₀ sector subunits is discussed and a model is proposed for the functioning of the highly charged b-subunit of the F₀ sector as the actual proton conductor.Abbreviations atp denotes genes coding for the ATP synthase subunits. This symbol has been proposed as a replacement of unc (von Meyenburg and Hansen 1980; Hansen et al. 1981 b); the alternative symbol pap has also been proposed (Kanazawa et al. 1981). For other genetic symbols see Bachmann and Low (1980) - bp basepair - kb kilobase (pair) - kD kilo Dalton - DCCD N N,N-Dicyclohexylcarbodiimide - SDS Sodium Dodecyl Sulphate     

A common sequence motif, -E-G-Y-A-T-A-, identified within the primase domains of plasmid-encoded I- and P-type DNA primases and the alpha protein of the Escherichia coli satellite phage P4.

DNA primases encoded by the conjugative plasmids ColIb-P9 (IncI1), RP4, and R751 (IncP), and the protein of the Escherichia coli satellite phage P4 alpha were shown to contain a common amino acid sequence motif -E-G-Y-A-T-A-. The P4 alpha gene product, required for initiation of phage DNA replication, exhibits primase activity on single-stranded circular DNA templates. This priming activity resembles the enzymatic activity of DNA primases encoded by conjugative plasmids in terms of template utilization and the ability to synthesize primers that can be elongated by DNA polymerase III holoenzyme. The -E-G-Y-A-T-A- motif is part of an extended sequence region most conserved within the primase domains of the four enzymes. Single amino acid substitutions generated in the -E-G-Y-A-T-A- motif of the RP4 TraC2 and the P4 alpha protein affect priming activity, supporting the hypothesis that the conserved sequence motif is part of the active center for primase function. A mutation that eliminates priming activity causes P4 phage to grow poorly and to depend upon the host dnaG primase. Computer analysis identified two additional sequence motifs within the amino acid sequence of the P4 alpha protein: a potential zinc-finger motif and a "type A" nucleotide binding site, both strikingly similar to sequence motifs described in various DNA primases and helicases.     

Reactions of a fluorescent ATP analog, 2'-(5-dimethyl-aminonaphthalene-1-sulfonyl) amino-2'-deoxyATP, with E. coli F1-ATPase and its subunits: the roles of the high affinity binding site in the alpha subunit and the low affinity binding site in the beta subunit

We performed kinetic studies on the reactions of a fluorescent ATP analog, 2'-(5-dimethyl-aminonaphthalene-1-sulfonyl) amino-2'-deoxyATP (DNS-ATP), with E. coli F1-ATPase (EF1) and its subunits, to clarify the role of each subunit in the ATPase reaction. The following results were obtained. 1. One mol of EF1, which contains nonexchangeable 2 mol ATP and 0.5 mol ADP, binds 3 mol of DNS-ATP. The apparent dissociation constant, in the presence of Mg2+, was 0.23 microM. Upon binding, the fluorescence intensity of DNS-ATP at 520 nm increased exponentially with t1/2 of 35 s, and reached 3.5 times the original fluorescence level. Following the fluorescence increase, DNS-ATP was hydrolyzed, and the fluorescence intensity maintained its enhanced level. 2. The addition of an excess of ATP over the EF1-DNS-nucleotide complex, in the presence of Mg2+, decreased the fluorescence intensity rapidly, indicating the acceleration of DNS-nucleotide release from EF1. ADP and GTP also decreased the fluorescence intensity. 3. DCCD markedly inhibited the accelerating effect of ATP on DNS-nucleotide release from EF1 and the EF1-DNS-ATPase or -ATPase activity in a steady state. On the other hand, DCCD only slightly inhibited the fluorescence increase of DNS-ATP, due to its binding to EF1, and the rate of single cleavage of 1 mol of DNS-ATP per mol of alpha subunit of EF1. 4. In the presence of Mg2+, 0.65-0.82 mol of DNS-ATP binds to 1 mol of the isolated alpha subunit of EF1 with an apparent dissociation constant of 0.06-0.07 microM. Upon binding, the fluorescence intensity of DNS-ATP at 520 nm increased 1.55 fold very rapidly (t1/2 less than 1 s). No hydrolysis of DNS-ATP was observed upon the addition of the isolated alpha subunit. The fluorescence intensity of DNS-ATP was unaffected by the addition of the isolated beta subunit. DNS-ATP was also unhydrolyzed by the isolated beta subunit. 5. EF1-ATPase was reconstituted from alpha, beta, and gamma subunits in the presence of Mg2+ and ATP. The kinetic properties of the fluorescence change of DNS-ATP in the reaction with the reconstituted EF1-ATPase were quite similar to those of native EF1. Most of our findings are consistent with a simple mechanism that the high affinity catalytic site and low affinity regulatory site exist in the alpha subunit and beta subunit, respectively. However, the findings mentioned in (4) suggest that the binding of the alpha and beta subunit, which is mediated by the gamma subunit, induces conformational change(s) in the ATP binding site located probably in the alpha subunit, and that the conformational change(s) is essential to exert the full hydrolyzing activity.