共查询到20条相似文献,搜索用时 265 毫秒
1.
Fierens K Gils A Sansen S Brijs K Courtin CM Declerck PJ De Ranter CJ Gebruers K Rabijns A Robben J Campenhout S Volckaert G Delcour JA 《The FEBS journal》2005,272(22):5872-5882
Wheat endoxylanase inhibitor TAXI-I inhibits microbial glycoside hydrolase family 11 endoxylanases. Crystallographic data of an Aspergillus niger endoxylanase-TAXI-I complex showed His374 of TAXI-I to be a key residue in endoxylanase inhibition. Its role in enzyme-inhibitor interaction was further investigated by site-directed mutagenesis of His374 into alanine, glutamine or lysine. Binding kinetics and affinities of the molecular interactions between A. niger, Bacillus subtilis, Trichoderma longibrachiatumendoxylanases and wild-type TAXI-I and TAXI-I His374 mutants were determined by surface plasmon resonance analysis. Enzyme-inhibitor binding was in accordance with a simple 1 : 1 binding model. Association and dissociation rate constants of wild-type TAXI-I towards the endoxylanases were in the range between 1.96 and 36.1 x 10(4)m(-1) x s(-1) and 0.72-3.60 x 10(-4) x s(-1), respectively, resulting in equilibrium dissociation constants in the low nanomolar range. Mutation of TAXI-I His374 to a variable degree reduced the inhibition capacity of the inhibitor mainly due to higher complex dissociation rate constants (three- to 80-fold increase). The association rate constants were affected to a smaller extent (up to eightfold decrease). Substitution of TAXI-I His374 therefore strongly affects the affinity of the inhibitor for the enzymes. In addition, the results show that His374 plays a critical role in the stabilization of the endoxylanase-TAXI-I complex rather than in the docking of inhibitor onto enzyme. 相似文献
2.
Complete disulfide bond assignment of a recombinant immunoglobulin G4 monoclonal antibody 总被引:1,自引:0,他引:1
Surface plasmon resonance biosensor analysis was used to evaluate the thermodynamics and binding kinetics of naturally occurring and synthetic cobalamins interacting with vitamin B(12) binding proteins. Cyanocobalamin-b-(5-aminopentylamide) was immobilized on a biosensor chip surface to determine the affinity of different cobalamins for transcobalamin, intrinsic factor, and nonintrinsic factor. A solution competition binding assay, in which a surface immobilized cobalamin analog competes with analyte cobalamin for B(12) protein binding, shows that only recombinant human transcobalamin is sensitive to modification of the corrin ring b-propionamide of cyanocobalamin. A direct binding assay, where recombinant human transcobalamin is conjugated to a biosensor chip, allows kinetic analysis of cobalamin binding. Response data for cyanocobalamin binding to the transcobalamin protein surface were globally fitted to a bimolecular interaction model that includes a term for mass transport. This model yields association and dissociation rate constants of k(a) = 3 x 10(7) M(-1) s(-1) and k(d) = 6 x 10(-4) s(-1), respectively, with an overall dissociation constant of K(D) = 20 pM at 30 degrees C. Transcobalamin binds cyanocobalamin-b-(5-aminopentylamide) with association and dissociation rates that are twofold slower and threefold faster, respectively, than transcobalamin binding to cyanocobalamin. The affinities determined for protein-ligand interaction, using the solution competition and direct binding assays, are comparable, demonstrating that surface plasmon resonance provides a versatile way to study the molecular recognition properties of vitamin B(12) binding proteins. 相似文献
3.
《MABS-AUSTIN》2013,5(5):491-504
The in vitro binding of monomeric, dimeric and multimeric forms of monoclonal IgG1 molecules, designated mAb1 and mAb2, to the extracellular domains of Fcγ receptors RI, RIIA and RIIIB were investigated using a surface plasmon resonance (SPR) based biosensor technique. Stable noncovalent and covalent dimers of mAb1 and mAb2, respectively, were isolated from CHO cell expressed materials. The dissociation constants of monomeric mAb1 and mAb2 were determined to be 1 nM for the FcγRI-binding and 6–12 μM for the FcγRIIA- and FcγRIIIB-binding. Dimeric mAb1 and mAb2 exhibited increased affinities, by 2-3 fold for FcγRI and 200-800 fold for FcγRIIA and FcγRIIIB. Further increases in binding were observed when the antibodies formed large immune complexes with multivalent antigens, but not in a linear relation with size. The binding properties of monomeric mAb2 were identical with and without a bound monovalent antigen, indicating that antigen-binding alone does not induce measurable change in binding of antibodies to Fcγ receptors. Dimerization is sufficient to show enhancement in the receptor binding. Given the wide distribution of the low-affinity Fcγ receptors on immune effector cells, the increased affinities to aggregated IgG may lead to some biological consequences, depending on the subsequent signal transduction events. The SPR-based in vitro binding assay is useful in evaluating Fcγ receptor binding of various species in antibody-based biotherapeutics. 相似文献
4.
TLR4 together with CD14 and MD-2 forms a pattern recognition receptor that plays an initiating role in the innate immune response to Gram-negative bacteria. Here, we employed the surface plasmon resonance technique to investigate the kinetics of binding of LPS to recombinant CD14, MD-2 and TLR4 proteins produced in insect cells. The dissociation constants (KD) of LPS for immobilized CD14 and MD-2 were 8.7 microM, and 2.3 microM, respectively. The association rate constant (Kon) of LPS for MD-2 was 5.61 x 10(3) M-1S-1, and the dissociation rate constant (Koff) was 1.28 10 2 S 1, revealing slow association and fast dissociation with an affinity constant KD of 2.33 x 10-6 M at 25 degreesC. These affinities are consistent with the current view that CD14 conveys LPS to the TLR4/MD-2 complex. 相似文献
5.
6.
Dettmann W Grandbois M André S Benoit M Wehle AK Kaltner H Gabius HJ Gaub HE 《Archives of biochemistry and biophysics》2000,383(2):157-170
Protein-carbohydrate interactions are involved in diverse regulatory processes. To help understand the mechanics and kinetics of dissociation of receptor-ligand complexes, we have analyzed the separation of lactose and the N-glycan chains of asialofetuin (ASF) from three lectins and an immunoglobulin G fraction by surface plasmon resonance at zero force and by atomic force microscopy with variations of the external force. While the (AB)2 agglutinins from Ricinus communis (RCA) and Viscum album (VAA) show structural homology, the homodimeric galectin-1 from bovine heart (BHL) has no similarity to the two plant lectins except for sharing this monosaccharide specificity. The beta-galactoside-binding immunoglobulin G (IgG) fraction from human serum provides a further model system with distinct binding-site architecture. The k(off) constants for the two plant agglutinins were independent of the nature of the ligand at 1.1-1.3 x 10(-3) s(-1), whereas the geometry of ligand and binding site presentation affected this parameter for BHL (0.5 x 10(-3) s(-1) for lactose and 1 x 10(-3) s(-1) for ASF) and IgG (1.3 x 10(-3) s(-1) for lactose and 0.55 x 10(-3) s(-1) for ASF). When assessing comparatively the rupture forces at a loading rate of 3 nN/s with lactose as ligand, 34 +/- 6 pN (BHL), 36 +/- 4 pN (IgG), 47 +/- 7 pN (VAA), and 58 +/- 9 pN (RCA) were measured. For the same loading rate the rupture forces for the receptor-ASF interactions were found to be 37 +/- 3 pN (BHL), 43 +/- 5 pN (VAA), 45 +/- 6 pN (IgG), and 65 +/- 9 pN (RCA). The variation of the pulling velocity revealed in all cases a linear dependence between the rupture force and the natural logarithm of the loading rate. Performing probability density and Monte Carlo calculations, the potential barrier widths, which determine the inverse dynamic dependence with the rate of force elevation, increased from 4 A (RCA) and 7 A (VAA and IgG) to 10 A (BHL) for the receptor-lactose interactions. Presenting ASF as ligand potential widths of 4 A for RCA and IgG and 6 A for VAA and BHL were obtained. Since the dissociation kinetics at zero force apparently cannot predict the behavior in force-driven experiments, these results reveal new insights into biological functions. The dissociation kinetics under force helps to explain the difference in the toxic potency of VAA and RCA and points to a function of the galectin in cis-crosslinking and in transient trans-bridging. 相似文献
7.
K Maenaka P A van der Merwe D I Stuart E Y Jones P Sondermann 《The Journal of biological chemistry》2001,276(48):44898-44904
Fcgamma receptors (FcgammaRs) are expressed on all immunologically active cells. They bind the Fc portion of IgG, thereby triggering a range of immunological functions. We have used surface plasmon resonance to analyze the kinetic and thermodynamic properties of the interactions between the ectodomains of human low affinity FcgammaRs (FcgammaRIIa, FcgammaRIIb, and FcgammaRIIIb-NA2) and IgG1 or the Fc fragment of IgG1. All three receptors bind Fc or IgG with similarly low affinities (K(D) approximately 0.6-2.5 microm) and fast kinetics, suggesting that FcgammaR-mediated recognition of aggregated IgG and IgG-coated particles or cells is mechanistically similar to cell-cell recognition. Interestingly, the Fc receptors exhibit distinct thermodynamic properties. Whereas the binding of the FcgammaRIIa and FcgammaRIIb to Fc is driven by favorable entropic and enthalpic changes, the binding of FcgammaRIII is characterized by highly unfavorable entropic changes. Although the structural bases for these differences remain to be determined, they suggest that the molecular events coupled to the binding differ among the low affinity FcgammaRs. 相似文献
8.
Direct comparison of binding equilibrium, thermodynamic, and rate constants determined by surface- and solution-based biophysical methods 总被引:9,自引:0,他引:9
Day YS Baird CL Rich RL Myszka DG 《Protein science : a publication of the Protein Society》2002,11(5):1017-1025
The binding interactions of small molecules with carbonic anhydrase II were used as model systems to compare the reaction constants determined from surface- and solution-based biophysical methods. Interaction data were collected for two arylsulfonamide compounds, 4-carboxybenzenesulfonamide (CBS) and 5-dimethyl-amino-1-naphthalene-sulfonamide (DNSA), binding to the enzyme using surface plasmon resonance, isothermal titration calorimetry, and stopped-flow fluorescence. We demonstrate that when the surface plasmon resonance biosensor experiments are performed with care, the equilibrium, thermodynamic, and kinetic constants determined from this surface-based technique match those acquired in solution. These results validate the use of biosensor technology to collect reliable data on small molecules binding to immobilized macromolecular targets. Binding kinetics were shown to provide more detailed information about complex formation than equilibrium constants alone. For example, although carbonic anhydrase II bound DNSA with twofold higher affinity than CBS, kinetic analysis revealed that CBS had a fourfold slower dissociation rate. Analysis of the binding and transition state thermodynamics also revealed significant differences in the enthalpy and entropy of complex formation. The lack of labeling requirements, high information content, and high throughput of surface plasmon resonance biosensors will make this technology an important tool for characterizing the interactions of small molecules with enzymes and receptors. 相似文献
9.
The coexistence of ERalpha and ERbeta suggests that active receptor complexes are present as homo- or heterodimers. In addition each of three forms of active receptors may trigger different cellular responses. A real-time biosensor based on surface plasmon resonance was used as instrument to determine binding kinetics of homo- and heterodimerization of estrogen receptor alpha and beta. Partially purified full-length estrogen receptor alpha was expressed intracellularly as a C-terminal fusion to a hexa-histidine tag using the baculovirus-expression system. Purified estrogen receptor alpha and beta without tags were used as partners in the dimerization process. An association rate constant of 3.6 x 10(3) to 1.5 x 10(4)M(-1)s(-1) for the homodimer formation of ERalpha and 5.7 x 10(3) to 1.5 x 10(4)M(-1)s(-1) for the heterodimer formation was found assuming a pseudo first-order reaction kinetic. The equilibrium dissociation constant for homodimerization of ERalpha was 2.2 x 10(-8) to 5.4 x 10(-8) and 1.8 x 10(-8) to 2.6 x 10(-8)M for the heterodimer formation. The homo- and heterodimer formation was characterized by a slow association kinetics and kinetic rate constants were within the same range. 相似文献
10.
Selective distinction at equilibrium between the two alpha-neurotoxin binding sites of Torpedo acetylcholine receptor by microtitration 总被引:1,自引:0,他引:1
The binding of the monoiodinated alpha-neurotoxin I from Naja mossambica mossambica to the membrane-bound acetylcholine receptor from Torpedo marmorata was investigated using a new picomolar-sensitive microtitration assay. From equilibrium binding studies a non-linear Scatchard plot demonstrated two populations of binding sites characterized by the two dissociation constants Kd1 = 7 +/- 4 pM and Kd2 = 51 +/- 16 pM and having equal binding capacities. These two populations differed in their rate of dissociation (k-1.1 = 25 x 10(-6) s-1 and k-1.2 = 623 x 10(-6) s-1 respectively), but not in their rate of formation of the toxin-receptor complex (k + 1 = 11.7 x 10(6) M-1 s-1). From these rate constants the same two values of dissociation constant were deduced (Kd1 = 2 pM and Kd2 = 53 pM). All the specific binding was prevented by the cholinergic antagonists alpha-bungarotoxin and d-tubocurarine. In addition, a biphasic competition phenomenon allowed us to differentiate between two d-tubocurarine sites (Kda = 103 nM and Kdb = 13.7 microM respectively). Evidence is provided indicating that these two sites are shared by d-tubocurarine and alpha-neurotoxin I, with inverse affinities. Fairly conclusive agreement between our equilibrium, kinetic and competition data demonstrates that the two high-affinity binding sites for this short alpha-neurotoxin are selectively distinguishable. 相似文献
11.
Nakatani K Kobori A Kumasawa H Goto Y Saito I 《Bioorganic & medicinal chemistry》2004,12(12):3117-3123
Naphthyridine dimer composed of two naphthyridine chromophores and a linker connecting them strongly, and selectively, binds to the guanine-guanine mismatch in duplex DNA. The kinetics for the binding of the G-G mismatch to the naphthyridine dimer was investigated by surface plasmon resonance assay. The sensor surface was prepared by immobilizing naphthyridine dimer through a long poly(ethylene oxide) linker with the ligand density of 9.1 x 10(-12) fmolnm(-2). The kinetic analyses revealed that the binding of the G-G mismatch was sequence dependent on the flanking base pairs, and the G-G mismatches flanking at least one G-C base pair bound to the surface via a two-step process with a 1:1 DNA-ligand stoichiometry. The first association rate constant for the binding of the G-G mismatch in the 5'-CGG-3'/3'-GGC-5' sequence to the naphthyridine dimer-immobilized sensor surface was 3.2 x 10(3)M(-1)s(-1) and the first dissociation rate constant was 1.4 x 10(-2)s(-1). The association and dissociation rate constants for the second step were insensitive to the flanking sequences, and were almost of the same order of magnitude as the first dissociation rate constant. This indicates that the second step had only a small energetic contribution to the binding. The association constant calculated from kinetic parameters was 2.7 x 10(5)M(-1), which is significantly smaller than the apparent association constants obtained from experiments in solution. Electrospray ionization time-of-flight (ESI-TOF) mass spectrometry on the complex produced from the G-G mismatch and naphthyridine dimer showed the formation of the 1:1 complex and a 1:2 DNA-ligand complex in solution. The latter complex became the dominant complex when a six-fold excess of naphthyridine dimer was added to DNA. 相似文献
12.
《MABS-AUSTIN》2013,5(2):331-343
The neonatal Fc receptor (FcRn) is expressed by cells of epithelial, endothelial and myeloid lineages and performs multiple roles in adaptive immunity. Characterizing the FcRn/IgG interaction is fundamental to designing therapeutic antibodies because IgGs with moderately increased binding affinities for FcRn exhibit superior serum half-lives and efficacy. It has been hypothesized that 2 FcRn molecules bind an IgG homodimer with disparate affinities, yet their affinity constants are inconsistent across the literature. Using surface plasmon resonance biosensor assays that eliminated confounding experimental artifacts, we present data supporting an alternate hypothesis: 2 FcRn molecules saturate an IgG homodimer with identical affinities at independent sites, consistent with the symmetrical arrangement of the FcRn/Fc complex observed in the crystal structure published by Burmeister et al. in 1994. We find that human FcRn binds human IgG1 with an equilibrium dissociation constant (KD) of 760 ± 60 nM (N = 14) at 25°C and pH 5.8, and shows less than 25% variation across the other human subtypes. Human IgG1 binds cynomolgus monkey FcRn with a 2-fold higher affinity than human FcRn, and binds both mouse and rat FcRn with a 10-fold higher affinity than human FcRn. FcRn/IgG interactions from multiple species show less than a 2-fold weaker affinity at 37°C than at 25°C and appear independent of an IgG's variable region. Our in vivo data in mouse and rat models demonstrate that both affinity and avidity influence an IgG's serum half-life, which should be considered when choosing animals, especially transgenic systems, as surrogates. 相似文献
13.
Cheung PY Fong CC Ng KT Lam WC Leung YC Tsang CW Yang M Wong MS 《Journal of biochemistry》2003,134(5):731-738
The interactions of two pyridoxal-5-phosphate (PLP)-dependent enzymes, alanine aminotransferase (ALT) and glutamate decarboxylase (GAD), with pyridoxal kinase (PK) were studied by fluorescence polarization as well as surface plasmon resonance techniques. The results demonstrated that PK can specifically bind to ALT and GAD. Moreover, binding profiles of both enzymes to immobilized PK were altered by excess amount of PLP. The equilibrium affinity constants for ALT in the absence and presence of PLP are 20.4 x 10(4) M(-1)and 6.7 x 10(4) M(-1), and for GAD are 37 x 10(4) M(-1)and 20.8 x 10(4) M(-1), respectively. It appears that specific interactions occur between PK and PLP-dependent enzymes, and the binding affinities of PK for PLP-dependent enzymes decrease in the presence of PLP. The results support our hypothesis that PLP transfer from PK to PLP-dependent enzymes requires a specific interaction between PK and the enzyme. 相似文献
14.
The binding interaction between amphotericin B and human serum albumin (HSA) has been studied using surface plasmon resonance (SPR) spectroscopy combined with a fluorescence quenching method to confirm the binding kinetic results. In this paper, the SPR method used to study the drug-protein interaction has been described in detail. The association rate constant, dissociation rate constant and the equilibrium association constant of amphotericin B binding to HSA were obtained using this method. To confirm the feasibility of the SPR method, a fluorescence quenching method was performed to obtain the equilibrium constant. In order to obtain more accurate results, experiment design was used to optimize the fluorescence quenching process. The two equilibrium association constants obtained using the two methods were 4.017 x 10(4) M(-1) (SPR) and 3.656 x 10(4) M(-1) (fluorescence quenching method) respectively. 相似文献
15.
Paetz A Sack M Thepen T Tur MK Bruell D Finnern R Fischer R Barth S 《Biochemical and biophysical research communications》2005,338(4):1811-1817
The ectodomain of human FcgammaRI (rsCD64) was expressed in HEK 293T cells and purified by immobilized-metal affinity chromatography. Binding activity to human IgG was verified by ELISA and the isotype-specificity determined by a surface plasmon resonance inhibition assay was found to be the same as for native CD64. The active concentration of the rsCD64 preparation was derived using a solution competition assay and was used for the subsequent kinetic analysis. Binding curves were well described by a simple monovalent interaction model confirming the known stoichiometry of the interaction. Mass-transport limitation was prevented by using sufficiently low surface capacities. For binding to the recombinant mouse/human chimeric antibody cPIPP (IgG1/kappa) a high association rate of k(ass)=1.7 x 10(6) (M s)(-1) and a low dissociation rate of k(diss)=1.8 x 10(-4) s(-1) were observed. The derived dissociation equilibrium constant of K(D)=110 pM was significantly lower than that reported for binding to native FcgammaRI. 相似文献
16.
Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies. 相似文献
17.
We explored the use of a newly developed cuvette-based surface plasmon resonance (SPR) instrument (IBIS) to study peptide-protein interactions. We studied the interaction between the SH2 domain of lck and a phosphotyrosine peptide EPQY*EEIPIYL which was immobilized on a sensor chip. No indications for mass transport limitation (MTL) were observed when standard kinetic approaches were used. However, addition of competing peptide during dissociation revealed a high extent of rebinding. A dissociation rate constant (k(d)) of 0.6+/-0.1 s(-1) was obtained in the presence of large amounts of peptide. A simple bimolecular binding model, applying second-order kinetics for the cuvette system, could not adequately describe the data. Fits were improved upon including a step in the model which describes diffusion of the SH2 domain from the bulk to the sensor, especially for a surface with high binding capacity. From experiments in glycerol-containing buffers, it appeared that the diffusion rate decreased with higher viscosity. It is demonstrated that MTL during association and dissociation can be described by the same diffusion rate. A binding constant (K(D)) of 5.9+/-0.8 nM was obtained from the SPR equilibrium signals by fitting to a Langmuir binding isotherm, with correction for loss of free analyte due to binding. An association rate constant k(a) of 1.1(+/-0.2)x10(8) M(-1) x s(-1) was obtained from k(d)/K(D). The values for k(a) and k(d) obtained in this way were 2-3 orders larger than that from standard kinetic analysis, ignoring MTL. We conclude that in a cuvette the extent of MTL is comparable to that in a flow system. 相似文献
18.
The NahR regulatory protein activates the naphthalene catabolic operon through binding to the Psal promoter in the presence of salicylate. Here, we investigated in vitro binding interaction between NahR and Psal using purified functional recombinant NahR. The T7-tagged NahR was shown to exist as a monomer in solution. Electrophoretic mobility shift assay (EMSA) showed that purified NahR bound to Psal in 3 different forms, whereas surface plasmon resonance (SPR) showed on an SPR chip at ratios ranging from 1:1 (at 0.42 microM NahR) to 8:1 (at 6.8 microM NahR). The binding was slightly inhibited by salicylate, suggesting that salicylate may not be involved in the binding of NahR to the promoter, but rather may be important in the activation of prebound NahR. An examination of the binding kinetics by SPR for the interaction between NahR and Psal revealed that the equilibrium dissociation constant was approximately 2.44 x 10(-6) M and the association and dissociation rates were 7.82 x 10(4) M(-1) s(-1) and 0.191 s(-1), respectively. These results demonstrate for the first time that purified NahR binds as a monomer to Psal and undergoes multimerization. In addition, we present novel data on the kinetics of NahR binding. 相似文献
19.
The extracellular domain of human FcγRI which interacts with a human IgG was expressed as recombinant soluble human FcγRI (rshFcγRI) by Chinese hamster ovary (CHO) cell. Stable CHO cell clones with efficient expression of rshFcγRI were established based on a dihydrofolate reductase (DHFR)/methotrexate (MTX) gene-amplification system. The CHO clones efficiently produced rshFcγRI under high-density continuous culture in a bioreactor. After 53 days of culture, the number of cells had reached approximately 4 × 10? cells/mL in the bioreactor and the average production of rshFcγRI had reached 7.4 mg L-medium?1 day?1. Secreted rshFcγRI was purified to a homogeneous state using cation exchange and affinity chromatographies. The binding affinities of rshFcγRI to human IgG subclasses were determined using surface plasmon resonance analysis. The binding affinities of rshFcγRI to human IgG1/κ and IgG3/κ were high (1.59 × 10?1? and 2.81 × 10?1? M, respectively), whereas that of rshFcγRI to human IgG4/κ was lower binding affinity (1.41 × 10?? M). Binding to IgG2/κ was not detectable. Examination of circular dichroism spectra indicated that rshFcγRI was rich in β-structures and loop or turn structures, but there were few α-helices. These results may be valuable for further studies of the structure and function of human FcγRI. 相似文献
20.
Total internal reflection fluorescence microscopy has been used to investigate the binding of the soluble extracellular domain of mouse FcγRII (sFcγRII) to an anti-trinitrophenyl monoclonal mouse IgG2b (GK14.1) specifically bound to substrate-supported planar membranes composed of dipalmitoylphosphatidylcholine (DPPC) and trinitrophenylaminocaproyldipalmitoylphosphatidylethanolamine (TNP-cap-DPPE). The equilibrium dissociation constants for sFcγRII at GK14.1-coated TNP-cap-DPPE/DPPC planar membranes containing 0.5–25 mol% TNP-cap-DPPE were ≊1 μM. Total internal reflection with fluorescence photobleaching recovery was used to examine the dissociation kinetics. The fluorescence recovery curves were better described as a sum of two exponentials rather than by one exponential; the rates and fractional recoveries were ∼1s −1 (65%) and ≊0.1s−1 (35%). The similarity between the values of these equilibrium and kinetic parameters to those previously measured for the binding of IgG in solution to intact mouse FcγRII reconstituted into planar membranes suggests that conformational changes which may occur when IgG is constrained to a membrane surface do not significantly affect the equilibrium or kinetics of IgG-mouse FcγRII binding. The stoichiometry of sFcγRII-GK14.1 binding was 1:4, indicating that a significant fraction of the membrane-bound antibodies were not accessible for receptor binding. Possible mechanisms that might underlay the observed heterogeneity in sFcγRII-IgG binding kinetics are discussed. © 1997 John Wiley & Sons, Ltd. 相似文献