共查询到20条相似文献,搜索用时 15 毫秒
1.
Evolutionary conservation of methyl-accepting chemotaxis protein location in Bacteria and Archaea
下载免费PDF全文

Gestwicki JE Lamanna AC Harshey RM McCarter LL Kiessling LL Adler J 《Journal of bacteriology》2000,182(22):6499-6502
The methyl-accepting chemotaxis proteins (MCPs) are concentrated at the cell poles in an evolutionarily diverse panel of bacteria and an archeon. In elongated cells, the MCPs are located both at the poles and at regions along the length of the cells. Together, these results suggest that MCP location is evolutionarily conserved. 相似文献
2.
Shufang Wang Xiang Xiao Lijing Jiang Xiaotong Peng Huaiyang Zhou Jun Meng Fengping Wang 《Applied and environmental microbiology》2009,75(12):4216-4220
The abundance and diversity of archaeal ammonia monooxygenase subunit A (amoA) genes from hydrothermal vent chimneys at the Juan de Fuca Ridge were investigated. The majority of the retrieved archaeal amoA sequences exhibited identities of less than 95% to those in the GenBank database. Novel ammonia-oxidizing archaea may exist in the hydrothermal vent environments.Ammonia-oxidizing archaea (AOA) may play important roles in carbon and nitrogen cycles in various temperate environments (5, 7, 10, 12, 16). The frequent detection (23, 24) and successful enrichment (2, 6) of thermophilic AOA from terrestrial hot springs suggested a wide distribution of thermophilic AOA in geothermal environments. High concentrations of NH4+ (1, 9, 11) and high rates of ammonia oxidation (9, 22) have been observed at the Juan de Fuca Ridge. However, the presence of AOA in this deep-sea hydrothermal system has not been reported. Here, the abundance and diversity of AOA in three hydrothermal vent chimneys in the Endeavor segment of the Juan de Fuca Ridge were investigated by targeting the conserved amoA genes. This is also the first report on AOA from deep-sea hydrothermal vent chimneys.These vent chimneys were sulfide structures obtained in the fall of 2005 using the submersible Alvin on board the research vessel Atlantis (dive numbers 4143, 4136, and 4148). Chimney 4148 was an active black smoker venting at around 310°C in the Main Endeavor field (47°56.876′N, 129°5.915′W; depth, 2,192 m). Chimney 4143-1 was an active black smoker venting at 316°C in the Mothra field (47°55.424′N, 129°6.533′W; depth, 2,267 m). The outer layers (samples 4148-1A and 4143-1A) of these chimneys were used in this study. The sample from chimney 4136-1 was from a diffusive field (Clambed field) (47°57.909′N, 129°5.443′W; depth, 2,200 m), where the in situ temperature was measured as 29.2°C. The chimney samples were stored at −20°C on board, transported to the home laboratory on dry ice, and stored at −80°C until analyses were performed.Chimney samples were frozen in liquid nitrogen and milled upon thawing. This procedure was repeated three times to break down the solid sample into small particles, which were then mixed with DNA extraction buffer for DNA isolation as described before (25). The obtained crude DNA was purified by an E-Z N.A. Cycle-Pure kit (Omega Bio-Tek Inc., Norcross, GA). PCR amplifications for the archaeal 16S rRNA gene, the crenarchaeal marine group I (MGI) 16S rRNA gene, the archaeal amoA gene, and the bacterial amoA gene followed procedures previously described (Table (Table1)1) (3, 5, 10, 14). Quantitative PCR (Q-PCR) was performed using a model 7500 real-time system (Applied Biosystems, United Kingdom) and a 20-μl reaction mixture that consisted of 1 μl (1 to 10 ng) of DNA as the template, a 0.15 μM concentration of each primer, and 10 μl of Power SYBR green PCR master mix (Applied Biosystems, United Kingdom) with ROX and SYBR green I. The inserted PCR fragments of clones 4143-1A-71 (from the amoA gene library) and 4136-1-4 (from the archaeal 16S rRNA gene library) were amplified and purified to generate standard DNAs for amoA or archaeal 16S rRNA gene quantification. A serial dilution of standard DNAs was performed to generate calibration curves for sample quantification. A melting curve analysis was performed after amplification, and the cycle threshold was set automatically using system 7500 software, version 1.3.
Open in a separate windowTriplicate PCR products were pooled and clone libraries constructed following the manufacturer''s instructions (Takara Inc., Dalian, China). PCR clones from the libraries were randomly selected for sequencing (Sangon Inc., China). Phylogenetic trees were generated using the PHYLIP package (4) and the maximum-likelihood, neighbor-joining, and maximum-parsimony methods. Bootstrap analysis was used to estimate the reliability of phylogenetic tree constructions (200 replicates). Trees were created using the program Treeview (version 1.6.6).Positive and specific PCR bands were obtained for the archaeal amoA genes from all the three samples, while no PCR band was obtained for the bacterial amoA gene (for the primers and procedures used, see Table Table1).1). In addition, sample 4136-1 was found by Q-PCR analysis to contain the highest number of archaeal amoA genes (with 7.36 ± 0.37 × 104 copies per g of chimney), followed by samples 4143-1A (with 1.88 ± 0.08 × 104 copies per g of chimney) and 4148-1A (with 1.37 ± 0.07 × 102 copies per g of chimney).Clone libraries of archaeal amoA from the three samples were constructed. A total of 93 clones (33 from sample 4136-1, 30 from sample 4143-1A, and 30 from sample 4148-1A) were sequenced and divided into 33 operational taxonomic units (OTUs) based on 99% nucleotide identity. The majority (81.7%) of the retrieved archaeal amoA OTU sequences exhibited relatively low identity (≤94.56%) to other archaeal amoA sequences deposited in GenBank. The phylogenetic relationships among the retrieved amoA and some published amoA sequences are shown in Fig. Fig.1.1. The chimney archaeal amoA sequences fell into five clusters (chimney group I, chimney group II, sediment A-1, and water column A and B clusters), except the sequence of clone 4143-1A-10, which did not fall into any cluster and exhibited the highest identity (90%) to the sequence of clone HB_B_0805A06, which was derived from coastal sediment (18). Chimney group I contained 52 sequences (30 from sample 4148-1A, 11 from sample 4143-1A, and 11 from sample 4136-1); chimney group II contained 23 sequences (20 from sample 4136-1 and 3 from sample 4143-1A). Fourteen sequences from sample 4143-1A grouped into water column A and B clusters (5); and one sequence from sample 4143-1A grouped into the sediment A-1 cluster (13). The sequences from chimney group I exhibited the highest identity (94%) to clone CR-G3N006, derived from a cold seep of the Japan Sea (13). Sequences in chimney group II exhibited the highest identity to clone OA-MA-122 from a water column of a coastal aquarium biofilter, with 84% nucleotide identity (21). The sequences of chimney group II did not cluster with any other sequences. Although showing low bootstrap values (<50%), the chimney group II sequences always clustered into a separate group (Fig. (Fig.1)1) according to different calculation methods, including the maximum-likelihood, neighbor-joining, and maximum-parsimony methods.Open in a separate windowFIG. 1.Phylogenetic tree showing the affiliations of archaeal amoA gene sequences from chimneys (in bold), sediments, soil, water, and the isolated AOA. Bootstrap values were calculated from 200 replications with 585 characters. Maximum-likelihood (left), distance (middle), and parsimony (right) bootstrap values providing ≥50% support are indicated. The bar represents 100 expected substitutions for the archaeal amoA region analyzed. Bacterial amoA sequences were set as the outgroup.Sample 4136-1 contained the highest number of archaeal amoA gene copies. Q-PCR using primers 344F and 518R (15) showed that sample 4136-1 contained 1.10 ± 0.05 × 106 copies of archaeal 16S rRNA genes per g of chimney. Assuming that each crenarchaeal cell possessed only one copy of the amoA gene (8), the AOA constituted at least 6.1% of the archaeal community in sample 4136-1. To explore the potential sources of these amoA sequences in sample 4136-1, an archaeal 16S rRNA clone library was constructed and a total of 82 clones were sequenced. These sequences divided into 20 OTUs based on 98% nucleotide identity. Fifteen OTUs (accounting 76.8% of the total sequences) belonged to hyperthermophilic Desulfurococcales species, and two OTUs (accounting for 15.9% of the total number of sequences) belonged to hyperthermophilic Thermoproteales species of the Crenarchaeota phylum, whereas three OTUs (accounting 7.32% of the total number of sequences) belonged to Thermococcales species of the Euryarchaeota kingdom (Fig. (Fig.2).2). Members of the crenarchaeal MGI, which was thought to be the source of nonthermophilic AOA (6, 8), were not detected in this library. Therefore, PCR using MGI-specific primers was performed to further detect MGI species (for PCR primers and conditions, see Table Table11 and reference 14). MGI species were easily detected in sample 4143-1A, but not in samples 4136-1 and 4148-1A, by direct PCR amplification. A nested PCR method employing generic archaeal 16S rRNA gene primers was then performed for the first round of PCR followed by MGI-selective PCR primers for the second round of PCR. This procedure created a PCR band of the correct size for MGI species from sample 4136-1; that band was later shown by cloning and sequencing to represent an MGI 16S rRNA gene fragment (see Fig. S1 in the supplemental material). The data implied that some of the amoA genes detected in the chimney samples may have come from MGI species; however, to determine the origin of the amoA genes, especially those in the chimney groups I and II, isolation or enrichment of the organisms would be necessary.Open in a separate windowFIG. 2.Phylogenetic tree showing the affiliations of 16S rRNA gene sequences retrieved from hydrothermal vent chimney 4136-1 (in boldface) with selected reference sequences of the Archaea domain. Bootstrap values were calculated from 200 replications with 790 characters. Maximum-likelihood (left), distance (middle), and parsimony (right) bootstrap values providing ≥50% support are indicated. The bar represents 100 expected substitutions for the archaeal 16S rRNA gene analyzed. Bacterial 16S rRNA sequences were set as the outgroup. HWCGIII, hot water crenarchaeotic group III. 相似文献
TABLE 1.
PCR primers and procedures used in this studyTarget gene | Primer | Sequence (5′→3′) | PCR cycle conditions | Reference |
---|---|---|---|---|
Archaeal amoA | Arch-amoAF | STAATGGTCTGGCTTAGACG | 5 min at 95°C; 30 cycles consisting of 45 s at 94°C, 1 min at 53°C, and 1 min at 72°C; 15 min at 72°C | Francis et al., 2005 (5) |
Arch-amoAR | GCGGCCATCCATCTGTATGT | |||
Archaeal 16S rRNA | 21F | TTCCGGTTGATCCYGCCRG | 5 min at 95°C; 30 cycles consisting of 30 s at 94°C, 1 min at 54°C, and 1 min at 72°C; 10 min at 72°C | DeLong, 1992 (3) |
958R | YCCGGCGTTGAMTCCAATT | |||
Archaeal 16S rRNA (for Q-PCR) | 344F | ACGGGGCGCAGCAGGCGCGA | 10 min at 50°C, 2 min at 95°C; 40 cycles consisting of 15 s at 95°C and 1 min at 60°C; 15 s at 95°C, 1 min at 60°C, and 15 s at 95°C to make the melting curve | Øvreås et al., 1998 (15) |
518R | ATTACCGCGGCTGCTGG | |||
Archaeal amoA (for Q-PCR) | amo196F | GGWGTKCCRGGRACWGCMAC | 10 min at 50°C and 2 min at 95°C; 40 cycles consisting of 15 s at 95°C and 1 min at 60°C; 15 s at 95°C, 1 min at 60°C, and 15 s at 95°C to make the melting curve | Treusch et al., 2005 (20) |
amo277R | CRATGAAGTCRTAHGGRTADCC | |||
Bacterial amoA | AmoA-1F | GGGGTTTCTACTGGTGGT | 5 min at 95°C; 30 cycles consisting of 30 s at 94°C, 45 s at 54°C-50°C, and 45 s at 72°C; 10 min at 72°C | Stephen et al., 1998 (19) |
AmoA-2R | CCCCTCKGSAAAGCCTTCTTC | Rotthauwe et al., 1997 (17) | ||
Crenarchaeal marine group I 16S rRNA | 771F | ACGGTGAGGGATGAAAGCT | 5 min at 95°C; 30 cycles consisting of 30 s at 95°C, 30 s at 54°C, and 30 s at 72°C | Ochsenreiter et al., 2003 (14) |
957R | CGGCGTTGACTCCAATTG |
3.
The Closest Relatives of Icosahedral Viruses of Thermophilic Bacteria Are among Viruses and Plasmids of the Halophilic Archaea
下载免费PDF全文

Matti Jalasvuori Silja T. Jaatinen Simonas Laurinavi?ius Elina Ahola-Iivarinen Nisse Kalkkinen Dennis H. Bamford Jaana K. H. Bamford 《Journal of virology》2009,83(18):9388-9397
We have sequenced the genome and identified the structural proteins and lipids of the novel membrane-containing, icosahedral virus P23-77 of Thermus thermophilus. P23-77 has an ∼17-kb circular double-stranded DNA genome, which was annotated to contain 37 putative genes. Virions were subjected to dissociation analysis, and five protein species were shown to associate with the internal viral membrane, while three were constituents of the protein capsid. Analysis of the bacteriophage genome revealed it to be evolutionarily related to another Thermus phage (IN93), archaeal Halobacterium plasmid (pHH205), a genetic element integrated into Haloarcula genome (designated here as IHP for integrated Haloarcula provirus), and the Haloarcula virus SH1. These genetic elements share two major capsid proteins and a putative packaging ATPase. The ATPase is similar with the ATPases found in the PRD1-type viruses, thus providing an evolutionary link to these viruses and furthering our knowledge on the origin of viruses.Three-dimensional structures of the major capsid proteins, as well as the architecture of the virion and the sequence similarity of putative genome packaging ATPases, have revealed unexpected evolutionary connection between virus families. Viruses infecting hosts residing in different domains of life (Bacteria, Archaea, and Eukarya) share common structural elements and possibly also ways to package the viral genome (8, 13, 41). It has been proposed that the set of genes responsible for virion assembly is a hallmark of the virus and is designated as the innate viral “self,” which may retain its identity through evolutionary times (5). Based on this, it is proposed that viruses can be classified into lineages that span the different domains of life. Therefore, the studies of new virus isolates might provide insights into the events that led to the origin of viruses and maybe even the origin of life itself (34, 40). However, viruses are known to be genetic mosaics (28), and these structural lineages therefore do not reflect the evolutionary history of all genes in a given virus. For example, the genome replication strategies vary significantly even in the currently established lineages (41) and, consequently, a structural approach does not point out to a specific form of replication in the ancestor. Nevertheless, as the proposal for a viral self is driven from information on viral structures and pathways of genome encapsidation, the ancestral form of the self was likely to be composed of a protective coat and the necessary mechanisms to incorporate the genetic material within the coat.Viruses structurally related to bacteriophage PRD1, a phage infecting gram-negative bacteria, have been identified in all three domains of life, and the lineage hypothesis was first proposed based on structural information on such viruses. Initially, PRD1 and human adenovirus were proposed to originate from a common ancestor mainly due to the same capsid organization (T=25) and the major coat protein topology, the trimeric double β-barrel fold (12). In addition, these viruses share a common vertex organization and replication mechanism (20, 31, 53, 63). PRD1 is an icosahedral virus with an inner membrane, whereas adenovirus lacks the membrane. Later, many viruses with similar double β-barrel fold in the major coat protein have been discovered and included to this viral lineage. For example, the fold is present in Paramecium bursaria Chlorella virus 1 (56) of algae, Bam35 (45) of gram-positive bacteria, PM2 (2) of gram-negative marine bacteria, and Sulfolobus turreted icosahedral virus (STIV) (38) of an archaeal host. Moreover, genomic analyses have revealed a common set of genes in a number of nucleocytoplasmic large DNA viruses. Chilo iridescent virus and African swine fever virus 1 are related to Paramecium bursaria Chlorella virus 1 and most probably share structural similarity to PRD1-type viruses (13, 30, 31, 68). The largest known viruses, represented by mimivirus and poxvirus, may also belong to this lineage (29, 77). Two euryarchaeal proviruses, TKV4 and MVV, are also proposed to belong to this lineage based on bioinformatic searches (42). The proposed PRD1-related viruses share the same basic architectural principles despite major differences in the host organisms and particle and genome sizes (1, 2, 38, 56). PM2, for example, has a genome of only 10 kbp, whereas mimivirus (infecting Acanthamoeba polyphaga) double-stranded DNA (dsDNA) genome is 1.2 Mbp in size (59).How many virion structure-based lineages might there be? This obviously relates to the number of protein folds that have the properties needed to make viral capsids. It has been noted that, in addition to PRD1-type viruses, at least tailed bacterial and archaeal viruses, as well as herpesviruses, share the same coat protein fold. Also, certain dsRNA viruses seem to have structural and functional similarities, although their hosts include bacteria and yeasts, as well as plants and animals (6, 18, 19, 27, 55, 60, 74). Obviously, many structural principles to build a virus capsid exist, and it has been suggested that especially geothermally heated environments have preserved many of the anciently formed virus morphotypes (35).Thermophilic dsDNA bacteriophage P23-77 was isolated from an alkaline hot spring in New Zealand on Thermus thermophilus (17) ATCC 33923 (deposited as Thermus flavus). P23-77 was shown to have an icosahedral capsid and possibly an internal membrane but no tail (81). Previously, another Thermus virus, IN93, with a similar morphology has been described (50). IN93 was inducible from a lysogenic strain of Thermus aquaticus TZ2, which was isolated from hot spring soil in Japan. Recently, P23-77 was characterized in more detail (33). It has an icosahedral protein coat, organized in a T=28 capsid lattice (21). The presence of an internal membrane was confirmed, and lipids were shown to be constituents of the virion. Ten structural proteins were identified, with apparent molecular masses ranging from 8 to 35 kDa. Two major protein species with molecular masses of 20 and 35 kDa were proposed to make the capsomers, one forming the hexagonal building blocks and the other the two towers that decorate the capsomer bases (33). Surprisingly, P23-77 is structurally closest to the haloarchaeal virus SH1, which is the only other example of a T=28 virion architecture (32, 33). In both cases it was proposed that the capsomers are made of six single β-barrels opposing the situation with the other structurally related viruses where the hexagonal capsomers are made of three double β-barrel coat protein monomers (8).In the present study we analyze the dsDNA genome of P23-77. Viral membrane proteins and those associated with the capsid were identified by virion dissociation studies. The protein chemistry data and genome annotation are consistent with the results of the disruption studies. A detailed analysis of the lipid composition of P23-77 and its T. thermophilus host was carried out. The data collected here reveal additional challenges in attempts to generate viral lineages based on the structural and architectural properties of the virion. 相似文献
4.
Metagenomic and Small-Subunit rRNA Analyses Reveal the Genetic Diversity of Bacteria, Archaea, Fungi, and Viruses in Soil 总被引:2,自引:0,他引:2
下载免费PDF全文

Noah Fierer Mya Breitbart James Nulton Peter Salamon Catherine Lozupone Ryan Jones Michael Robeson Robert A. Edwards Ben Felts Steve Rayhawk Rob Knight Forest Rohwer Robert B. Jackson 《Applied microbiology》2007,73(21):7059-7066
Recent studies have highlighted the surprising richness of soil bacterial communities; however, bacteria are not the only microorganisms found in soil. To our knowledge, no study has compared the diversities of the four major microbial taxa, i.e., bacteria, archaea, fungi, and viruses, from an individual soil sample. We used metagenomic and small-subunit RNA-based sequence analysis techniques to compare the estimated richness and evenness of these groups in prairie, desert, and rainforest soils. By grouping sequences at the 97% sequence similarity level (an operational taxonomic unit [OTU]), we found that the archaeal and fungal communities were consistently less even than the bacterial communities. Although total richness levels are difficult to estimate with a high degree of certainty, the estimated number of unique archaeal or fungal OTUs appears to rival or exceed the number of unique bacterial OTUs in each of the collected soils. In this first study to comprehensively survey viral communities using a metagenomic approach, we found that soil viruses are taxonomically diverse and distinct from the communities of viruses found in other environments that have been surveyed using a similar approach. Within each of the four microbial groups, we observed minimal taxonomic overlap between sites, suggesting that soil archaea, bacteria, fungi, and viruses are globally as well as locally diverse. 相似文献
5.
Molecular Identification and Localization of Filamentous Symbiotic Bacteria Associated with the Hydrothermal Vent Annelid Alvinella pompejana
下载免费PDF全文

S. C. Cary M. T. Cottrell J. L. Stein F. Camacho D. Desbruyeres 《Applied microbiology》1997,63(3):1124-1130
Alvinella pompejana is a polychaetous annelid that inhabits high-temperature environments associated with active deep-sea hydrothermal vents along the East Pacific Rise. A unique and diverse epibiotic microflora with a prominent filamentous morphotype is found associated with the worm's dorsal integument. A previous study established the taxonomic positions of two epsilon proteobacterial phylotypes, 13B and 5A, which dominated a clone library of 16S rRNA genes amplified by PCR from the epibiotic microbial community of an A. pompejana specimen. In the present study deoxyoligonucleotide PCR primers specific for phylotypes 13B and 5A were used to demonstrate that these phylotypes are regular features of the bacterial community associated with A. pompejana. Assaying of other surfaces around colonies of A. pompejana revealed that phylotypes 13B and 5A are not restricted to A. pompejana. Phylotype 13B occurs on the exterior surfaces of other invertebrate genera and rock surfaces, and phylotype 5A occurs on a congener, Alvinella caudata. The 13B and 5A phylotypes were identified and localized on A. pompejana by in situ hybridization, demonstrating that these two phylotypes are, in fact, the prominent filamentous bacteria on the dorsal integument of A. pompejana. These findings indicate that the filamentous bacterial symbionts of A. pompejana are epsilon Proteobacteria which do not have an obligate requirement for A. pompejana. 相似文献
6.
Annabel Meyer Andreas Focks Viviane Radl Gerhard Welzl Ingo Schöning Michael Schloter 《Microbial ecology》2014,67(1):161-166
In the present study, the influence of the land use intensity on the diversity of ammonia oxidizing bacteria (AOB) and archaea (AOA) in soils from different grassland ecosystems has been investigated in spring and summer of the season (April and July). Diversity of AOA and AOB was studied by TRFLP fingerprinting of amoA amplicons. The diversity from AOB was low and dominated by a peak that could be assigned to Nitrosospira. The obtained profiles for AOB were very stable and neither influenced by the land use intensity nor by the time point of sampling. In contrast, the obtained patterns for AOA were more complex although one peak that could be assigned to Nitrosopumilus was dominating all profiles independent from the land use intensity and the sampling time point. Overall, the AOA profiles were much more dynamic than those of AOB and responded clearly to the land use intensity. An influence of the sampling time point was again not visible. Whereas AOB profiles were clearly linked to potential nitrification rates in soil, major TRFs from AOA were negatively correlated to DOC and ammonium availability and not related to potential nitrification rates. 相似文献
7.
The study of of the distribution of microorganisms through space (and time) allows evaluation of biogeographic patterns, like the species-area index (z). Due to their high dispersal ability, high reproduction rates and low rates of extinction microorganisms tend to be widely distributed, and they are thought to be virtually cosmopolitan and selected primarily by environmental factors. Recent studies have shown that, despite these characteristics, microorganisms may behave like larger organisms and exhibit geographical distribution. In this study, we searched patterns of spatial diversity distribution of bacteria and archaea in a contiguous environment. We collected 26 samples of a lake sediment, distributed in a nested grid, with distances between samples ranging from 0.01 m to 1000 m. The samples were analyzed using T-RFLP (Terminal restriction fragment length polymorphism) targeting mcrA (coding for a subunit of methyl-coenzyme M reductase) and the genes of Archaeal and Bacterial 16S rRNA. From the qualitative and quantitative results (relative abundance of operational taxonomic units) we calculated the similarity index for each pair to evaluate the taxa-area and distance decay relationship slopes by linear regression. All results were significant, with mcrA genes showing the highest slope, followed by Archaeal and Bacterial 16S rRNA genes. We showed that the microorganisms of a methanogenic community, that is active in a contiguous environment, display spatial distribution and a taxa-area relationship. 相似文献
8.
In the past two years, archaeal genomics has achieved several breakthroughs. On the evolutionary front the most exciting development was the sequencing and analysis of the genome of Nanoarchaeum equitans, a tiny parasitic organism that has only approximately 540 genes. The genome of Nanoarchaeum shows signs of extreme rearrangement including the virtual absence of conserved operons and the presence of several split genes. Nanoarchaeum is distantly related to other archaea, and it has been proposed to represent a deep archaeal branch that is distinct from Euryarchaeota and Crenarchaeota. This would imply that many features of its gene repertoire and genome organization might be ancestral. However, additional genome analysis has provided a more conservative suggestion - that Nanoarchaeum is a highly derived euryarchaeon. Also there have been substantial developments in functional genomics, including the discovery of the elusive aminoacyl-tRNA synthetase that is involved in both the biosynthesis of cysteine and its incorporation into proteins in methanogens, and the first experimental validation of the predicted archaeal exosome. 相似文献
9.
Susceptibility to Heavy Metals and Characterization of Heterotrophic Bacteria Isolated from Two Hydrothermal Vent Polychaete Annelids, Alvinella pompejana and Alvinella caudata
下载免费PDF全文

Specimens of alvinellid polychaetes and their tubes were collected in the Parigo hydrothermal vent field on the East Pacific Rise (13°N) in October and November 1987. Heterotrophic bacterial strains were isolated on metal-amended media from the tube and dorsal integument of one specimen of Alvinella pompejana, from the dorsal integument of another from the whole integument of a specimen of Alvinella caudata, and from undetermined alvinellid tubes. The strains were characterized and tested for susceptibility to five heavy metals by using a microdilution method for MIC determinations. All strains were gram-negative rods. Most of them were characterized by the ability to degrade Tween 80 and gelatin and to produce hydrogen sulfide from cysteine. Numerous strains, from all sample origins, displayed resistance to cadmium, zinc, arsenate, and silver and tolerated high amounts of copper. Metal resistance was exhibited by 92.3% of the total isolates. The occurrence of multiply resistant bacteria may demonstrate an adaptation of alvinellid-associated microflora to the general enrichment of metals in the hydrothermal vent environment. 相似文献
10.
Yoshihiro Takaki Shigeru Shimamura Satoshi Nakagawa Yasuo Fukuhara Hiroshi Horikawa Akiho Ankai Takeshi Harada Akira Hosoyama Akio Oguchi Shigehiro Fukui Nobuyuki Fujita Hideto Takami Ken Takai 《DNA research》2010,17(3):123-137
The complete genome sequence of the thermophilic sulphur-reducing bacterium, Deferribacter desulfuricans SMM1, isolated from a hydrothermal vent chimney has been determined. The genome comprises a single circular chromosome of 2 234 389 bp and a megaplasmid of 308 544 bp. Many genes encoded in the genome are most similar to the genes of sulphur- or sulphate-reducing bacterial species within Deltaproteobacteria. The reconstructed central metabolisms showed a heterotrophic lifestyle primarily driven by C1 to C3 organics, e.g. formate, acetate, and pyruvate, and also suggested that the inability of autotrophy via a reductive tricarboxylic acid cycle may be due to the lack of ATP-dependent citrate lyase. In addition, the genome encodes numerous genes for chemoreceptors, chemotaxis-like systems, and signal transduction machineries. These signalling networks may be linked to this bacterium''s versatile energy metabolisms and may provide ecophysiological advantages for D. desulfuricans SSM1 thriving in the physically and chemically fluctuating environments near hydrothermal vents. This is the first genome sequence from the phylum Deferribacteres. 相似文献
11.
Pedro Farias Christophe Espírito Santo Rita Branco Romeu Francisco Susana Santos Lars Hansen Soren Sorensen Paula V. Morais 《Applied and environmental microbiology》2015,81(7):2534-2543
Microorganisms are responsible for multiple antibiotic resistances that have been associated with resistance/tolerance to heavy metals, with consequences to public health. Many genes conferring these resistances are located on mobile genetic elements, easily exchanged among phylogenetically distant bacteria. The objective of the present work was to isolate arsenic-, antimonite-, and antibiotic-resistant strains and to determine the existence of plasmids harboring antibiotic/arsenic/antimonite resistance traits in phenotypically resistant strains, in a nonanthropogenically impacted environment. The hydrothermal Lucky Strike field in the Azores archipelago (North Atlantic, between 11°N and 38°N), at the Mid-Atlantic Ridge, protected under the OSPAR Convention, was sampled as a metal-rich pristine environment. A total of 35 strains from 8 different species were isolated in the presence of arsenate, arsenite, and antimonite. ACR3 and arsB genes were amplified from the sediment''s total DNA, and 4 isolates also carried ACR3 genes. Phenotypic multiple resistances were found in all strains, and 7 strains had recoverable plasmids. Purified plasmids were sequenced by Illumina and assembled by EDENA V3, and contig annotation was performed using the “Rapid Annotation using the Subsystems Technology” server. Determinants of resistance to copper, zinc, cadmium, cobalt, and chromium as well as to the antibiotics β-lactams and fluoroquinolones were found in the 3 sequenced plasmids. Genes coding for heavy metal resistance and antibiotic resistance in the same mobile element were found, suggesting the possibility of horizontal gene transfer and distribution of theses resistances in the bacterial population. 相似文献
12.
Comparative biochemistry of Archaea and Bacteria. 总被引:11,自引:0,他引:11
W Zillig 《Current opinion in genetics & development》1991,1(4):544-551
This review compares exemplary molecular and metabolic features of Archaea and Bacteria in terms of phylogenetic aspects. The results of the comparison confirm the coherence of the Archaea as postulated by Woese. Archaea and Bacteria share many basic features of their genetic machinery and their central metabolism. Similarities and distinctions allow projections regarding the nature of the common ancestor and the process of lineage diversification. 相似文献
13.
Of the many pathogens that infect humans and animals, a large number use cells of the host organism as protected sites for replication. To reach the relevant intracellular compartments, they take advantage of the endocytosis machinery and exploit the network of endocytic organelles for penetration into the cytosol or as sites of replication. In this review, we discuss the endocytic entry processes used by viruses and bacteria and compare the strategies used by these dissimilar classes of pathogens.Many of the most widespread and devastating diseases in humans and livestock are caused by viruses and bacteria that enter cells for replication. Being obligate intracellular parasites, viruses have no choice. They must transport their genome to the cytosol or nucleus of infected cells to multiply and generate progeny. Bacteria and eukaryotic parasites do have other options; most of them can replicate on their own. However, some have evolved to take advantage of the protected environment in the cytosol or in cytoplasmic vacuoles of animal cells as a niche favorable for growth and multiplication. In both cases (viruses and intracellular bacteria), the outcome is often destructive for the host cell and host organism. The mortality and morbidity caused by infectious diseases worldwide provide a strong rationale for research into pathogen–host cell interactions and for pursuing the detailed mechanisms of transmission and dissemination. The study of viruses and bacteria can, moreover, provide invaluable insights into fundamental aspects of cell biology.Here, we focus on the mechanisms by which viral and bacterial pathogens exploit the endocytosis machinery for host cell entry and replication. Among recent reviews on this topic, dedicated uniquely to either mammalian viruses or bacterial pathogens, we recommend the following: Cossart and Sansonetti (2004); Pizarro-Cerda and Cossart (2006); Kumar and Valdivia (2009); Cossart and Roy (2010); Mercer et al. (2010b); Grove and Marsh (2011); Kubo et al. (2012); Vazquez-Calvo et al. (2012a); Sun et al. (2013).The term “endocytosis” is used herein in its widest sense, that is, to cover all processes whereby fluid, solutes, ligands, and components of the plasma membrane as well as particles (including pathogenic agents) are internalized by cells through the invagination of the plasma membrane and the scission of membrane vesicles or vacuoles. This differs from current practice in the bacterial pathogenesis field, where the term “endocytosis” is generally reserved for the internalization of molecules or small objects, whereas the uptake of bacteria into nonprofessional phagocytes is called “internalization” or “bacterial-induced phagocytosis.” In addition, the term “phagocytosis” is reserved for internalization of bacteria by professional phagocytes (macrophages, polymorphonuclear leucocytes, dendritic cells, and amoebae), a process that generally but not always leads to the destruction of the ingested bacteria (Swanson et al. 1999; May and Machesky 2001; Henry et al. 2004; Zhang et al. 2010). With a few exceptions, we will not discuss phagocytosis of bacteria or the endocytosis of protozoan parasites such as Toxoplasma and Plasmodium (Robibaro et al. 2001). 相似文献
14.
H Nishida 《Current issues in molecular biology》2012,15(1):19-24
Comparative genomics has revealed that variations in bacterial and archaeal genome DNA sequences cannot be explained by only neutral mutations. Virus resistance and plasmid distribution systems have resulted in changes in bacterial and archaeal genome sequences during evolution. The restriction-modification system, a virus resistance system, leads to avoidance of palindromic DNA sequences in genomes. Clustered, regularly interspaced, short palindromic repeats (CRISPRs) found in genomes represent yet another virus resistance system. Comparative genomics has shown that bacteria and archaea have failed to gain any DNA with GC content higher than the GC content of their chromosomes. Thus, horizontally transferred DNA regions have lower GC content than the host chromosomal DNA does. Some nucleoid-associated proteins bind DNA regions with low GC content and inhibit the expression of genes contained in those regions. This form of gene repression is another type of virus resistance system. On the other hand, bacteria and archaea have used plasmids to gain additional genes. Virus resistance systems influence plasmid distribution. Interestingly, the restriction-modification system and nucleoid-associated protein genes have been distributed via plasmids. Thus, GC content and genomic signatures do not reflect bacterial and archaeal evolutionary relationships. 相似文献
15.
Abstract
The fluctuations of the total microbial abundance, the culturable heterotrophic bacterial population, and the composition
of heterotrophic bacteria were investigated in relation to environmental parameters in a shallow, marine hydrothermal vent
off the Island of Vulcano (Eolian Islands, Italy). Standing stock dynamics were studied by measuring the total population
of picoplankton by direct count and the population of viable heterotrophic bacteria in water and sediment samples collected
monthly. The environmental factors most strongly linked to the total microbial abundance and heterotrophic bacterial populations
were pH and H2S content in water and C/N ratio in sediment samples. The pattern of variation of microbial populations associated with water
was different from those associated with sediment. Assessment of the qualitative composition of aerobic heterotrophic bacterial
communities was based on 30 morphological and biochemical characteristics for each strain. Numerical analysis was used for
an initial survey of the similarity among the isolates. The data were successively used to determine the structure and the
metabolic potential of water and sediment bacteria. Metabolic properties varied between water- and sediment-isolated bacteria.
Bacteria from water were structurally more diverse, and active in the use of carbohydrates, than those from sediment. Moreover,
most of the sediment bacteria were able to grow at a high temperature (60 and 70°C). The fluctuations of bacterial characteristics
in relation to environmental parameters present an evident temporal variation in water, but not in the sediment habitat.
Received: 13 January 1997; Accepted: 7 August 1997 相似文献
16.
Fengyu Wang Jingfa Xiao Linlin Pan Ming Yang Guoqiang Zhang Shouguang Jin Jun Yu 《PloS one》2008,3(12)
Background
Mini-proteins, defined as polypeptides containing no more than 100 amino acids, are ubiquitous in prokaryotes and eukaryotes. They play significant roles in various biological processes, and their regulatory functions gradually attract the attentions of scientists. However, the functions of the majority of mini-proteins are still largely unknown due to the constraints of experimental methods and bioinformatic analysis.Methodology/Principal Findings
In this article, we extracted a total of 180,879 mini-proteins from the annotations of 532 sequenced genomes, including 491 strains of Bacteria and 41 strains of Archaea. The average proportion of mini-proteins among all genomic proteins is approximately 10.99%, but different strains exhibit remarkable fluctuations. These mini-proteins display two notable characteristics. First, the majority are species-specific proteins with an average proportion of 58.79% among six representative phyla. Second, an even larger proportion (70.03% among all strains) is hypothetical proteins. However, a fraction of highly conserved hypothetical proteins potentially play crucial roles in organisms. Among mini-proteins with known functions, it seems that regulatory and metabolic proteins are more abundant than essential structural proteins. Furthermore, domains in mini-proteins seem to have greater distributions in Bacteria than Eukarya. Analysis of the evolutionary progression of these domains reveals that they have diverged to new patterns from a single ancestor.Conclusions/Significance
Mini-proteins are ubiquitous in bacterial and archaeal species and play significant roles in various functions. The number of mini-proteins in each genome displays remarkable fluctuation, likely resulting from the differential selective pressures that reflect the respective life-styles of the organisms. The answers to many questions surrounding mini-proteins remain elusive and need to be resolved experimentally. 相似文献17.
Ivan Andreas Stancik Martin Sebastijan Šestak Boyang Ji Marina Axelson-Fisk Damjan Franjevic Carsten Jers Tomislav Domazet-Lošo Ivan Mijakovic 《Journal of molecular biology》2018,430(1):27-32
The main family of serine/threonine/tyrosine protein kinases present in eukarya was defined and described by Hanks et al. in 1988 (Science, 241, 42–52). It was initially believed that these kinases do not exist in bacteria, but extensive genome sequencing revealed their existence in many bacteria. For historical reasons, the term “eukaryotic-type kinases” propagated in the literature to describe bacterial members of this protein family. Here, we argue that this term should be abandoned as a misnomer, and we provide several lines of evidence to support this claim. Our comprehensive phylostratigraphic analysis suggests that Hanks-type kinases present in eukarya, bacteria and archaea all share a common evolutionary origin in the lineage leading to the last universal common ancestor (LUCA). We found no evidence to suggest substantial horizontal transfer of genes encoding Hanks-type kinases from eukarya to bacteria. Moreover, our systematic structural comparison suggests that bacterial Hanks-type kinases resemble their eukaryal counterparts very closely, while their structures appear to be dissimilar from other kinase families of bacterial origin. This indicates that a convergent evolution scenario, by which bacterial kinases could have evolved a kinase domain similar to that of eukaryal Hanks-type kinases, is not very likely. Overall, our results strongly support a monophyletic origin of all Hanks-type kinases, and we therefore propose that this term should be adopted as a universal name for this protein family. 相似文献
18.
Roberts TH Hejgaard J Saunders NF Cavicchioli R Curmi PM 《Journal of molecular evolution》2004,59(4):437-447
Most serpins irreversibly inactivate specific serine proteinases of the chymotrypsin family. Inhibitory serpins are unusual proteins in that their native structure is metastable, and rapid conversion to a relaxed state is required to trap target enzymes in a covalent complex. The evolutionary origin of the serpin fold is unresolved, and while serpins in animals are known to be involved in the regulation of a remarkable diversity of metabolic processes, the physiological functions of homologues from other phyla are unknown. Addressing these questions, here we analyze serpin genes identified in unicellular eukaryotes: the green alga Chlamydomonas reinhardtii, the dinoflagellate Alexandrium tamarense, and the human pathogens Entamoeba spp., Eimera tenella, Toxoplasma gondii, and Giardia lamblia. We compare these sequences to others, particularly those in the complete genome sequences of Archaea, where serpins were found in only 4 of 13 genera, and Bacteria, in only 9 of 56 genera. The serpins from unicellular organisms appear to be phylogenetically distinct from all of the clades of higher eukaryotic serpins. Most of the sequences from unicellular organisms have the characteristics of inhibitory serpins, and where multiple serpin genes are found in one genome, variability is displayed in the region of the reactive-center loop important for specificity. All the unicellular eukaryotic serpins have large hydrophobic or positively charged residues at the putative P1 position. In contrast, none of the prokaryotic serpins has a residue of these types at the predicted P1 position, but many have smaller, neutral residues. Serpin evolution is discussed.[Reviewing Editor: Dr. Peer Bork] 相似文献
19.
A. S. McFarlane 《BMJ (Clinical research ed.)》1949,2(4639):1247-1250
20.
Computational analysis reveals abundance of potential glycoproteins in Archaea, Bacteria and Eukarya
Glycosylation is the most common type of post-translational modification (PTM) and is known to affect protein stability, folding and activity. Inactivity of enzymes mediating glycosylation can result in serious disorders including colon cancer and brain disorders. Out of five main types of glycosylation, N-linked glycosylation is most abundant and characterized by the addition of a sugar group to an Asparagine residue at the N-X-S/T motif. Enzyme mediating such transfer is known as oligosaccharyl transferase (OST). It has been hypothesized before that a significant number of proteins serve as glycoproteins. In this study, we used programming implementations of Python to statistically quantify the representation of glycoproteins by scanning all the available proteome sequence data at ExPASy server for the presence of glycoproteins and also the enzyme which plays critical role in glycosylation i.e. OST. Our results suggest that more than 50% of the proteins carry N-X-S/T motif i.e. they could be potential glycoproteins. Furthermore, approximately 28-36% (1/3) of proteins possesses signature motifs which are characteristic features of enzyme OST. Quantifying this bias individually reveals that both the number of proteins tagged with N-X-S/T motif and the average number of motifs per protein is significantly higher in case of eukaryotes when compared to prokaryotes. In the light of these results we conclude that there is a significant bias in the representation of glycoproteins in the proteomes of all species and is manifested substantially in eukaryotes and claim for glycosylation to be the most common and ubiquitous PTM in cells, especially in eukaryotes. 相似文献