共查询到20条相似文献,搜索用时 31 毫秒
1.
Linoleic acid hydroperoxides delivered to Ehrlich ascites tumor cells in vitro in a concentration reaching a threshold one (approximately 10(-5) M) sharply decrease their ionic permeability and the value of membrane capacity. With suprathreshold hydroperoxide concentrations (greater than 10(-5) M), the specific yield of chromosome aberrations and the share of aberrant cells increase while the mitotic index decreases. The correlation between general regularities and the equality of the threshold concentrations, with a reference to membrane and genetic effects of hydroperoxides, is thought to be an indication of a close relationship between membrane lesions caused by the development of induced lipid peroxidation and injury to genetic apparatus of the cell. 相似文献
2.
Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx,GPx4) in mammalian cells 总被引:22,自引:0,他引:22
Reactive oxygen species (ROS) are known mediators of intracellular signal cascades. Excessive production of ROS may lead to oxidative stress, loss of cell function, and cell death by apoptosis or necrosis. Lipid hydroperoxides are one type of ROS whose biological function has not yet been clarified. Phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) is a unique antioxidant enzyme that can directly reduce phospholipid hydroperoxide in mammalian cells. This contrasts with most antioxidant enzymes, which cannot reduce intracellular phospholipid hydroperoxides directly. In this review, we focus on the structure and biological functions of PHGPx in mammalian cells. Recently, molecular techniques have allowed overexpression of PHGPx in mammalian cell lines, from which it has become clear that lipid hydroperoxides also have an important function as activators of lipoxygenase and cyclooxygenase, participate in inflammation, and act as signal molecules for apoptotic cell death and receptor-mediated signal transduction at the cellular level. 相似文献
3.
Phospholipid hydroperoxide glutathione peroxidase protects against singlet oxygen-induced cell damage of photodynamic therapy 总被引:5,自引:0,他引:5
Wang HP Qian SY Schafer FQ Domann FE Oberley LW Buettner GR 《Free radical biology & medicine》2001,30(8):825-835
Phospholipid hydroperoxide glutathione peroxidase (PhGPx) is an important enzyme in the removal of lipid hydroperoxides (LOOHs) from cell membranes. Cancer treatments such as photodynamic therapy (PDT) induce lipid peroxidation in cells as a detrimental action. The photosensitizers used produce reactive oxygen species such as singlet oxygen ((1)O(2)). Because singlet oxygen introduces lipid hydroperoxides into cell membranes, we hypothesized that PhGPx would provide protection against the oxidative stress of singlet oxygen and therefore could interfere with cancer treatment. To test this hypothesis, human breast cancer cells (MCF-7) were stably transfected with PhGPx cDNA. Four clones with varying levels of PhGPx activity were isolated. The activities of other cellular antioxidant enzymes were not influenced by the overexpression of PhGPx. Cellular PhGPx activity had a remarkable inverse linear correlation to the removal of lipid hydroperoxides in living cells (r = -0.85), and correlated positively with cell survival after singlet oxygen exposure (r = 0.94). These data demonstrate that PhGPx provides significant protection against singlet oxygen-generated lipid peroxidation via removal of LOOH and suggest that LOOHs are major mediators in this cell injury process. Thus, PhGPx activity could contribute to the resistance of tumor cells to PDT. 相似文献
4.
Lethal damage to murine L1210 cells by exogenous lipid hydroperoxides: protective role of glutathione-dependent selenoperoxidases 总被引:2,自引:0,他引:2
The effect of selenium deprivation on the viability of murine L1210 cells exposed to various exogenous lipid hydroperoxides has been investigated. Selenoperoxidase activities of cells grown for longer than 1 week in 1% serum with no added selenium [Se(-) cells] were less than 10% of the activities of selenium-satisfied controls [Se(+) cells] or selenium-repleted counterparts [Se(-/+) cells]. The enzymes measured were classical glutathione peroxidase (GPX) and phospholipid hydroperoxide glutathione peroxidase (PHGPX). Se(-) cells exhibited a compensatory increase in catalase activity. Dye exclusion and clonal survival assays indicated that Se(-) and Se(+) cells were relatively insensitive to photochemically generated phospholipid hydroperoxides in liposomal form. However, both cell types were sensitive to liposomal cholesterol hydroperoxides, e.g., 7-hydroperoxycholesterol (7-OOH), Se(-) being much more so (LD50 approximately 10 microM) than Se(+) (LD50 approximately 75 microM). By contrast, 7-hydroxycholesterol over a comparable concentration range was minimally toxic to Se(-) and Se(+) cells. Cell killing by 7-OOH was inhibited by desferrioxamine and by butylated hydroxytoluene, suggesting that iron-mediated free radical reactions are involved. The involvement of glutathione in cytoprotection was confirmed by showing that Se(+) cells were more sensitive to 7-OOH after treating with buthionine sulfoximine, an inhibitor of GSH synthesis. Cellular detoxification of 7-OOH is provisionally attributed to PHGPX rather than GPX, since 7-OOH and other cholesterol hydroperoxides were found to be good substrates for PHGPX in a cell free system, but were unreactive with GPX. 相似文献
5.
Diphenyl-1-pyrenylphosphine (DPPP), which reacts with lipid hydroperoxides stoichiometrically to yield fluorescent product DPPP oxide, was used as a fluorescent probe for lipid peroxidation in live cells. DPPP was successfully incorporated into U937 cells. Incorporation of DPPP into the cell membrane was confirmed by fluorescence microscopy. Reaction of DPPP with hydroperoxides was examined by monitoring increase in fluorescence intensity of the cell. It was found that lipid-soluble hydroperoxides such as methyl linoleate hydroperoxide preferably react with DPPP, whereas hydrogen peroxide did not react with DPPP located in the membrane. Linear correlation between increase in fluorescence intensity and the amount of methyl linoleate hydroperoxide applied to the cell was observed. DPPP gave little effect on cell proliferation, cell viability or cell morphology for at least 3 d. DPPP oxide, fluorescent product of DPPP, was quite stable in the membrane of living cells for at least 2 d. Fluorescence of DPPP-labeled cells was measured after treating with diethylmaleate (DEM), or 2,2'-Azobis(2-amidinopropane) dihydrochloride (AAPH), or culturing with low serum content. These reagents and culture condition induced dose- and/or time-dependent increase in fluorescence. Addition of vitamin E effectively suppressed increase in fluorescence. When DPPP-labeled cells and DCFH-DA-labeled cells were treated with NO, H(2)O(2), AAPH, and DEM to compare the formation of hydoperoxides in the membrane and cytosol, distinct patterns of peroxide formation were observed. These results indicate that fluorescent probe DPPP is eligible for estimation of lipid peroxidation proceeding in the membrane of live cells, and use of this probe is especially advantageous in long-term peroxidation of the cell. 相似文献
6.
Zhao L Wang HP Zhang HJ Weydert CJ Domann FE Oberley LW Buettner GR 《Archives of biochemistry and biophysics》2003,417(2):212-218
Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques. 相似文献
7.
Ferretti G Bacchetti T Moroni C Vignini A Curatola G 《Biochimica et biophysica acta》2003,1635(1):48-54
In the present study, we confirmed that copper ions induce oxidative damage in human astrocytes in culture, as demonstrated by the significant increase in the levels of hydroperoxides and in the fluorescence intensity of the fluorescent probe dichloro-dihydrofluorescein diacetate (H(2)DCFDA). The compositional changes were associated with a significant decrease in cell viability in astrocytes treated with 10 microM Cu(++) with respect to control cells. Astrocytes incubated with copper ions in the presence of high density lipoproteins (HDL) isolated from plasma of normolipemic subjects showed lower levels of hydroperoxides and a higher cell viability with respect to cells oxidized alone. Moreover, a significant decrease in the levels of hydroperoxides was observed in oxidized astrocytes treated with HDL. These results demonstrate that HDL exert a protective role against lipid peroxidation. The protective effect could be related to the ability of HDL to bind metal ions at the lipoprotein surface and/or to a stimulation of the efflux of lipid hydroperoxides from cell membranes as demonstrated in other cell types. Oxidative damage of astrocytes was induced at a copper concentration similar to that observed in cerebrospinal fluid (CSF) of patients affected by neurodegenerative diseases such as Alzheimer's (AD) and Parkinson's diseases (PD). Lipoprotein particles similar for density and chemical composition to plasma HDL were recently isolated in human CSF, therefore, the protective role exerted by HDL against Cu(++)-induced oxidative damage of astrocytes could be of physiological relevance. 相似文献
8.
Monocyte cells are exposed to a range of reactive oxygen species (ROS) when they are recruited to a site of inflammation. In this study, we have examined the damage caused to the monocyte-like cell line U937 by peroxyl radicals and characterised the protective effect of the macrophage synthesised compound 7,8-dihydroneopterin.Exposure of U937 cells to peroxyl radicals, generated by the thermolytic breakdown of 2,2'-azobis(amidinopropane) dihydrochloride (AAPH), resulted in the loss of cell viability as measured by thiazolyl blue (MTT) reduction, and lactate dehydrogenase (LDH) leakage. The major form of cellular damage observed was cellular thiol loss and the formation of reactive protein hydroperoxides. Peroxyl radical oxidation of the cells only caused a small increase in cellular lipid oxidation measured. Supplementation of the media with increasing concentrations of 7,8-dihydroneopterin significantly reduced the cellular thiol loss and inhibited the formation of the protein hydroperoxides. High performance liquid chromatography (HPLC) analysis showed 7,8-dihydroneopterin was oxidised by both peroxyl radicals and preformed protein hydroperoxides to predominately 7,8-dihydroxanthopterin.The possibility that 7,8-dihydroneopterin is a cellular antioxidant protecting macrophage proteins during inflammation is discussed. 相似文献
9.
Siritantikorn A Johansson K Ahlen K Rinaldi R Suthiphongchai T Wilairat P Morgenstern R 《Biochemical and biophysical research communications》2007,355(2):592-596
Rat liver microsomal glutathione transferase 1 (MGST1) is a membrane-bound enzyme that displays both glutathione transferase and glutathione peroxidase activities. We hypothesized that physiologically relevant levels of MGST1 is able to protect cells from oxidative damage by lowering intracellular hydroperoxide levels. Such a role of MGST1 was studied in human MCF7 cell line transfected with rat liver mgst1 (sense cell) and with antisense mgst1 (antisense cell). Cytotoxicities of two hydroperoxides (cumene hydroperoxide (CuOOH) and hydrogen peroxide) were determined in both cell types using short-term and long-term cytotoxicity assays. MGST1 significantly protected against CuOOH and against hydrogen peroxide (although less pronounced and only in short-term tests). These results demonstrate that MGST1 can protect cells from both lipophilic and hydrophilic hydroperoxides, of which only the former is a substrate. After CuOOH exposure MGST1 significantly lowered intracellular ROS as determined by FACS analysis. 相似文献
10.
Phospholipid hydroperoxide glutathione peroxidase (PHGPx), a selenium-dependent glutathione peroxidase, can interact with lipophilic substrates, including phospholipid hydroperoxides, fatty acid hydroperoxides and cholesterol hydroperoxides, and can reduce them to hydroxide compounds. It also seems to be a major regulator of lipid oxygenation in human epidermoid carcinoma A431 cells. In order to study the functional role of PHGPx in the regulation of 12-lipoxygenase and cyclooxygenase, cDNA of PHGPx was inserted into pcDNA3.1/His, and a plasmid designated as S4 with the His-tag sequence inserted between PHGPx and its 3'-untranslated region was constructed. A number of stable transfectants of A431 cells that could express the tag-PHGPx were generated using plasmid S4. Using an intact cell assay system, the metabolism of arachidonic acid to prostaglandin E(2) significantly decreased in stable transfectants of overexpressing PHGPx compared to that in a vector control cell line. If the intact cell assay was carried out in the presence of 13-hydroperoxyoctadecadienoic acid as a stimulator of lipid peroxidation, formation of 12-hydroxyeicosatetraenoic acid from arachidonic acid also significantly decreased in stable transfectants of overexpressing PHGPx compared to that in a vector control cell line, indicating that PHGPx could downregulate the 12-lipoxygenase activity in cells. These results support the hypothesis that PHGPx plays a pivotal role in the regulation of arachidonate metabolism in A431 cells. 相似文献
11.
Saito Y Yoshida Y Akazawa T Takahashi K Niki E 《The Journal of biological chemistry》2003,278(41):39428-39434
Selenium is an essential trace element and it is well known that selenium is necessary for cell culture. However, the mechanism underlying the role of selenium in cellular proliferation and survival is still unknown. The present study using Jurkat cells showed that selenium deficiency in a serum-free medium decreased the selenium-dependent enzyme activity (glutathione peroxidases and thioredoxin reductase) within cells and cell viability. To understand the mechanism of this effect of selenium, we examined the effect of other antioxidants, which act by different mechanisms. Vitamin E, a lipid-soluble radical-scavenging antioxidant, completely blocked selenium deficiency-induced cell death, although alpha-tocopherol (biologically the most active form of vitamin E) could not preserve selenium-dependent enzyme activity. Other antioxidants, such as different isoforms and derivatives of vitamin E, BO-653 and deferoxamine mesylate, also exerted an inhibitory effect. However, the water-soluble antioxidants, such as ascorbic acid, N-acetyl cysteine, and glutathione, displayed no such effect. Dichlorodihydrofluorescein (DCF) assay revealed that cellular reactive oxygen species (ROS) increased before cell death, and sodium selenite and alpha-tocopherol inhibited ROS increase in a dose-dependent manner. The generation of lipid hydroperoxides was observed by fluorescence probe diphenyl-1-pyrenylphosphine (DPPP) and HPLC chemiluminescence only in selenium-deficient cells. These results suggest that the ROS, especially lipid hydroperoxides, are involved in the cell death caused by selenium deficiency and that selenium and vitamin E cooperate in the defense against oxidative stress upon cells by detoxifying and inhibiting the formation of lipid hydroperoxides. 相似文献
12.
Chotimarkorn C Nagasaka R Ushio H Ohshima T Matsunaga S 《Biochemical and biophysical research communications》2005,338(2):1222-1228
A novel fluorescent probe 3-perylene diphenylphosphine (3-PeDPP) was synthesized for the direct analysis of lipid hydroperoxides. The structure of 3-PeDPP was identified by the spectroscopic data, FAB-MS, (1)H NMR, and (13)C NMR. The reactivities of 3-PeDPP with lipid hydroperoxides were investigated in chloroform/MeOH homogeneous solutions and PC liposome model systems oxidized by either 2,2'-azobis(2-amidinopropane)dihydrochloride and photosensitized oxidation. The fluorescence intensity derived from 3-perylene diphenylphosphineoxide (3-PeDPPO) increased proportionally with amount of hydroperoxides produced in homogeneous solutions and liposome model systems. 3-PeDPP was easily incorporated into mouse myeloma SP2 cells and thin tissue section for dynamic membrane lipid peroxidation studies. Linear correlations between fluorescence intensity and amount of hydroperoxides in the cell membrane and tissue sections were obtained. The fluorescence intensity from 2-dimensional image analysis was also well correlated with lipid hydroperoxide level in these models. Thus, the novel probe 3-PeDPP is useful for the direct determination of lipid hydroperoxides in biological materials. 相似文献
13.
In U937 and mouse myeloma cells, protein hydroperoxides are the predominant hydroperoxide formed during exposure to AAPH or gamma irradiation. In lipid-rich human monocyte-derived macrophages (HMDMs), we have found the opposite situation. Hydroperoxide measurements by the FOX assay showed the majority of hydroperoxides formed during AAPH incubation were lipid hydroperoxides. Lipid hydroperoxide formation began after a four hour lag period and was closely correlated with loss of cell viability. The macrophage pterin 7,8-dihydroneopterin has previously been shown to be a potent scavenger of peroxyl radicals, preventing oxidative damage in U937 cells, protein and lipoprotein. However, when given to HMDM cells, 7,8-dihydroneopterin failed to inhibit the AAPH-mediated cellular damage. The lack of interaction between 7,8-dihydroneopterin and AAPH peroxyl radicals suggests that they localize to separate cellular sites in HMDM cells. Our data shows that lipid peroxidation is the predominant reaction occurring in HMDMs, possibly due to the high lipid content of the cells. 相似文献
14.
In U937 and mouse myeloma cells, protein hydroperoxides are the predominant hydroperoxide formed during exposure to AAPH or gamma irradiation. In lipid-rich human monocyte-derived macrophages (HMDMs), we have found the opposite situation. Hydroperoxide measurements by the FOX assay showed the majority of hydroperoxides formed during AAPH incubation were lipid hydroperoxides. Lipid hydroperoxide formation began after a four hour lag period and was closely correlated with loss of cell viability. The macrophage pterin 7,8-dihydroneopterin has previously been shown to be a potent scavenger of peroxyl radicals, preventing oxidative damage in U937 cells, protein and lipoprotein. However, when given to HMDM cells, 7,8-dihydroneopterin failed to inhibit the AAPH-mediated cellular damage. The lack of interaction between 7,8-dihydroneopterin and AAPH peroxyl radicals suggests that they localize to separate cellular sites in HMDM cells. Our data shows that lipid peroxidation is the predominant reaction occurring in HMDMs, possibly due to the high lipid content of the cells. 相似文献
15.
Intracellular glutathione (GSH) depletion induced by buthionine sulfoximine (BSO) caused cell death that seemed to be apoptosis in C6 rat glioma cells. Arachidonic acid (AA) promoted BSO-induced cell death by accumulating reactive oxygen species (ROS) or hydroperoxides. AA inhibited caspase-3 activation and internucleosomal DNA fragmentation during the BSO-induced GSH depletion. Furthermore, AA reduced intracellular ATP content, induced dysfunction of mitochondrial membrane and enhanced 8-hydroxy-2'-deoxyguanosine (8-OH-dG) production. There was significant increase of 12-lipoxygenase activity in the presence of AA under the BSO-induced GSH depletion in C6 cells. These results suggest that AA promotes cell death by changing to necrosis from apoptosis through lipid peroxidation initiated by lipid hydroperoxides produced by 12-lipoxygenase under the GSH depletion in C6 cells. Some ROS such as hydroperoxide produced by unknown pathway make hydroxy radicals and induce 8-OH-dG formation in the cells. The conversion of apoptosis to necrosis may be a possible event under GSH depleted conditions. 相似文献
16.
Banning A Schnurr K Böl GF Kupper D Müller-Schmehl K Viita H Ylä-Herttuala S Brigelius-Flohé R 《Free radical biology & medicine》2004,36(2):135-144
Cytokines or hydroperoxides upregulate cell adhesion molecules (CAM) in early stages of atherosclerosis. VCAM-1 expression was therefore investigated in rabbit aortic smooth muscle cells (SMC) stably transfected either with phospholipid hydroperoxide glutathione peroxidase (PHGPx; SMCPHGPx) as a hydroperoxide-reducing enzyme or with 15-lipoxygenase (15-LOX; SMCLOX) as a hydroperoxide-producing enzyme. Transfected cells showed up to 3-fold enhanced PHGPx and a marked LOX activity, respectively, that was absent in controls. Intracellular hydroperoxides were 6-fold higher in SMCLOX than in SMC or SMCPHGPx. Intracellular protein thiols were decreased by 50 and 90% in SMCPHGPx and SMCLOX, respectively. Glutathione mixed disulfides were tentatively increased from SMC via SMCPHGPx to SMCLOX, accordingly. Thiol reduction with tris(2-carboxyethyl)phosphine completely restored protein thiols in SMCPHGPx, whereas in SMCLOX only 60% of control values were recovered. Basal VCAM-1 mRNA levels were decreased by 50% in SMCPHGPx and 75% in SMCLOX. VCAM-1-inducibility was abrogated in SMCLOX but not in SMCPHGPx. Accordingly, NFkappaB-driven reporter gene activation by IL-1 was unaffected in SMCPHGPx but abolished in SMCLOX. The data confirm that PHGPx overexpression dampens CAM expression either by lowering stimulatory hydroperoxides or by using hydroperoxides for protein modification. But hydroperoxides, when constitutively overproduced as in SMCLOX, inhibit CAM expression and render cells refractory to IL-1 stimulation likely due to oxidation of protein thiols of the signaling system. 相似文献
17.
Reaction of radicals in the presence of O2, or singlet oxygen, with some amino acids, peptides, and proteins yields hydroperoxides. These species are key intermediates in chain reactions and protein damage. They can be detected in cells and are poorly removed by enzymatic defenses. Previously we have shown that peptide and protein hydroperoxides react rapidly with thiols, with this resulting in inactivation of some thiol-dependent enzymes. In light of these data, we hypothesized that inactivation of protein tyrosine phosphatases (PTPs), by hydroperoxides present on oxidized proteins, may contribute to cellular and tissue dysfunction by modulation of phosphorylation-dependent cell signaling. We show here that PTPs in cell lysates, and purified PTP-1B, are inactivated by amino acid, peptide, and protein hydroperoxides in a concentration- and structure-dependent manner. Protein hydroperoxides are particularly effective, with inhibition occurring with greater efficacy than with H2O2. Inactivation involves reaction of the hydroperoxide with the conserved active-site Cys residue of the PTPs, as evidenced by hydroperoxide consumption measurements and a diminution of this effect on blocking the Cys residue. This inhibition of PTPs, by oxidized proteins containing hydroperoxide groups, may contribute to cellular dysfunction and altered redox signaling in systems subject to oxidative stress. 相似文献
18.
Wang G Conover RC Benoit S Olczak AA Olson JW Johnson MK Maier RJ 《The Journal of biological chemistry》2004,279(50):51908-51914
In the gastric pathogen Helicobacter pylori, catalase (KatA) and alkyl hydroperoxide reductase (AhpC) are two highly abundant enzymes that are crucial for oxidative stress resistance and survival of the bacterium in the host. Here we report a connection unidentified previously between the two stress resistance enzymes. We observed that the catalase in ahpC mutant cells in comparison with the parent strain is inactivated partially (approximately 50%). The decrease of catalase activity is well correlated with the perturbation of the heme environment in catalase, as detected by electron paramagnetic resonance spectroscopy. To understand the reason for this catalase inactivation, we examined the inhibitory effects of hydroperoxides on H. pylori catalase (either present in cell extracts or added to the purified enzyme) by monitoring the enzyme activity and the EPR signal of catalase. H. pylori catalase is highly resistant to its own substrate, without the loss of enzyme activity by treatment with a molar ratio of 1:3000 H2O2. However, it inactivated is by lower concentrations of organic hydroperoxides (the substrate of AhpC). Treatment with a molar ratio of 1:400 t-butyl hydroperoxide resulted in an inactivation of catalase by approximately 50%. UV-visible absorption spectra indicated that the catalase inactivation by organic hydroperoxides is caused by the formation of a catalytically incompetent compound II species. To further support the idea that organic hydroperoxides, which accumulate in the ahpC mutant cells, are responsible for the inactivation of catalase, we compared the level of lipid peroxidation found in ahpC mutant cells with that found in wild type cells. The results showed that the total amount of extractable lipid hydroperoxides in the ahpC mutant cells is approximately three times that in the wild type cells. Our findings reveal a novel role of the organic hydroperoxide detoxification system in preventing catalase inactivation. 相似文献
19.
K Akeo H Miyamoto S Okisaka T Hiramitsu 《Pigment cell research / sponsored by the European Society for Pigment Cell Research and the International Pigment Cell Society》1999,12(3):199-205
Light-induced peroxidation of polyunsaturated fatty acids (PUFA) may generate lipid hydroperoxides, which may have toxic effects on retinal pigment epithelial (RPE) cells in vitro. We investigated the effects of cool-white fluorescent light on the RPE cells incubated with linoleic acids (LA) or linoleic acid hydroperoxides (LHP) and the influence of antioxidative enzymes. We measured the bovine RPE cell number after exposure to fluorescent light (610 and 1,200 lux) in the presence of LA or LHP. Furthermore, the effects of superoxide dismutase (SOD) and catalase on LA- or LHP-treated RPE cells were also examined. Both LA and LHP treatment increased RPE cell number under weak illumination (610 lux), but dose-dependently decreased the number of cells exposed to strong illumination (1,200 lux). With exposure to strong illumination, LA caused a greater reduction in RPE cell number than LHP. Multiple linear regression analysis showed that the number of RPE cells was significantly decreased in a manner dependent on the interactions of the illuminance of light and the concentrations of LA or LHP. The antioxidative enzymes significantly ameliorated the damage to RPE cells from LA or LHP and exposure to light. Therefore, the exposure to fluorescent light augmented the cytotoxic effects of LA and LHP on RPE cells, and this effect is likely to be mediated by reactive oxygen species. 相似文献
20.
Glutamate induced glutathione (GSH) depletion in C6 rat glioma cells, which resulted in cell death. This cell death seemed to be apoptosis through accumulation of reactive oxygen species (ROS) or hydroperoxides representing cytochrome c release from mitochondria and internucleosomal DNA fragmentation. A significant increase of 12-lipoxygenase enzyme activity was observed in the presence of arachidonic acid (AA) under GSH depletion induced by glutamate. AA promoted the glutamate-induced cell death, which reduced caspase-3 activity and diminished internucleosomal DNA fragmentation. Furthermore, AA reduced intracellular NAD, ATP and membrane potentials, which indicated dysfunction of the mitochondrial membrane. Protease inhibitors such as N-alpha-tosyl-L-phenylalanine chloromethyl ketone (TPCK) and 3, 4-dichloroisocumarin (DCI) but no Ac-DEVD, a caspase inhibitor, suppressed the glutamate-induced cell death. AA reduced the inhibitory effect of TPCK and DCI on the glutamate-induced cell death. These results suggest that AA promotes cell death by inducing necrosis from caspase-3-independent apoptosis. This might occur through lipid peroxidation initiated by ROS or lipid hydroperoxides generated during GSH depletion in C6 cells. 相似文献