Determination of thermodynamic parameters for HIV DIS type loop-loop kissing complexes

The HIV-1 type dimerization initiation signal (DIS) loop was used as a starting point for the analysis of the stability of Watson–Crick (WC) base pairs in a tertiary structure context. We used ultraviolet melting to determine thermodynamic parameters for loop–loop tertiary interactions and compared them with regular secondary structure RNA helices of the same sequences. In 1 M Na⁺ the loop–loop interaction of a HIV-1 DIS type pairing is 4 kcal/mol more stable than its sequence in an equivalent regular and isolated RNA helix. This difference is constant and sequence independent, suggesting that the rules governing the stability of WC base pairs in the secondary structure context are also valid for WC base pairs in the tertiary structure context. Moreover, the effect of ion concentration on the stability of loop–loop tertiary interactions differs considerably from that of regular RNA helices. The stabilization by Na⁺ and Mg²⁺ is significantly greater if the base pairing occurs within the context of a loop–loop interaction. The dependence of the structural stability on salt concentration was defined via the slope of a T_m/log [ion] plot. The short base-paired helices are stabilized by 8°C/log [Mg²⁺] or 11°C/log [Na⁺], whereas base-paired helices forming tertiary loop–loop interactions are stabilized by 16°C/log [Mg²⁺] and 26°C/log [Na⁺]. The different dependence on ionic strength that is observed might reflect the contribution of specific divalent ion binding to the preformation of the hairpin loops poised for the tertiary kissing loop–loop contacts.     

Fluorescence measurement of intracellular sodium concentration in single Escherichia coli cells

The energy-transducing cytoplasmic membrane of bacteria contains pumps and antiports maintaining the membrane potential and ion gradients. We have developed a method for rapid, single-cell measurement of the internal sodium concentration ([Na⁺]_in) in Escherichia coli using the sodium ion fluorescence indicator, Sodium Green. The bacterial flagellar motor is a molecular machine that couples the transmembrane flow of ions, either protons (H⁺) or sodium ions (Na⁺), to flagellar rotation. We used an E. coli strain containing a chimeric flagellar motor with H⁺- and Na⁺-driven components that functions as a sodium motor. Changing external sodium concentration ([Na⁺]_ex) in the range 1–85 mM resulted in changes in [Na⁺]_in between 5–14 mM, indicating a partial homeostasis of internal sodium concentration. There were significant intercell variations in the relationship between [Na⁺]_in and [Na⁺]_ex, and the internal sodium concentration in cells not expressing chimeric flagellar motors was 2–3 times lower, indicating that the sodium flux through these motors is a significant fraction of the total sodium flux into the cell.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Mg2+-induced triplex formation of an equimolar mixture of poly(rA) and poly(rU)

Magnesium ions strongly influence the structure and biochemical activity of RNA. The interaction of Mg²⁺ with an equimolar mixture of poly(rA) and poly(rU) has been investigated by UV spectroscopy, isothermal titration calorimetry, ultrasound velocimetry and densimetry. Measurements in dilute aqueous solutions at 20°C revealed two differ ent processes: (i) Mg²⁺ binding to unfolded poly(rA)·poly(rU) up to [Mg²⁺]/[phosphate] = 0.25; and (ii) poly(rA)·2poly(rU) triplex formation at [Mg²⁺]/[phosphate] between 0.25 and 0.5. The enthalpies of these two different processes are favorable and similar to each other, ~–1.6 kcal mol^–1 of base pairs. Volume and compressibility effects of the first process are positive, 8 cm³ mol^–1 and 24 × 10^–4 cm³ mol^–1 bar^–1, respectively, and correspond to the release of water molecules from the hydration shells of Mg²⁺ and the polynucleotides. The triplex formation is also accompanied by a positive change in compressibility, 14 × 10^–4 cm³ mol^–1 bar^–1, but only a small change in volume, 1 cm³ mol^–1. A phase diagram has been constructed from the melting experiments of poly(rA)·poly(rU) at a constant K⁺ concentration, 140 mM, and various amounts of Mg²⁺. Three discrete regions were observed, corresponding to single-, double- and triple-stranded complexes. The phase boundary corresponding to the transition between double and triple helical conformations lies near physiological salt concentrations and temperature.     

Divalent metal-dependent catalysis and cleavage specificity of CSP41, a chloroplast endoribonuclease belonging to the short chain dehydrogenase/reductase superfamily

CSP41 is a ubiquitous chloroplast endoribonuclease belonging to the short chain dehydrogenase/reductase (SDR) superfamily. To help elucidate the role of CSP41 in chloroplast gene regulation, the mechanisms that determine its substrate recognition and catalytic activity were investigated. A divalent metal is required for catalysis, most probably to provide a nucleophile for cleavage 5′ to the phosphodiester bond, and may also participate in cleavage site selection. This requirement distinguishes CSP41 from other Rossman fold-containing proteins from the SDR superfamily, including several RNA-binding proteins and endonucleases. CSP41 is active only in the presence of MgCl₂ and CaCl₂. Although Mg²⁺- and Ca²⁺-activated CSP41 cleave at identical sites in the single-stranded regions of a stem–loop-containing substrate, Mg²⁺-activated CSP41 was also able to cleave within the double-stranded region of the stem–loop. Mixed metal experiments with Mg²⁺ and Ca²⁺ suggest that CSP41 contains a single divalent metal-binding site which is non-selective, since Mn²⁺, Co²⁺ and Zn²⁺ compete with Mg²⁺ for binding, although there is no activity in their presence. Using site-directed mutagenesis, we identified three residues, Asn71, Asp89 and Asp103, which may form the divalent metal-binding pocket. The activation constant for Mg²⁺ (K_A,Mg = 2.1 ± 0.4 mM) is of the same order of magnitude as the stromal Mg²⁺ concentrations, which fluctuate between 0.5 and 10 mM as a function of light and of leaf development. These changes in stromal Mg²⁺ concentration may regulate CSP41 activity, and thus cpRNA stability, during plant development.     

Requirement of a Relatively High Threshold Level of Mg2+ for Cell Growth of a Rhizoplane Bacterium, Sphingomonas yanoikuyae EC-S001

Mg²⁺ is one of the essential elements for bacterial cell growth. The presence of the magnesium cation (Mg²⁺) in various concentrations often affects cell growth restoration in plant-associating bacteria. This study attempted to determine whether Mg²⁺ levels in Sphingomonas yanoikuyae EC-S001 affected cell growth restoration in the host plant and what the threshold level is. S. yanoikuyae EC-S001, isolated from the rhizoplane of spinach seedlings grown from surface-sterilized seeds under aseptic conditions, displayed uniform dispersion and attachment throughout the rhizoplane and phylloplane of the host seedlings. S. yanoikuyae EC-S001 did not grow in potato-dextrose broth medium but grew well in an aqueous extract of spinach leaves. Chemical investigation of the growth factor in the spinach leaf extract led to identification of the active principle as the magnesium cation. A concentration of ca. 0.10 mM Mg²⁺ or more allowed S. yanoikuyae EC-S001 to grow in potato-dextrose broth medium. Some saprophytic and/or diazotrophic bacteria used in our experiment were found to have diverse threshold levels for their Mg²⁺ requirements. For example, Burkholderia cepacia EC-K014, originally isolated from the rhizoplane of a Melastoma sp., could grow even in Mg²⁺-free Hoagland's no. 2 medium with saccharose and glutamine (HSG medium) and requires a trace level of Mg²⁺ for its growth. In contrast, S. yanoikuyae EC-S001, together with Bacillus subtilis IFO12113, showed the most drastic restoring responses to subsequent addition of 0.98 mM Mg²⁺ to Mg²⁺-free HSG medium. Our studies concluded that Mg²⁺ is more than just the essential trace element needed for cell growth restoration in S. yanoikuyae EC-S001 and that certain nonculturable bacteria may require a higher concentration of Mg²⁺ or another specific essential element for their growth.     

Incorporation of a cationic aminopropyl chain in DNA hairpins: thermodynamics and hydration

We report on the physicochemical effects resulting from incorporating a 5-(3-aminopropyl) side chain onto a 2′-deoxyuridine (dU) residue in a short DNA hairpin. A combination of spectroscopy, calorimetry, density and ultrasound techniques were used to investigate both the helix–coil transition of a set of hairpins with the following sequence: d(GCGACTTTTTGNCGC) [N = dU, deoxythymidine (dT) or 5-(3-aminopropyl)-2′-deoxyuridine (dU*)], and the interaction of each hairpin with Mg²⁺. All three molecules undergo two-state transitions with melting temperatures (T_M) independent of strand concentration that indicates their intramolecular hairpin formation. The unfolding of each hairpin takes place with similar T_M values of 64–66°C and similar thermodynamic profiles. The unfavorable unfolding free energies of 6.4–6.9 kcal/mol result from the typical compensation of unfavorable enthalpies, 36–39 kcal/mol, and favorable entropies of ~110 cal/mol. Furthermore, the stability of each hairpin increases as the salt concentration increases, the T_M-dependence on salt yielded slopes of 2.3–2.9°C, which correspond to counterion releases of 0.53 (dU and dT) and 0.44 (dU*) moles of Na⁺ per mole of hairpin. Absolute volumetric and compressibility measurements reveal that all three hairpins have similar hydration levels. The electrostatic interaction of Mg²⁺ with each hairpin yielded binding affinities in the order: dU > dT > dU*, and a similar release of 2–4 electrostricted water molecules. The main result is that the incorporation of the cationic 3-aminopropyl side chain in the major groove of the hairpin stem neutralizes some local negative charges yielding a hairpin molecule with lower charge density.     

Accumulation of inorganic and organic osmolytes and their role in osmotic adjustment in NaCl-stressed vetiver grass seedlings

The accumulation of inorganic and organic osmolytes and their role in osmotic adjustment were investigated in roots and leaves of vetiver grass (Vetiveria zizanioides) seedlings stressed with 100, 200, and 300 mM NaCl for 9 days. The results showed that, although the contents of inorganic (K⁺, Na⁺, Ca²⁺, Mg²⁺, Cl⁻, NO₃⁻, SO₄²⁻ and H₂PO₃⁻)) and organic (soluble sugar, organic acids, and free amino acids) osmolytes all increased with NaCl concentration, the contribution of inorganic ions (mainly Na⁺, K⁺, and Cl⁻) to osmotic adjustment was higher (71.50–80.56% of total) than that of organic solutes (19.43–28.50%). The contribution of inorganic ions increased and that of organic solutes decreased in roots with the enhanced NaCl concentration, whereas the case in leaves was opposite. On the other hand, the osmotic adjustment was only effective for vetiver grass seedlings under moderate saline stress (less than 200 mM NaCl).     

Importance in catalysis of a magnesium ion with very low affinity for a hammerhead ribozyme

Available evidence suggests that Mg²⁺ ions are involved in reactions catalyzed by hammerhead ribozymes. However, the activity in the presence of exclusively monovalent ions led us to question whether divalent metal ions really function as catalysts when they are present. We investigated ribozyme activity in the presence of high levels of Mg²⁺ ions and the effects of Li⁺ ions in promoting ribozyme activity. We found that catalytic activity increased linearly with increasing concentrations of Mg²⁺ ions and did not reach a plateau value even at 1 M Mg²⁺ ions. Furthermore, this dependence on Mg²⁺ ions was observed in the presence of a high concentration of Li⁺ ions. These results indicate that the Mg²⁺ ion is a very effective cofactor but that the affinity of the ribozyme for a specific Mg²⁺ ion is very low. Moreover, cleavage by the ribozyme in the presence of both Li⁺ and Mg²⁺ ions was more effective than expected, suggesting the existence of a new reaction pathway—a cooperative pathway—in the presence of these multiple ions, and the possibility that a Mg²⁺ ion with weak affinity for the ribozyme is likely to function in structural support and/or act as a catalyst.     

Mechanisms of Cation Exchange by Pseudomonas aeruginosa PAO1 and PAO1 wbpL, a Strain with a Truncated Lipopolysaccharide

The ability of bacterial cells to sequester cations is well recognized, despite the fact that the specific binding sites and mechanistic details of the process are not well understood. To address these questions, the cation-exchange behavior of Pseudomonas aeruginosa PAO1 cells with a truncated lipopolysaccharide (LPS) (PAO1 wbpL) and cells further modified by growth in a magnesium-deficient medium (PAO1 wbpL − Mg²⁺) were compared with that of wild-type P. aeruginosa PAO1 cells. P. aeruginosa PAO1 cells had a negative surface charge (zeta potential) between pH 11 and 2.2, due to carboxylate groups present in the B-band LPS. The net charge on PAO1 wbpL cells was increasingly positive below pH 3.5, due to the influence of NH₃⁺ groups in the core LPS. The zeta potentials of these cells were also measured in Na⁺, Ca²⁺, and La³⁺ electrolytes. Cells in the La³⁺ electrolyte had a positive zeta potential at all pH values tested. Growing P. aeruginosa PAO1 wbpL in magnesium-deficient medium (PAO1 wbpL − Mg²⁺) resulted in an increase in its zeta potential in the pH range from 3.0 to 6.5. In cation-exchange experiments carried out at neutral pH with either P. aeruginosa PAO1 or PAO1 wbpL, the concentration of bound Ca²⁺ was found to decrease as the pH was reduced from 7.0 to 3.5. At pH 3.5, the bound Mg²⁺ concentration decreased sharply, revealing the activity of surface sites for cation exchange and their pH dependence. Infrared spectroscopy of attached biofilms suggested that carboxylate and phosphomonoester functional groups within the core LPS are involved in cation exchange.     

Modulation of the Local SR Ca2+ Release by Intracellular Mg2+ in Cardiac Myocytes

In cardiac muscle, Ca²⁺-induced Ca²⁺ release (CICR) from the sarcoplasmic reticulum (SR) defines the amplitude and time course of the Ca²⁺ transient. The global elevation of the intracellular Ca²⁺ concentration arises from the spatial and temporal summation of elementary Ca²⁺ release events, Ca²⁺ sparks. Ca²⁺ sparks represent the concerted opening of a group of ryanodine receptors (RYRs), which are under the control of several modulatory proteins and diffusible cytoplasmic factors (e.g., Ca²⁺, Mg²⁺, and ATP). Here, we examined by which mechanism the free intracellular Mg²⁺ ([Mg²⁺]_free) affects various Ca²⁺ spark parameters in permeabilized mouse ventricular myocytes, such as spark frequency, duration, rise time, and full width, at half magnitude and half maximal duration. Varying the levels of free ATP and Mg²⁺ in specifically designed solutions allowed us to separate the inhibition of RYRs by Mg²⁺ from the possible activation by ATP and Mg²⁺-ATP via the adenine binding site of the channel. Changes in [Mg²⁺]_free generally led to biphasic alterations of the Ca²⁺ spark frequency. For example, lowering [Mg²⁺]_free resulted in an abrupt increase of spark frequency, which slowly recovered toward the initial level, presumably as a result of SR Ca²⁺ depletion. Fitting the Ca²⁺ spark inhibition by [Mg²⁺]_free with a Hill equation revealed a K_i of 0.1 mM. In conclusion, our results support the notion that local Ca²⁺ release and Ca²⁺ sparks are modulated by Mg²⁺ in the intracellular environment. This seems to occur predominantly by hindering Ca²⁺-dependent activation of the RYRs through competitive Mg²⁺ occupancy of the high-affinity activation site of the channels. These findings help to characterize CICR in cardiac muscle under normal and pathological conditions, where the levels of Mg²⁺ and ATP can change.     

Carbon,nitrogen and O2 fluxes associated with the cyanobacterium Nodularia spumigena in the Baltic Sea

Photosynthesis, respiration, N₂ fixation and ammonium release were studied directly in Nodularia spumigena during a bloom in the Baltic Sea using a combination of microsensors, stable isotope tracer experiments combined with nanoscale secondary ion mass spectrometry (nanoSIMS) and fluorometry. Cell-specific net C- and N₂-fixation rates by N. spumigena were 81.6±6.7 and 11.4±0.9 fmol N per cell per h, respectively. During light, the net C:N fixation ratio was 8.0±0.8. During darkness, carbon fixation was not detectable, but N₂ fixation was 5.4±0.4 fmol N per cell per h. Net photosynthesis varied between 0.34 and 250 nmol O₂ h⁻¹ in colonies with diameters ranging between 0.13 and 5.0 mm, and it reached the theoretical upper limit set by diffusion of dissolved inorganic carbon to colonies (>1 mm). Dark respiration of the same colonies varied between 0.038 and 87 nmol O₂ h⁻¹, and it reached the limit set by O₂ diffusion from the surrounding water to colonies (>1 mm). N₂ fixation associated with N. spumigena colonies (>1 mm) comprised on average 18% of the total N₂ fixation in the bulk water. Net NH₄⁺ release in colonies equaled 8–33% of the estimated gross N₂ fixation during photosynthesis. NH₄⁺ concentrations within light-exposed colonies, modeled from measured net NH₄⁺ release rates, were 60-fold higher than that of the bulk. Hence, N. spumigena colonies comprise highly productive microenvironments and an attractive NH₄⁺ microenvironment to be utilized by other (micro)organisms in the Baltic Sea where dissolved inorganic nitrogen is limiting growth.     

Incoming nucleotide binds to Klenow ternary complex leading to stable physical sequestration of preceding dNTP on DNA

Klenow–DNA complex is known to undergo a rate-limiting, protein conformational transition from an ‘open’ to ‘closed’ state, upon binding of the ‘correct’ dNTP at the active site. In the ‘closed’ state, Mg²⁺ mediates a rapid chemical step involving nucleophilic displacement of pyrophosphate by the 3′ hydroxyl of the primer terminus. The enzyme returns to the ‘open’ state upon the release of PPi and translocation permits the next round of reaction. To determine whether Klenow can translocate to the next site on the addition of the next dNTP, without the preceding chemical step, we studied the ternary complex (Klenow–DNA–dNTP) in the absence of Mg²⁺. While the ternary complex is proficient in chemical addition of dNTPs in Mg²⁺, as revealed by primer extensions, the same in Mg²⁺-deficient conditions lead to non-covalent (physical) sequestration of first two ‘correct’ dNTPs in the ternary complex. Moreover, the second dNTP traps the first one in the DNA-helix of the ternary complex. Such a dNTP–DNA complex is found to be stable even after the dissociation of Klenow. This reveals the novel state of the dNTP–DNA complex where the complementary base is stacked in a DNA-helix non-covalently, without the phosphodiester linkage. Further, shuttling of the DNA between the polymerase and the exonuclease site mediates the release of such a DNA complex. Interestingly, Klenow in such a Mg²⁺-deficient ternary complex exhibits a ‘closed’ conformation.     

Altered Na+ and Li+ Homeostasis in Saccharomyces cerevisiae Cells Expressing the Bacterial Cation Antiporter NhaA

The bacterial Na⁺(Li⁺)/H⁺ antiporter NhaA has been expressed in the yeast Saccharomyces cerevisiae. NhaA was present in both the plasma membrane and internal membranes, and it conferred lithium but not sodium tolerance. In cells containing the yeast Ena1-4 (Na⁺, Li⁺) extrusion ATPase, the extra lithium tolerance conferred by NhaA was dependent on a functional vacuolar H⁺ ATPase and correlated with an increase of lithium in an intracellular pool which exhibited slow efflux of cations. In yeast mutants without (Na⁺, Li⁺) ATPase, lithium tolerance conferred by NhaA was not dependent on a functional vacuolar H⁺ ATPase and correlated with a decrease of intracellular lithium. NhaA was able to confer sodium tolerance and to decrease intracellular sodium accumulation in a double mutant devoid of both plasma membrane (Na⁺, Li⁺) ATPase and vacuolar H⁺ ATPase. These results indicate that the bacterial antiporter NhaA expressed in yeast is functional at both the plasma membrane and the vacuolar membrane. The phenotypes conferred by its expression depend on the functionality of plasma membrane (Na⁺, Li⁺) ATPase and vacuolar H⁺ ATPase.     

Platinum cross-linking of adenines and guanines on the quadruplex structures of the AG3(T2AG3)3 and (T2AG3)4 human telomere sequences in Na+ and K+ solutions

The quadruplex structures of the human telomere sequences AG₃(T₂AG₃)₃ I and (T₂AG₃)₄ II were investigated in the presence of Na⁺ and K⁺ ions, through the cross-linking of adenines and guanines by the cis- and trans-[Pt(NH₃)₂(H₂O)₂](NO₃)₂ complexes 1 and 2. The bases involved in chelation of the cis- and trans-Pt(NH₃)₂ moieties were identified by chemical and 3′-exonuclease digestions of the products isolated after denaturing gel electrophoresis. These are the four adenines of each sequence and four out of the 12 guanines. Two largely different structures have been reported for I: A from NMR data in Na⁺ solution and B from X-ray data of a K⁺-containing crystal. Structure A alone agrees with our conclusions about the formation of the A1–G10, A13–G22, A1–A13 platinum chelates at the top of the quadruplex and A7–A19, G4–A19 and A7–G20 at the bottom, whether the Na⁺ or K⁺ ion is present. At variance with a recent proposal that structures A and B could be the major species in Na⁺ and K⁺ solutions, respectively, our results suggest that structure A exists predominantly in the presence of both ions. They also suggest that covalent platinum cross-linking of a human telomere sequence could be used to inhibit telomerase.     

The Na+-Responsive ntp Operon Is Indispensable for Homeostatis of K+ and Na+ in Enterococcus hirae at Limited Proton Potential

Enterococcus hirae ATCC 9790 grew well in Na⁺-deficient, low-K⁺ medium, but growth was inhibited by carbonylcyanide m-chlorophenylhydrazone (CCCP). Growth inhibition and decrease of cellular K⁺ levels in the presence of CCCP were relieved by the addition of Na⁺ and a high concentration of K⁺. In contrast, in the mutant defective in Na⁺-ATPase or the NtpJ component of the KtrII K⁺ uptake system, CCCP-induced growth inhibition was rescued by a high concentration of K⁺ but not of Na⁺. These transporters are thus indispensable for homeostatis of K⁺ and Na⁺ at low proton potential.     

Effects of polyamines on the thermal stability and formation kinetics of DNA duplexes with abnormal structure

The effects of ions (i.e. Na⁺, Mg²⁺ and polyamines including spermidine and spermine) on the stability of various DNA oligonucleotides in solution were studied. These synthetic DNA molecules contained sequences that mimic various cellular DNA structures, such as duplexes, bulged loops, hairpins and/or mismatched base pairs. Melting temperature curves obtained from the ultraviolet spectroscopic experiments indicated that the effectiveness of the stabilization of cations on the duplex formation follows the order of spermine > spermidine > Mg²⁺ > Na⁺ > Tris–HCl buffer alone at pH 7.3. Circular dichroism spectra showed that salts and polyamines did not change the secondary structures of those DNA molecules under study. Surface plasmon resonance (SPR) observations suggested that the rates of duplex formation are independent of the kind of cations used or the structure of the duplexes. However, the rate constants of DNA duplex dissociation decrease in the same order when those cations are involved. The enhancement of the duplex stability by polyamines, especially spermine, can compensate for the instability caused by abnormal structures (e.g. bulged loops, hairpins or mismatches). The effects can be so great as to make the abnormal DNAs as stable as the perfect duplex, both kinetically and thermodynamically. Our results may suggest that the interconversion of various DNA structures can be accomplished readily in the presence of polyamine. This may be relevant in understanding the role of DNA polymorphism in cells.     

Sodium Ion Cycle in Bacterial Pathogens: Evidence from Cross-Genome Comparisons

Analysis of the bacterial genome sequences shows that many human and animal pathogens encode primary membrane Na⁺ pumps, Na⁺-transporting dicarboxylate decarboxylases or Na⁺-translocating NADH:ubiquinone oxidoreductase, and a number of Na⁺-dependent permeases. This indicates that these bacteria can utilize Na⁺ as a coupling ion instead of or in addition to the H⁺ cycle. This capability to use a Na⁺ cycle might be an important virulence factor for such pathogens as Vibrio cholerae, Neisseria meningitidis, Salmonella enterica serovar Typhi, and Yersinia pestis. In Treponema pallidum, Chlamydia trachomatis, and Chlamydia pneumoniae, the Na⁺ gradient may well be the only energy source for secondary transport. A survey of preliminary genome sequences of Porphyromonas gingivalis, Actinobacillus actinomycetemcomitans, and Treponema denticola indicates that these oral pathogens also rely on the Na⁺ cycle for at least part of their energy metabolism. The possible roles of the Na⁺ cycling in the energy metabolism and pathogenicity of these organisms are reviewed. The recent discovery of an effective natural antibiotic, korormicin, targeted against the Na⁺-translocating NADH:ubiquinone oxidoreductase, suggests a potential use of Na⁺ pumps as drug targets and/or vaccine candidates. The antimicrobial potential of other inhibitors of the Na⁺ cycle, such as monensin, Li⁺ and Ag⁺ ions, and amiloride derivatives, is discussed.     

Mechanisms underlying cell death in ischemia-like damage to the rat spinal cord in vitro

New spinal cord injury (SCI) cases are frequently due to non-traumatic causes, including vascular disorders. To develop mechanism-based neuroprotective strategies for acute SCI requires full understanding of the early pathophysiological changes to prevent disability and paralysis. The aim of our study was to identify the molecular and cellular mechanisms of cell death triggered by a pathological medium (PM) mimicking ischemia in the rat spinal cord in vitro. We previously showed that extracellular Mg²⁺ (1 mM) worsened PM-induced damage and inhibited locomotor function. The present study indicated that 1 h of PM+Mg²⁺ application induced delayed pyknosis chiefly in the spinal white matter via overactivation of poly (ADP-ribose) polymerase 1 (PARP1), suggesting cell death mediated by the process of parthanatos that was largely suppressed by pharmacological block of PARP-1. Gray matter damage was less intense and concentrated in dorsal horn neurons and motoneurons that became immunoreactive for the mitochondrial apoptosis-inducing factor (the intracellular effector of parthanatos) translocated into the nucleus to induce chromatin condensation and DNA fragmentation. Immunoreactivity to TRPM ion channels believed to be involved in ischemic brain damage was also investigated. TRPM2 channel expression was enhanced 24 h later in dorsal horn and motoneurons, whereas TRPM7 channel expression concomitantly decreased. Conversely, TRPM7 expression was found earlier (3 h) in white matter cells, whereas TRPM2 remained undetectable. Simulating acute ischemic-like damage in vitro in the presence of Mg²⁺ showed how, during the first 24 h, this divalent cation unveiled differential vulnerability of white matter cells and motoneurons, with distinct changes in their TRPM expression.     

Age-Related Reference Intervals of the Main Biochemical and Hematological Parameters in C57BL/6J, 129SV/EV and C3H/HeJ Mouse Strains

Background

Although the mouse is the animal model most widely used to study the pathogenesis and treatment of human diseases, reference values for biochemical parameters are scanty or lacking for the most frequently used strains. We therefore evaluated these parameters in the C57BL/6J, 129SV/EV and C3H/HeJ mice.

Methodology/Principal Findings

We measured by dry chemistry 26 analytes relative to electrolyte balance, lipoprotein metabolism, and muscle/heart, liver, kidney and pancreas functions, and by automated blood counter 5 hematological parameters in 30 animals (15 male and 15 female) of each mouse strain at three age ranges: 1–2 months, 3–8 months and 9–12 months. Whole blood was collected from the retro-orbital sinus. We used quality control procedures to investigate analytical imprecision and inaccuracy. Reference values were calculated by non parametric methods (median and 2.5^th and 97.5^th percentiles). The Mann-Whitney and Kruskal-Wallis tests were used for between-group comparisons. Median levels of GLU, LDH, Chol and BUN were higher, and LPS, AST, ALP and CHE were lower in males than in females (p range: 0.05–0.001). Inter-strain differences were observed for: (1) GLU, t-Bil, K⁺, Ca⁺⁺, PO₄ ⁻ (p<0.05) and for TAG, Chol, AST, Fe⁺⁺ (p<0.001) in 4–8 month-old animals; (2) for CK, Crea, Mg⁺⁺, Na⁺⁺, K⁺, Cl⁻ (p<0.05) and BUN (p<0.001) in 2- and in 10–12 month-old mice; and (3) for WBC, RBC, HGB, HCT and PLT (p<0.05) during the 1 year life span.

Conclusion/Significance

Our results indicate that metabolic variations in C57BL/6J, 129SV/EV and C3H/HeJ mice after therapeutic intervention should be evaluated against gender- and age-dependent reference intervals.