Marine biodiversity and ecosystem functioning: what's known and what's next?

Marine ecosystems are experiencing rapid and pervasive changes in biodiversity and species composition. Understanding the ecosystem consequences of these changes is critical to effectively managing these systems. Over the last several years, numerous experimental manipulations of species richness have been performed, yet existing quantitative syntheses have focused on a just a subset of processes measured in experiments and, as such, have not summarized the full data available from marine systems. Here, we present the results of a meta‐analysis of 110 marine experiments from 42 studies that manipulated the species richness of organisms across a range of taxa and trophic levels and analysed the consequences for various ecosystem processes (categorised as production, consumption or biogeochemical fluxes). Our results show that, generally, mixtures of species tend to enhance levels of ecosystem function relative to the average component species in monoculture, but have no effect or a negative effect on functioning relative to the ‘highest‐ performing’ species. These results are largely consistent with those from other syntheses, and extend conclusions to ecological functions that are commonly measured in the marine realm (e.g. nutrient release from sediment bioturbation). For experiments that manipulated three or more levels of richness, we attempted to discern the functional form of the biodiversity–ecosystem functioning relationship. We found that, for response variables related to consumption, a power‐function best described the relationship, which is also consistent with previous findings. However, we identified a linear relationship between richness and production. Combined, our results suggest that changes in the number of species will, on average, tend to alter the functioning of marine ecosystems. We outline several research frontiers that will allow us to more fully understand how, why, and when diversity may drive the functioning of marine ecosystems. Synthesis The oceans host an incredible number and variety of species. However, human activities are driving rapid changes in the marine environment. It is imperative we understand ecosystem consequences of any associated loss of species. We summarized data from 110 experiments that manipulated species diversity and evaluated resulting changes to a range of ecosystem responses. We show that losing species, on average, decreases productivity, growth, and a myriad of other processes related to how marine organisms capture and utilize resources. Finally, we suggest that the loss of species may have stronger consequences for some processes than others.     

Coprological diagnosis: what's new?

Analysis of faecal samples for the presence of parasite eggs, larvae, cysts and oocysts is the most widely used diagnostic procedure both in veterinary and human parasitology. After its fundation by C. J. Davaine in 1857, several copromicroscopic techniques have been developed. The McMaster technique developed and improved at the McMaster laboratory of the University of Sidney (whose name derives from one of the great benefactors in veterinary research in Australia, the McMaster family) is the most universally used technique for estimating the number of parasite elements in faeces. In the literature, however, many variations of the McMaster technique are to be found, and there is a clear need for the standardization of this technique. Recently, we have conducted a study in order to evaluate the influence of flotation solution, sample dilution, and the choice of McMaster slide area (volume) on the reliability of the McMaster technique in estimating the egg counts of gastrointestinal strongyles and Dicrocoelium dendriticum in a composite sample of faeces from naturally infected sheep. The study used 14 flotation solutions (having specific gravities between 1.200 and 1.450), 6 sample dilutions (1:10, 1:15, 1:20, 1:30, 1:40 and 1:50), and 4 McMaster slide areas (volumes) (McM 0.15 ml, McM 0.3 ml, McM 0.5 ml and McM 1.0 ml). The type of flotation solution used significantly influenced the EPG in the GI strongyle and in the D. dendriticum egg counts. All the sucrose based solutions at s.g. between 1.200 and 1.350 floated more GI strongyle eggs than the others. With respect to D. dendriticum, only six solutions were capable of floating eggs and the potassium jodomercurate solution (s.g.1.440) floated more eggs than the others. The reliability of the McMaster technique regarding sample dilution was high for both GI strongyle and D. dendriticum EPG at 1:10 and 1:15, and then progressively decreased with increasing dilution. The reliability of the McMaster technique regarding the choice of the McMaster slide area (volume) was high for both GI strongyle and D. dendriticum EPG at the McMaster slide area (volume) of 1.0 ml, i.e., the total area of the McMaster slide. The EPG counts resulting from choosing any of the other three McMaster slide areas (volumes), i.e. McM 0.15 ml, McM 0.3 ml, or McM 0.5 ml, produced unreliable over-estimates. In order to improve the sensitivity of copromicroscopic diagnosis, at our laboratory a novel technique (flotation-translation) was established based upon a new apparatus, the FLOTAC. This technique allows, after the centrifugation, the real count of the parasite elements in 1 gram of feaces.     

IAPs: what's in a name?

Originally described in insect viruses, cellular proteins with Baculoviral IAP repeat (BIR) motifs have been thought to function primarily as inhibitors of apoptosis. The subsequent finding that a subset of IAPs that contain a RING domain have ubiquitin protein ligase (E3) activity implied the presence of other functions. It is now known that IAPs are involved in mitotic chromosome segregation, cellular morphogenesis, copper homeostasis, and intracellular signaling. Here, we review the current understanding of the roles of IAPs in apoptotic and nonapoptotic processes and explore the notion that the latter represents the primary physiologic activities of IAPs.     

Ubiquitin junction, what's your function?

A report on the Ubiquitin and Intracellular Protein Degradation FASEB summer conference, Saxtons River, USA, 23-28 June 2001.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

The antibiotic resistome: what's new?

1. Download : Download high-res image (133KB)
2. Download : Download full-size image

     

Nomenclature: or what's in a name?

Transgenic Research -     

Cellular evolution: what's in a mitochondrion?

Mitochondria and their relatives constitute a wide range of organelles, only some of which function in aerobic respiration. Mitochondrial remnants from different anaerobic lineages show a striking degree of functional convergence.     

Stereoscopic vision: what's the first step?

Neurons in primary visual cortex respond to binocular disparity, the raw material of stereoscopic depth perception. Although these neurons are probably essential to depth perception, a recent study has shown that they are unable to compute depth itself.     

LAP proteins: what's up with epithelia?

How cells maintain their overall shape and size, and the related question of how proteins and other molecules reach and stay at their specific subcellular locations, are among the most difficult and exciting problems in cell biology. Three recent studies have made a significant contribution to this area by identifying new proteins, called LAP proteins, that have critical functions in maintaining the shape and apical-basal polarity of epithelial cells.     

Men and sin: what's the difference?

A conserved signalling cascade--termed the mitotic-exit network in budding yeast and the septation-initiation network in fission yeast--controls key events during exit from mitosis and cytokinesis. Although the components of these signalling networks are highly conserved between the two yeasts, the outputs seem quite different. How, then, do these two pathways function, and how are they regulated?     

Wnt: what's needed to maintain pluripotency?

A precise role for the canonical Wnt pathway in maintaining pluripotency in mouse embryonic stem cells (mESCs) has been debated. Four recent reports add pieces to the puzzle and together these results may help establish a robust model.     

Marine nitrogen fixation: what's the fuss?

Biological nitrogen fixation is a much more important process in the nitrogen cycle of the oceans than previously thought. Further, nitrogen fixation may have an influence on the capacity of the oceans to sequester carbon. A greater diversity of marine nitrogen fixers has also been uncovered but their quantitative significance remains to be determined.