Copy number of tandem direct repeats within the inverted repeats of Marek's disease virus DNA

We previously reported that DNA of the oncogenic strain BC-1 of Marek's disease virus serotype 1 (MDV1) contains three units of tandem direct repeats with 132 base pair (bp) repeats within the inverted repeats of the long regions of the MDV1 genome, whereas the attenuated, nononcogenic viral DNA contains multiple units of tandem direct repeats (Maotani et al., 1986). In the present study, the difference in the copy numbers of 132 bp repeats of oncogenic and nononcogenic MDV1 DNAs in other strains of MDV1 was investigated by Southern blot hybridization. The main copy numbers in different oncogenic MDV1 strains differed: those of BC-1, JM and highly oncogenic Md5 were 3, 5 to 12 and 2, respectively. The viral DNA population with two units of repeats was small, but detectable, in cells infected with either the oncogenic BC-1 or JM strain. The MDV1 DNA in various MD cell lines contained either two units or both two and three units of repeats. The significance of the copy number of repeats in oncogenicity of MDV1 is discussed.     

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.     

Identification and nucleotide sequences of two similar tandem direct repeats in Epstein-Barr virus DNA

Epstein-Barr virus DNA is known to have partially homologous segments, designated DL and DR, near the left and right ends of the long unique region (Raab-Traub et al., Cell 22:257-267, 1980). DL and DR are each partially composed of tandem direct repeat sequences. DL contains 11 to 14 repeats of a 124-base-pair sequence designated IR2. DR contains approximately 30 direct repeats of a 103-base-pair sequence designated IR4. The DL and DR sequences have colinear partial homology for approximately 2.4 and 1.5 kilobase pairs to the right of IR2 and IR4, respectively. IR2 and IR4 are similar sequences and evolved in part from a common ancestor. Both sequences are 84% guanine and cytosine and have limited homology to Epstein-Barr virus IR1 and to the herpes simplex virus type 1 inverted terminal repeat "a" sequence. IR2 encodes part of an abundant 2.5-kilobase persistent early EBV RNA expressed in productively infected cells, but does not encode part of the 3-kilobase Epstein-Barr virus RNA which is transcribed from the adjacent IR1-U2 region of the Epstein-Barr virus genome in latently infected cells.     

Short direct repeats mediate spontaneous high-frequency deletions in DNA of minute virus of mice.

Previous work (E. A. Faust and D. C. Ward, J. Virol. 32:276-292, 1979) revealed a remarkably high rate of spontaneous deletion in viral DNA during lytic infection of cultured murine cells with minute virus of mice (MVM), an autonomous parvovirus. In the present study, we have isolated plasmid and phage recombinants containing MVM DNA inserts bearing deletions and we have determined the DNA sequence spanning three deletion junctions. The deletions, which average 3 kilobases in length, occur between pairs of perfectly homologous 4- to 10-base-pair direct repeats, such that one copy of the repeated sequence is lost, whereas the other remains behind at the deletion junction. When compared, the three sets of direct repeats exhibit no apparent sequence homology and have an A + T content of between 50 and 80%. These results indicate that 4- to 10-base-pair homologies mediate spontaneous deletion formation in the MVM genome and highlight parvoviruses as novel model systems for studies of this ubiquitous pathway of genetic variation.     

Sequence of the short unique region, short repeats, and part of the long repeats of human cytomegalovirus

We have determined the DNA sequence (46 kilobases) of the short unique region, the short repeat, and part of the long repeat of human cytomegalovirus strain AD169. Analysis of the sequence has revealed at least 38 possible regions that may code for protein. Many of these open reading frames show homology to each other, and five groups of homologous reading frames are identified. Half of the predicted translation products appear to be membrane proteins, and fall into two distinct classes; those that have potential signal and anchor sequences, and those that have seven potential membrane-spanning regions and appear to be integral membrane proteins. A number of the former class contain sites for N-linked glycosylation and may therefore be glycoproteins. None of the 38 open reading frames shows homology to other known herpesvirus proteins.     

Genome-wide analysis of long,exact DNA repeats in rhizobia

The rhizobia are a group of bacteria widely studied for their capacity to form intimate symbiotic relationships with leguminous plants. However, they are also interesting for containing a remarkable abundance of repetitive genetic elements, such as long DNA repeats. In this study we deeply analyzed long, exact DNA repeats in five representative rhizobial genomes; Rhizobium etli, Rhizobium leguminosarum, Bradyrhizobium japonicum, Sinorhizobium meliloti and Mesorhizobium loti. The results suggest that a huge proportion of repeats can be located in either plasmid or chromosome replicons, except in B. japonicum, which lacks plasmids, but contains the largest number, and longest repeat elements of the genomes analyzed here. Interestingly, we detected a slight correlation between the density of repeats (either number or length) and genome size. As expected, the highest percentage of DNA repeats code for mobile genetic elements, including insertion sequences, recombinases, and transposases. Some repeats corresponded to non-coding or intergenic regions, while in genomes like that of R. etli, a significant percentage of large repeats, mainly located in plasmids, were strongly associated with symbiotic and nitrogen fixation activities. In conclusion, our analysis shows that rhizobial genomes contain a high density of long DNA repeats, which might facilitate recombination events and genome rearrangements, functioning in adaption and persistence during saprophytic or symbiotic life.     

The role of direct oligonucleotide repeats in gonococcal pilin gene variation

Previous studies indicate that gonococcal pilin phase and antigenic variation occur by intragenomic pilin gene recombination, the outcome of which resembles that of gene conversion. During such transitions, the expressed complete pilin gene (pilE) acquires a novel sequence corresponding to that of a silent pilin gene (pilS). In the present study, we find that internal deletions of pilE can produce pilus-/pilus+ phase transitions: direct oligonucleotide repeats in the pilin-encoding portion of pilE bracket the deleted segments. A novel, orthodox pilE is formed upon repair of the internal deletions, with pilS sequence probably acting as a template for repair. Such deletion/repair of pilE is suggested as a principal mechanism underlying gonococcal pilus variation.     

DNA sequence of the US component of the varicella-zoster virus genome

The linear duplex DNA molecule of varicella-zoster virus is 120 000 bp in size and has the sequence arrangement UL-IRS-US-TRS, where UL and US are unique sequences and IRS and TRS are inverted repeats flanking US. The primary structure of the cloned SstI g DNA fragment containing US (5232 bp) and adjacent portions of IRS and TRS (426 bp of each) was determined, and the following model for genetic expression was derived from an analysis of the sequence. The region specifies four mRNAs encoding primary translation products with mol. wts. of 11, 44, 39 and either 74 or 70 kd. The 39-and 70-kd proteins have primary structures characteristic of membrane proteins. The mRNAs encoding the 11- and 74/70-kd proteins extend from opposite sides of US into IRS/TRS, thus sharing a common 3' terminus. These proteins do not share a common carboxy terminus because the coding region for the 11-kd protein terminates at the junction between US and IRS, whereas that for the 74/70-kd protein extends into TRS. The analysis affirms the hypothesis that the extent of inverted repeats in herpesvirus genomes is primarily a result of constraints imposed by adjacent protein coding sequences.     

Sequence instability in the long terminal repeats of avian spleen necrosis virus and reticuloendotheliosis virus

Summary Sequence divergence between the 3 long terminal repeats (LTR) of avian reticuloendotheliosis virus (REV), deletion variant proviral clone 2-20-4, and spleen necrosis virus (SNV)—proviral clones 14-44, 60, and 70—was found to involve two classes of base substitutions: low-frequency interspersed and high-frequency clustered substitutions. Clones 2-20-4 and 14-44 have diverged 4.4% owing to low-frequency substitutions. In contrast, two high-frequency substitution segments have diverged by 30% and 29%, respectively. Clustered substitutions appear to be located either within or next to tandem repeats, suggesting their introduction concomitant with sequence deletions and duplications commonly associated with such repeats. A new 19-bp tandem repeat is found in clone 2-20-4. Its sequence could have evolved from the 26-bp repeats found in the SNV clones.     

Proliferation of direct repeats near the Oenothera chloroplast DNA origin of replication

The spacer between the 16S and 23S rRNA genes of the chloroplast DNA has been implicated as an origin of replication in several species of plants. In the evening primrose, Oenothera, this site was found to vary greatly in size, with plastid genomes (plastomes) being readily distinguished. To determine whether plastome "strength" in transmission could be correlated with variation at oriB, the 16S rRNA-trnI spacer was sequenced from five plastomes. The size variation was found to be due to differential amplification (and deletion) of combinations of sequences belonging to seven families of direct repeats. From these comparisons, one short series of direct repeats and one region capable of forming a hairpin structure were identified as candidates for the factor that could be responsible for the differences between strong and weak plastome types. Ample sequence variation allowed phylogenetic inferences to be made about the relationships among the plastomes. Phylogenetic trees also could be constructed for most of the families of direct repeats. The amplifications and deletions of repeats that account for the size variation at oriB are proposed to have occurred through extensive replication slippage at this site.      

DNA of Epstein-Barr virus. V. Direct repeats of the ends of Epstein-Barr virus DNA.

Previous data indicated that Epstein-Barr virus DNA is terminated at both ends by direct or inverted repeats of from 1 to 12 copies of a 3 X 10(5)-dalton sequence. Thus, restriction endonuclease fragments which include either terminus vary in size by 3 X 10(5)-dalton increments (D. Given and E. Kieff, J. Virol. 28:524--542, 1978; S. D. Hayward and E. Kieff, J. Virol. 23:421--429, 1977). Furthermore, defined fragments containing either terminus hybridize to each other (Given and Kieff, J. Virol. 28:524--542, 1978). The 5' ends of the DNA are susceptible to lambda exonuclease digestion (Hayward and Kieff, J. Virol. 23:421--429, 1977). To determine whether the terminal DNA is a direct or inverted repeat, the structures formed after denaturation and reannealing of the DNA from one terminus and after annealing of lambda exonuclease-treated DNA were examined in the electron microscope. The data were as follows. (i) No inverted repeats were detected within the SalI D or EcoRI D terminal fragments of Epstein-Barr virus DNA. The absence of "hairpin- or pan-handle-like" structures in denatured and partially reannealed preparations of the SalI D or EcoRI D fragment and the absence of repetitive hairpin- or pan-handle-like structures in the free 5' tails of DNA treated with lambda exonuclease indicate that there is no inverted repeat within the 3 X 10(5)-dalton terminal reiteration. (ii) Denatured SalI D or EcoRI D fragments reanneal to form circles ranging in size from 3 X 10(5) to 2.5 X 1O(6) daltons, indicating the presence of multiple direct repeats within this terminus. (iii) Lambda exonuclease treatment of the DNA extracted from virus that had accumulated in the extracellular fluid resulted in asynchronous digestion of ends and extensive internal digestion, probably a consequence of nicks and gaps in the DNA. Most full-length molecules, after 5 min of lambda exonuclease digestion, annealed to form circles, indicating that there exists a direct repeat at both ends of the DNA. (iv) The finding of several circularized molecules with small, largely double-strand circles at the juncture of the ends indicates that the direct repeat at both ends is directly repeated within each end. Hybridization between the direct repeats at the termini is likely to be the mechanism by which Epstein-Barr virus DNA circularizes within infected cells (T. Lindahl, A. Adams, G. Bjursell, G. W. Bornkamm, C. Kaschka-Dierich, and U. Jehn, J. Mol. Biol. 102:511-530, 1976).     

Statistical evidence for the correlation of DNA deletions in prokaryotic genomes with direct repeats

In the present work a computer analysis of deletion localization in the sequence of the E. coli lacI gene has been carried out by the statistical weight method. Reliable statistical correlation of the deletions location sites with the arrangement of the most perfect direct repeats revealing the shortest distance between repeated fragments has been shown. At the same time statistical analysis did not reveal reliable connection of deletions localization regions with the expected sites of gyrase recognition, sites and other recombination sites. A conclusion has been drawn, that the mechanism of deletions emergence on the basis of repeats appears to be predominant.     

Investigation of varicella-zoster virus DNA in lymphocyte subpopulations by quantitative PCR assay

To investigate the nature of viremia during the acute phase of varicella, we studied the viral load in nine otherwise healthy children with varicella. Plasma and peripheral blood mononuclear cells (PBMC) were obtained, then PBMC were divided into CD4+T, CD8+T, and B lymphocytes and monocyte/macrophage fractions. The viral DNA in each component was quantified using a real-time quantitative polymerase chain reaction assay. Varicella-zoster virus (VZV) DNA was detected in plasma, PBMC and all subpopulations. The amount of viral DNA was similar in each PBMC subpopulation, suggesting that each lymphocyte fraction and monocytes carry similar amounts of VZV DNA during viremia.     

Tandem repeats within the inverted terminal repetition of vaccinia virus DNA

A tandemly repeated sequence within the genome of vaccinia virus is cut to fragments of approximately 70 bp by Hinf I, Taq I or Mbo II. The 70 bp repetition was localized within the much larger (10,300 bp) inverted terminal repetition by restriction analysis of cloned DNA fragments and by hybridization of the purified 70 bp repeat to vaccinia virus DNA restriction fragments. The molar abundance of the 70 bp fragment corresponds to a 30 fold repetition at each end of the genome. The repeating restriction endonuclease sites were mapped by agarose gel electrophoresis of partial Hinf I digests of the terminally labeled cloned DNA fragment. The first of 13 repetitive Hinf I sites occurred approximately 150 bp from the end of the cloned DNA. After an intervening sequence of approximately 435 bp, a second series of 17 repetitive Hinf I sites occurred. The DNA between the two blocks of repetitions has a unique sequence containing single Dde I, Alu I and Sau 3A sites. Tandem repeats within the inverted terminal repetition could serve to accelerate self-annealing of single strands of DNA to form circular structures during replication.