Binding of novel 9-O–N-aryl/arylalkyl amino carbonyl methyl berberine analogs to poly(U)-poly(A)·poly(U) triplex and comparison to the duplex poly(A)-poly(U)

Interaction of the 9-O–N-aryl/arylalkyl amino carbonyl methyl substituted analogs of the anticancer isoquinoline alkaloid berberine with RNA triplex, poly(U)-poly(A)·poly(U) has been studied in comparison to the duplex poly(A)-poly(U), using multiple biophysical techniques. Spectrophotometric and spectrofluorimetric studies established the non-cooperative binding mode of all the analogs with both the duplex and the triplex. However, berberine exhibited cooperative binding with poly(A)-poly(U) and non-cooperative binding with poly(U)-poly(A)·poly(U). Analog BER1 showed the highest affinity to both the duplex and the triplex followed by BER2 and BER3. The overall binding affinity varied as BER1 > BER2 > BER3 > BER. The magnitude of the quantum efficiency values (Q > 1) revealed that energy was transferred from the bases of the triplex and the duplex to the analogs. Comparative ferrocyanide quenching and viscosity studies unambiguously established a stronger intercalative geometry of the analogs to both the triplex and the duplex in comparison to berberine. Circular dichroism studies revealed that the alkaloids perturbed the conformation of both RNA helices. The binding of all the alkaloids was found to be exothermic from isothermal titration studies. Binding of the analogs was highly entropy driven while that of berberine was enthalpy dominated. The results presented here reveal strong and specific binding of these new berberine analogs to the RNA triplex and duplex and highlight the remarkable influence of the 9-substitution on the interaction profile.     

Synthesis and in vitro evaluation of 12-(substituted aminomethyl) berberrubine derivatives as anti-diabetics

By introducing various amino methyl groups into 12-position of berberrubine, a series of 12-(substituted aminomethyl) berberrubine derivatives were synthesized and evaluated for their anti-diabetic activity against type 2 diabetes mellitus. The results indicated that most of the prepared compounds exhibited moderate to good anti-diabetic activity, which were comparable to or even better than the berberine, the positive control rosiglitazone and insulin. Especially, compound 3b with an N-methyl piperazine-4-methyl group at C-12, exerted the most powerful anti-diabetic activity.     

Activation of AMP-activated protein kinase is required for berberine-induced reduction of atherosclerosis in mice: the role of uncoupling protein 2

Aims

Berberine, a botanical alkaloid purified from Coptidis rhizoma, is reported to activate the AMP-activated protein kinase (AMPK). Whether AMPK is required for the protective effects of berberine in cardiovascular diseases remains unknown. This study was designed to determine whether AMPK is required for berberine-induced reduction of oxidative stress and atherosclerosis in vivo.

Methods

ApoE (ApoE^-/-) mice and ApoE^-/-/AMPK alpha 2^-/- mice that were fed Western diets were treated with berberine for 8 weeks. Atherosclerotic aortic lesions, expression of uncoupling protein 2 (UCP2), and markers of oxidative stress were evaluated in isolated aortas.

Results

In ApoE^-/- mice, chronic administration of berberine significantly reduced aortic lesions, markedly reduced oxidative stress and expression of adhesion molecules in aorta, and significantly increased UCP2 levels. In contrast, in ApoE^-/-/AMPK alpha 2^-/- mice, berberine had little effect on those endpoints. In cultured human umbilical vein endothelial cells (HUVECs), berberine significantly increased UCP2 mRNA and protein expression in an AMPK-dependent manner. Transfection of HUVECs with nuclear respiratory factor 1 (NRF1)-specific siRNA attenuated berberine-induced expression of UCP2, whereas transfection with control siRNA did not. Finally, berberine promoted mitochondrial biogenesis that contributed to up-regulation of UCP2 expression.

Conclusion

We conclude that berberine reduces oxidative stress and vascular inflammation, and suppresses atherogenesis via a mechanism that includes stimulation of AMPK-dependent UCP2 expression.     

Targeting different RNA motifs by beta carboline alkaloid,harmalol: a comparative photophysical,calorimetric, and molecular docking approach

RNA has attracted recent attention for its key role in gene expression and targeting by small molecules for therapeutic intervention. This work focuses towards understanding interaction of harmalol, a DNA intercalator, with RNAs of different motifs viz. single-stranded A-form poly(A), double-stranded A-form of poly(C)·poly(G), and clover leaf tRNA^phe by different spectroscopic, calorimetric, and molecular modeling techniques. Results of this study converge to suggest that (i) binding constant varied in the order poly(C)·poly(G)?>?tRNA^phe > poly(A), (ii) non-cooperative binding of harmalol to poly(C)·poly(G) and poly(A) and cooperative binding with tRNA^phe, (iii) significant structural changes of poly(C)·poly(G) and tRNA^phe with concomitant induction of optical activity in the bound achiral alkaloid molecules, while with poly(A) no induced Circular dichroism (CD) perturbation was observed, (iv) the binding was predominantly exothermic, enthalpy-driven, entropy-favored with poly(C)·poly(G), while it was entropy driven with tRNA^phe and poly(A), (v) a hydrophobic contribution and comparatively large role of non polyelectrolytic forces to Gibbs energy changes with poly(C)·poly(G) and tRNA^phe and (vi) intercalated state of harmalol inside poly(C)·poly(G) structure as revealed from molecular docking was supported by the viscometric and ferrocyanide quenching data. All these findings unequivocally pointed out that harmalol prefers binding with poly(C)·poly(G), compared to tRNA^phe and poly(A); this results serve as data for the development of RNA-based antiviral drugs.     

Activation of several tRNAs of Escherichia coli by the phenoxyacetyl derivative of N-hydroxysuccinimide

Escherichia coli 15T^? treated with chloramphenicol produces tRNA^phe which is deficient in minor nucleosides. Undermodified tRNA^phe chromatographs as two new peaks from a benzoylated diethylaminoethyl-cellulose column. Chloramphenicol tRNA^phe was purified by phenoxyacetylation of phenylalanyl-tRNA and subsequent chromatography on benzoylated diethylaminoethyl-cellulose. Purified tRNA^phe had an altered Chromatographie profile as a result of the purification procedure. Phenoxyacetylation of an unpurified tRNA preparation, which was either charged with phenylalanine or kept discharged, resulted in a permanent alteration of tRNA^phe which was similar to the alteration of the purified tRNA^phe. The altered tRNAs eluted with higher salt or ethanol concentrations from benzoylated diethylaminoethyl-cellulose. The alteration was also shown for tRNA^phe of phenoxyacetylated tRNA from late log phase E. coli 15T?. tRNA^glu and tRNA^Leu were not changed, but both tRNA^Arg and tRNA^Ile were altered. tRNA₂^Val and tRNA^Met shifted in the elution profile; tRNA₁^Val and tRNA_f^Met were not affected.Comparison of the primary structures of the alterable and nonalterable tRNA's revealed that all alterable tRNA's have the undefined nucleoside X in the extra loop. Phenoxyacetylation of nucleoside X probably was the cause of the altered profiles.tRNA^phe from E. coli 15T^? treated with chloramphenicol was less reactive towards phenoxyacetylation than normal tRNA, possibly because of a different conformation of the modification-deficient molecule relative to the normal tRNA^phe. tRNA^phe from E. coli 15T^?, starved for cysteine and methionine and treated with chloram-phenicol, is more deficient in minor nucleosides and showed even less reactivity.Acceptor capacities of the altered tRNA species were not changed significantly; only the acceptor capacity for tRNA^Ile decreased approximately 25%. The recognition site for the aminoacyl-tRNA synthetases probably is not affected.     

Berberine attenuates experimental autoimmune encephalomyelitis in C57 BL/6 mice

Background

Berberine, an isoquinoline derivative alkaloid, has a wide range of pharmacological properties and is considered to have anti-inflammatory and neuroprotective effects. However, there are no reports about the effects and mechanisms of berberine in experimental autoimmune encephalomyelitis (EAE), an established model of multiple sclerosis (MS).

Methodology/Principal Findings

Female C57 BL/6 mice immunized with myelin oligodendrocyte glycoprotein 35–55 amino acid peptide were treated with berberine at the day of disease onset and medication was administered daily until mice were sacrificed. Blood–brain barrier (BBB) permeability and the alteration of matrix metalloproteinase-2 (MMP-2, 72 kDa) and matrix metalloproteinase-9 (MMP-9, 92 kDa) in the brain and cerebrospinal fluid (CSF) of EAE mice were detected by quantitative measurement for Evan''s blue (EB) content, Western blot and gelatin zymography respectively. The results showed that berberine attenuated clinical and pathological parameters of EAE, reduced the permeability of BBB, inhibited the activity and expression of MMP-9 but not MMP-2 in the CSF and brain of EAE mice.

Conclusions/Significance

These findings suggest that berberine is effective to attenuate the clinical severity of EAE in C57 BL/6 mice by reducing the permeability of BBB, decreasing the expression and activity of MMP-9, and decreasing the inflammatory infiltration. We think that berberine might be a potential therapeutic agent for MS.     

Crystal structure analysis reveals functional flexibility in the selenocysteine-specific tRNA from mouse

Background

Selenocysteine tRNAs (tRNA^Sec) exhibit a number of unique identity elements that are recognized specifically by proteins of the selenocysteine biosynthetic pathways and decoding machineries. Presently, these identity elements and the mechanisms by which they are interpreted by tRNA^Sec-interacting factors are incompletely understood.

Methodology/Principal Findings

We applied rational mutagenesis to obtain well diffracting crystals of murine tRNA^Sec. tRNA^Sec lacking the single-stranded 3′-acceptor end (^ΔGCCARNA^Sec) yielded a crystal structure at 2.0 Å resolution. The global structure of ^ΔGCCARNA^Sec resembles the structure of human tRNA^Sec determined at 3.1 Å resolution. Structural comparisons revealed flexible regions in tRNA^Sec used for induced fit binding to selenophosphate synthetase. Water molecules located in the present structure were involved in the stabilization of two alternative conformations of the anticodon stem-loop. Modeling of a 2′-O-methylated ribose at position U34 of the anticodon loop as found in a sub-population of tRNA^Sec in vivo showed how this modification favors an anticodon loop conformation that is functional during decoding on the ribosome. Soaking of crystals in Mn²⁺-containing buffer revealed eight potential divalent metal ion binding sites but the located metal ions did not significantly stabilize specific structural features of tRNA^Sec.

Conclusions/Significance

We provide the most highly resolved structure of a tRNA^Sec molecule to date and assessed the influence of water molecules and metal ions on the molecule''s conformation and dynamics. Our results suggest how conformational changes of tRNA^Sec support its interaction with proteins.     

Isolation and identification of berberine and berberrubine metabolites by berberine-utilizing bacterium Rhodococcus sp. strain BD7100

Based on the finding of a novel berberine (BBR)-utilizing bacterium, Rhodococcus sp. strain BD7100, we investigated the degradation of BBR and its analog berberrubine (BRU). Resting cells of BD7100 demethylenated BBR and BRU, yielding benzeneacetic acid analogs. Isolation of benzeneacetic acid analogs suggested that BD7100 degraded the isoquinoline ring of the protoberberine skeleton. This work represents the first report of cleavage of protoberberine skeleton by a microorganism.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Interaction of polyamines with fragments and whole molecules of yeast phenylalanine-specific transfer RNA

Binding of the polyamines spermidine (∼-+3) and spermine (∼-+4) to yeast tRNA^phe has been investigated by equilibrium dialysis under the same conditions used to study Mn²⁺-tRNA^phe interactions (Schreier & Schimmel, 1974). The polyamines bind to tRNA^phe in a co-operative and a non-co-operative phase, which is analogous to the behavior found with Mn²⁺. In the co-operative phase, the empirical index of co-operativity is somewhat greater for the polyamines, however. Binding constants for both the co-operative and non-co-operative phases are similar for Mn²⁺ and spermidine, and are strongest for spermine. Estimates of the total number of ligand binding sites indicate that these numbers are inversely proportional to the charge on the ligand for all three ligands. The interaction of polyamines with four large fragments of tRNA^phe shows no evidence for co-operativity. These results, together with recent kinetic studies, collectively suggest that polyamine binding to the co-operative sites is associated with tertiary structure formation and that polyamine and divalent metal ion interactions with tRNA occur by phenomenologically similar mechanisms, in spite of their structural diversity.     

Codon-Anticodon Binding in tRNA<Superscript>phe</Superscript>

THE anticodon loop of tRNA^phe of baker's yeast has the sequence (5′ to 3′) AY A A MeG U MeC. The unusual base Y, adjacent to the anticodon (AA MeG), is the only nucleotide in this tRNA which fluoresces at room temperature and because it absorbs to the red of all other bases, the excitation energy is localized on it exclusively. (7-Methyl guanine is another base in tRNA^phe which fluoresces in these conditions but its emission is so weak that it can only be observed in tRNA^phe from which Y has been excised.) The fluorescence spectrum undergoes a small blue shift in the presence of the complementary codon¹ and we report now the use of this shift to determine the association constants for this binding at several temperatures. The results suggest a simple thermodynamic model for the codon recognition step during protein synthesis.     

Comparison of the structures of the native form of rat liver 5S rRNA and yeast tRNAphe: small-angle and wide-angle X-ray scattering study

The small-angle and wide-angle X-ray scattering of tRNA^phe (yeast) and ribosomal 5S RNA (rat liver) in solution have been analysed and compared. tRNA^phe in solution is folded into a compact L-shaped structure similar to its structure in crystals. The geometry of the secondary structure of the double helical regions is also equivalent to the A-form in the crystalline state. Despite differences between the molar mosses of 5S rRNA (40 000 g mol^?1) and tRNA^phe (25 000 g mol^?1), and the fact that the 5S rRNA molecule is more anisometric than the tRNA^phe molecule, there are many structural similarities. The geometrical parameters of the secondary structure of double helical regions in both RNA molecules are almost identical; the mean rise per base pair is about 0.253–0.28 nm and the mean turn angle is about 32.5–33.5. Identical cross-sectional radii of gyration, R_sq,1 ≈ 1.16 nm and R_sq,2 = 0.92 nm, identical molar mass per unit length, , and a mean thickness of the molecules D ≈ 1.65 nm suggest a similar, nearly coplanar organization of isolated, double helical arms. Furthermore, there are compact regions in the central parts of both molecules, which are the sites of tertiary interactions in the tRNA^phe molecule and are a potential site of tertiary interactions in the SS rRNA molecule for stabilization of the complicated L-shape of the two molecules. Both molecules have a pseudo-twofold axis,w hich may play a role in recognition for binding of specific proteins.     

Gene rearrangements in gekkonid mitochondrial genomes with shuffling,loss, and reassignment of tRNA genes

Background

Vertebrate mitochondrial genomes (mitogenomes) are 16–18 kbp double-stranded circular DNAs that encode a set of 37 genes. The arrangement of these genes and the major noncoding region is relatively conserved through evolution although gene rearrangements have been described for diverse lineages. The tandem duplication-random loss model has been invoked to explain the mechanisms of most mitochondrial gene rearrangements. Previously reported mitogenomic sequences for geckos rarely included gene rearrangements, which we explore in the present study.

Results

We determined seven new mitogenomic sequences from Gekkonidae using a high-throughput sequencing method. The Tropiocolotes tripolitanus mitogenome involves a tandem duplication of the gene block: tRNA^Arg, NADH dehydrogenase subunit 4L, and NADH dehydrogenase subunit 4. One of the duplicate copies for each protein-coding gene may be pseudogenized. A duplicate copy of the tRNA^Arg gene appears to have been converted to a tRNA^Gln gene by a C to T base substitution at the second anticodon position, although this gene may not be fully functional in protein synthesis. The Stenodactylus petrii mitogenome includes several tandem duplications of tRNA^Leu genes, as well as a translocation of the tRNA^Ala gene and a putative origin of light-strand replication within a tRNA gene cluster. Finally, the Uroplatus fimbriatus and U. ebenaui mitogenomes feature the apparent loss of the tRNA^Glu gene from its original position. Uroplatus fimbriatus appears to retain a translocated tRNA^Glu gene adjacent to the 5’ end of the major noncoding region.

Conclusions

The present study describes several new mitochondrial gene rearrangements from Gekkonidae. The loss and reassignment of tRNA genes is not very common in vertebrate mitogenomes and our findings raise new questions as to how missing tRNAs are supplied and if the reassigned tRNA gene is fully functional. These new examples of mitochondrial gene rearrangements in geckos should broaden our understanding of the evolution of mitochondrial gene arrangements.

Electronic supplementary material

The online version of this article (doi:10.1186/1471-2164-15-930) contains supplementary material, which is available to authorized users.     

Role of berberine in ameliorating Schistosoma mansoni-induced hepatic injury in mice

Background

Schistosomiasis is caused by helminth parasites of the genus Schistosoma. Berberine chloride (BER), an isoquinoline alkaloid, has been used in vivo for its antiparasitic, antioxidant and hepatoprotective properties. In this study, the protective effect of BER and praziquantel has been compared for the extent of schistosomiasis-induced oxidative stress in hepatic tissue of mice.

Results

S. mansoni was able to induce inflammation and injury to the liver, evidenced (i) by an increase in inflammatory cellular infiltrations, dilated sinusoids and vacuolated hepatocytes, (ii) by decreased levels of alanine and aspartate aminotransferases and increased levels of alkaline phosphatase, γ-glutamyl transferase in the liver homogenate, (iii) by increased production of nitric oxide and thiobarbituric acid reactive substances, and (iv) by lowered glutathione levels and decreased activities of catalase and superoxide dismutase, respectively. All these infection-induced parameters were significantly altered during BER treatment. In particular, berberine counteracted the S. mansoni-induced loss of glutathione and the activities of catalase and superoxide dismutase.

Conclusion

Based on these results, it is concluded that berberine could ameliorate pre-existing liver damage and oxidative stress conditions due to schistosomiasis.     

Recognition of human telomeric G‐quadruplex DNA by berberine analogs: effect of substitution at the 9 and 13 positions of the isoquinoline moiety

G‐quadruplex forming sequences are widely distributed in human genome and serve as novel targets for regulating gene expression and chromosomal maintenance. They offer unique targets for anticancer drug development. Here, the interaction of berberine (BC) and two of its analogs bearing substitution at 9 and 13‐position with human telomeric G‐quadruplex DNA sequence has been investigated by biophysical techniques. Both the analogs exhibited several‐fold higher binding affinity than berberine. The Scatchard binding isotherms revealed non‐cooperative binding. 9‐ω‐amino hexyl ether analog (BC1) showed highest affinity (1.8 × 10⁶ M^?1) while the affinity of the 13‐phenylpropyl analog (BC2) was 1.09 × 10⁶ M^?1. Comparative fluorescence quenching and polarization anisotropy of the emission spectra gave evidence for a stronger stacking interaction of the analogs compared to berberine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberine. However, the binding of the analogs did not induce any major structural perturbation in the G‐quadruplex structure, but led to higher thermal stability. Energetics of the binding indicated that the association of the analogs was exothermic and predominantly entropy driven phenomenon. Increasing the temperature resulted in weaker binding; the enthalpic contribution increased and the entropic contribution decreased. A small negative heat capacity change with significant enthalpy–entropy compensation established the involvement of multiple weak noncovalent interactions in the binding process. The 9‐ω‐amino hexyl ether analog stabilized the G‐quadruplex structure better than the 13‐phenyl alkyl analog. Copyright © 2015 John Wiley & Sons, Ltd.     

Removal of Y-37 from tRNA phe yeast alters oligomer binding to two loops

The association constants of complementary oligomers were used to monitor changes in the structure of tRNA_yeast^phe as a consequence of excision of a single base Y in the anticodon loop and of clipping the molecule at the point of excision. Significant changes were found not only in the binding constants of oligomers complementary to the anticodon loop but also in the K of an oligomer complementary to the dihydro U loop. The results suggest that either a single base change in a tRNA may alter structure elsewhere in the molecule or that the acid treatment necessary to remove Y irreversibly alters the structure of tRNA_yeast^phe.     

Changes in Rhodopseudomonas sphaeroides isoaccepting phenylalanyl-tRNA species during transitions from chemoheterotrophic to photoheterotrophic growth

A new iso-accepting tRNA^phe from extracts of chemoheterotrophic and photoheterotrophic cells of Rhodopseudomonas sphaeroides has been identified by both BDEAE cellulose and RPC-5 chromatography. Rechromatography of each of the tRNA^phe species in either the acylated or deacylated state shows that they migrate as single homogeneous peaks.In steady-state chemoheterotrophic cultures of R. sphaeroides tRNA _I–II ^phe account for 25–30% of the total phenylalanine accepting activity while in steadystate photoheterotrophic cultures tRNA _I–II ^phe account for no more than 10% of the total phenylalanine accepting activity.During the transition from chemoheterotrophic to photoheterotrophic growth conditions the levels of tRNA _I–II ^phe fall in an exponential manner during the first half of the intracytoplasmic membrane induction period. tRNA _I ^phe then remains at a level 10% that of its steady-state chemoheterotrophic level as long as photoheterotrophic growth conditions remain. tRNA _II ^phe , after dropping to 10% of its former chemoheterotrophic level then returns to a level 50% that of its chemoheterotrophic level as long as photoheterotrophic growth conditions remain.Abbreviations BDEAE benzoylated diethyl amino ethyl - RPC reversed phase chromatography - TCA tricholroacetic acid - ICM intracytoplasmic membrane Submitted by WDS in partial fullfilment of requirements for the M.S. degree     

Intrinsic Precision of Aminoacyl-tRNA Synthesis Enhanced through Parallel Systems of Ligands

MOST aminoacyl-tRNAs possessed by an organism must contain amino-acids matched to their correct anticodon so that the meaning of structural genetic information will be preserved. It is only recently, however, that we have begun to understand the underlying molecular mechanisms with regard to isoleucyl-tRNA of Escherichia coli B. Isoleucyl-tRNA synthetase, which is representative of many others in size and other properties¹, is quite selective among tRNAs, in that it binds strongly only to the cognate tRNA^Ile species². However, a weaker, but still significant affinity for non-cognate tRNAs from E. coli can be detected³. In addition, non-cognates are isoleucylated (ref. 3 and unpublished work), albeit at a maximum rate considerably slower than tRNA^Ile. Two of these reactions, the binding and isoleucylation of tRNA^phe (E. coli)³ and of tRNA_f^Met (E. coli), have been studied in detail. The generality of this phenomenon could prove important. First, the tRNA concentrations in E. coli are high (they can be no less than about 0.5 × 10^?5 M^4,5 for individual species) compared with those usual in vitro and thus even weak binding could be significant. Second, many incorrect interactions are possible. Assuming that there are about sixty molecular species of tRNA and twenty species of aminoacyl-tRNA synthetase, there are 1,200 possible interacting pairs and only about sixty of these (or 5%) are cognates. Since it is presumably desirable that misacylated tRNAs be held to a very small fraction of the total, misacylation could be significant, even if it is always a slow reaction. I have, as of writing, examined five species of purified tRNA, of which the two already mentioned give misacylations which are sufficiently facile to be easily studied under usual in vitro conditions. The other three are much less easily isoleucylated, but also give indications of reaction (my unpublished data). Thus, this limited survey emphasizes that these reactions may be common and that rejection of non-cognate tRNAs by the aminoacyl-tRNA synthetase may not be the only mechanism by which the correctness of the aminoacyl-tRNAs is assured. In fact, I have already reported^3,6 that Ile-tRNA^phe, synthesized by isoleucyl-tRNA synthetase, is rapidly destroyed by phenylal-anyl-tRNA synthetase and have suggested⁶ that the aminoacyl-tRNA synthetases may have a function in addition to synthesis of aminoacyl-tRNAs; that of destruction of misacylated cognate tRNAs.     

DNA binding specificities of the long zinc-finger recombination protein PRDM9

Background

Meiotic recombination ensures proper segregation of homologous chromosomes and creates genetic variation. In many organisms, recombination occurs at limited sites, termed ''hotspots'', whose positions in mammals are determined by PR domain member 9 (PRDM9), a long-array zinc-finger and chromatin-modifier protein. Determining the rules governing the DNA binding of PRDM9 is a major issue in understanding how it functions.

Results

Mouse PRDM9 protein variants bind to hotspot DNA sequences in a manner that is specific for both PRDM9 and DNA haplotypes, and that in vitro binding parallels its in vivo biological activity. Examining four hotspots, three activated by Prdm9^Cst and one activated by Prdm9^Dom2, we found that all binding sites required the full array of 11 or 12 contiguous fingers, depending on the allele, and that there was little sequence similarity between the binding sites of the three Prdm9^Cst activated hotspots. The binding specificity of each position in the Hlx1 binding site, activated by Prdm9^Cst, was tested by mutating each nucleotide to its three alternatives. The 31 positions along the binding site varied considerably in the ability of alternative bases to support binding, which also implicates a role for additional binding to the DNA phosphate backbone.

Conclusions

These results, which provide the first detailed mapping of PRDM9 binding to DNA and, to our knowledge, the most detailed analysis yet of DNA binding by a long zinc-finger array, make clear that the binding specificities of PRDM9, and possibly other long-array zinc-finger proteins, are unusually complex.