An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

The Synthesis of Carbocyclic 5′-Nor Thymidine and an Isomer as Oligonucleotide Monomers

Abstract

The chiral synthesis of (1S,3S,4S)-1-(3,4-dihydroxycyclopent-1-yl)-1H?thymine (carbocyclic 5′-nor thymidine, 4) has been achieved in 5 steps from (+)-(lR,4S)-4-hydroxy-2-cyclopenten-1-yl acetate (5) and N³?benzoylthymine. Compound 4 is viewed as a monomeric building block for poly-T-like oligomers.     

Synthesis and Biological Evaluation of 1,3-Oxathiolane 5-Azapyrimidine, 6-Azapyrimidine,and Fluorosubstituted 3-Deazapyrimidine Nucleosides

Abstract

(2R,5S)-5-Amino-2-[2-(hydroxymethyl)-1,3-oxathiolan-5-y1]-1,2,4-triazine-3(2H)-one (8) and (2R,5R)-5-amino-2-[2-(hydroxymethyl)-1,3-oxathiolan-5-y1]-1,2,4-triazine-3(2H)-one (9) have been synthesized via a multi-step procedure from 6-azauridine. (2R,5S)-4-Amino-1-[2-(hydroxymethyl)-1,3-oxathiolan-5-y1]-1,3,5-triazine-2(1H)-one (11) and (2R,5R)-4-amino-1-[2-(hydroxymethyl)-1,3-oxathiolan-5-y1]-1,3,5-triazine-2(1H)-one (12), and the fluorosubstituted 3-deazanucleosides (19–24) have been synthesized by the transglycosylation of (2R,5S)-1-{2-[[(tert-butyldiphenylsilyl) oxy]methyl]-1,3-oxathiolan-5-y1} cytosine (2) with silylated 5-azacytosine and the corresponding silylated fluorosubstituted 3-deazacytosines, respectively, in the presence of trimethylsilyl trifluoromethanesulfonate as the catalyst in anhydrous dichloroethane, followed by deprotection of the blocking groups. These compounds were tested in vitro for cytotoxicity against L1210, B₁₆F₁₀, and CCRF-CEM tumor cell lines and for antiviral activity against HIV-1 and HBV.     

Analysis of Carotenoid Composition in Petals of Calendula (Calendula officinalis L.)

Nineteen carotenoids were identified in extracts of petals of orange- and yellow-flowered cultivars of calendula (Calendula officinalis L.). Ten carotenoids were unique to orange-flowered cultivars. The UV–vis absorption maxima of these ten carotenoids were at longer wavelengths than that of flavoxanthin, the main carotenoid of calendula petals, and it is clear that these carotenoids are responsible for the orange color of the petals. Six carotenoids had a cis structure at C-5 (C-5′), and it is conceivable that these (5Z)-carotenoids are enzymatically isomerized at C-5 in a pathway that diverges from the main carotenoid biosynthesis pathway. Among them, (5Z,9Z)-lycopene (1), (5Z,9Z,5′Z,9′Z)-lycopene (3), (5′Z)-γ-carotene (4), and (5′Z,9′Z)-rubixanthin (5) has never before been identified. Additionally, (5Z,9Z,5′Z)-lycopene (2) has been reported only as a synthesized compound.     

DNA sequence-specific ligands: XIV. Synthesis of fluorescent biologically active dimeric bisbenzimidazoles DB(3, 4, 5, 7, 11)

Five fluorescent symmetrical dimeric bisbenzimidazoles DB(n) containing four 2,6-substituted benzimidazole cores and differing in the length of the oligomethylene linker between two bisbenzimidazole rings (n = 3, 4, 5, 7, 11) have been synthesized. The ability of the dimeric bisbenzimidazoles to form complexes with the double-stranded DNA has been shown by spectral methods. Upon binding to the double-stranded DNA, DB(n) are localized in the narrow groove. The data on the inhibition of the DNA methyltransferase Dnmt3a by DB(n) indicate that dimeric bisbenzimidazoles DB(3) and DB(11) site-specifically bind to the oligonucleotide duplex.     

1′, 2′-Seco-2′,3′-Dideoxynucleoside Analogues: Synthesis and Antiviral Evaluation of Racemic Trans-[1′, 5′-Dihydroxy 3′, 4′-methylenylpent-2′-oxy)methyl] Nucleosides

Abstract

Reaction of (±)but-3-en-1,2-diol (3) with ethyl diazoacetate afforded two cyclopropyl compounds (5) and (6). Their relative trans stereochemistry at C-2 and C-3 has been determined by high-field and computational NMR spectroscopy. (±)Trans-1-(1′,5′-dihydroxy-3′,4′-methylenyl-pent-2′-oxy)methyl]thymine (1d) or -cytosine (1b) and (±)trans-9-(1′,5′-dihydroxy-3′,4′-methylenylpent-2′-oxy)-methyl]adenine (la) or -guanine (1c) have been obtained through a regiospecific alkylation procedure and their antiviral evaluation is reported.     

Highly selective biotransformation of (+)-(1S)- and (−)-(1R)-camphorquinone by Aspergillus wentii

Abstract

To clarify the structures of biotransformation products and metabolic pathways, the biotransformation of monoterpenoids, (+)- and (?)-camphorquinone (1a and b), has been investigated using Aspergillus wentii as a biocatalyst. Compound 1a was converted to (?)-(2S)-exo-hydroxycamphor (2a), (?)-(2S)-endo-hydroxycamphor (3a), (?)-(3S)-exo-hydroxycamphor (4a), (?)-(3S)-endo-hydroxycamphor (5a), and (+)-camphoric acid (6a). Compound 1b was converted to (+)-(2R)-exo-hydroxycamphor (2b), (+)-(2R)-endo-hydroxycamphor (3b), (+)-(3R)-exo-hydroxycamphor (4b), (+)-(3R)-endo-hydroxycamphor (5b), and (?)-camphoric acid (6b). Compound 1a mainly produced 2a (65.0%) with stereoselectivity, whereas 1b afforded 3b (84.3%) with high stereoselectivity. These structures were confirmed by gas chromatography–mass spectrometry, infrared, ¹H nuclear magnetic resonance (NMR), and ¹³C NMR spectral data. The products illustrate the marked ability of A. wentii for enzymatic oxidation and ketone reduction.     

1,3-Cycloaddition of Cyclic Isothioureas to Heterocumulenes and Fungitoxicity of the Resulting l,2,4-Triazolo[3,4-c]-l,2,4-dithiazoles

Phenacylation of 5-aryl-3-mercapto-l,2,4-triazoles (I) furnished 5-aryl-3-phenacylthio-1,2,4-triazoles (II) which reacted with CS₂ and aryl isothiocyanates to give 5-aryl-l,2,4-triazolo[3,4-c]-1,2,4-dithiazole-3-thiones (III) and 5-aryl-3-arylimino-l,2,4-triazolo[3,4-c]-l,2,4-dithiazoles (IV), respectively. (IV) on refluxing with CS₂ yielded (III) which, when heated with aryl isothiocyanates, regenerated (IV). Compounds(II) ~ (IV) were compared with Dithane M-45 for their fungitoxicity against Helminthosporium oryzae and Fusarium oxysporium. The screening results have been correlated with the structural features of the tested compounds.     

Novel steroidal saponins from Liriope graminifolia (Linn.) Baker with anti-tumor activities

Phytochemical investigation of the underground parts of Liriope graminifolia (Linn.) Baker resulted in the isolation of two new steroidal saponins lirigramosides A (1) and B (2) along with four known compounds. The structures were determined by extensive spectral analysis, including two-dimensional (2D) NMR spectroscopy and chemical methods, to be 3-O-{β-d-xylopyranosyl-(1→3)-α-l-arabinopyranosyl-(1→2)-[α-l-rhamnopyranosyl-(1→4)]-β-d-glucopyranosyl-(25S)-spirost-5-ene-3β,17α-diol (1), 1-O-[α-l-rhamnopyranosyl-(1→2)-β-d-xylopyranosyl]-(25R)-ruscogenin (2), 1-O-β-d-xylopyranosyl-3-O-α-l-rhamnopyranosyl-(25S)-ruscogenin (3), 3-O-α-l-rhamnopyranosyl-1-O-sulfo-(25S)-ruscogenin (4), methylophiopogonanone B (5), and 5,7-dihydroxy-3-(4-methoxybenzyl)-6-methyl-chroman-4-one, (ophiopogonanone B, 6), respectively. Compound 1 has a new (25S)-spirost-5-ene-3β,17α-diol ((25S)-pennogenin) aglycone moiety. The isolated compounds were evaluated for their cytotoxic activities against Hela and SMMC-7721 cells.     

Asymmetric Hydrolysis of Racemic 2-Oxazolidinone Esters with Lipases

The enzymatic hydrolysis of (R, S)-5-acyloxymethyl-3-alkyl-oxazolidin-2-one I and the behavior of (S)-I for extraction with an organic solvent were examined so as to extend the biological resolution to racemates, and to learn about more appropriate combinations of substrates with lipases on the asymmetric hydrolysis. The combination of (R, S)-5-hexanoyloxymethyl-3-tert-butyl-oxazolidin-2-one 4 with lipoprotein lipase Amano 3 (L. P. L. Amano 3, origin; Pseudomonas aeruginosa) and that of (R, S)-5-octanoyloxymethyl-3-isopropyl-oxazolidin-2-one 14 with L. P. L. Amano 3 efficiently gave (S)-5-hydroxymethyl-3-tert-butyl-oxazolidin-2-one (S)-lla (99% e.e.) and (S)-5-hydroxymethyl-3-isopropyl-oxazolidin-2-one (S)-IIb (99% e.e.),respectively. (S)-IIa and (S)-IIb could be considered to be favorable intermediates for preparing optically active β-blockers.     

Enantiospecific Synthesis of 5′-Noraristeromycin and its 7-Deaza Derivative and A Formal Synthesis of (-)-5′-Homoaristeromycin

Abstract

Beginning with the treatment of the diacetate of cis-3,5-cyclopentenediol (5) with Pseudomonas cepacia lipase, (-)-5′-noraristeromycin (1) and (-)-7-deaza 5′-noraristeromycin (3) have been prepared. Subjecting 5 to treatment with porcine liver esterase led to an efficient preparation of a substituted cyclopentane precursor which, following literature precedence, can be converted into (-)-5′-homoaristeromycin (4).     

Nucleosides and Nucleotides. 139. Stereoselective Synthesis of (2′S)-2′-C-Alkyl-2′-deoxyuridines

Abstract

A synthetic method for (2′S)-2′-C-alkyl-2′-deoxyuridines (9) has been described. Catalytic hydrogenation of 1-[2-C-alkynyl-2-O-methoxalyl-3,5-O-TIPDS-β-D-arabino-pentofuranosyl]uracils (5) gave 1-[2-C-(2-alkyl)-2-O-methoxalyl-3,5-O-TIPDS-β-D-arabino-pentofuranosyl]uracils (4) as a major product, which were then subjected to the radical deoxygenation, affording (2′S)-2′-alkyl-2′-deoxy-3′,5′-O-TIPDS-uridines (7) along with a small amount of their 2′R epimers.

     

Inhibition of murine DNA methyltransferase Dnmt3a by DNA duplexes containing pyrimidine-2(1<Emphasis Type="Italic">H</Emphasis>)-one

Here we studied the inhibition of the catalytic domain of Dnmt3a methyltransferase (Dnmt3a-CD) by DNA duplexes containing the mechanism-based inhibitor pyrimidine-2(1H)-one (P) instead of the target cytosine. It has been shown that conjugates of Dnmt3a-CD with P-DNA (DNA containing pyrimidine-2(1H)-one) are not stable to heating at 65°C in 0.1% SDS. The yield of covalent intermediate increases in the presence of the regulatory factor Dnmt3L. The importance of the DNA minor groove for covalent intermediate formation during the methylation reaction catalyzed by Dnmt3a-CD has been revealed. P-DNA was shown to inhibit Dnmt3a-CD; the IC₅₀ is 830 nM. The competitive mechanism of inhibition of Dnmt3a-CD by P-DNA has been elucidated. It is suggested that therapeutic effect of zebularine could be achieved by inhibition of not only Dnmt1 but also Dnmt3a.     

Synthesis and anticonvulsant activity of new N-mannich bases derived from benzhydryl- and isopropyl-pyrrolidine-2,5-dione

Synthesis and anticonvulsant properties of 26 new N-Mannich bases of 3-benzhydryl-(5–17) and 3-isopropyl-pyrrolidine-2,5-diones (18–30) have been described. Initial anticonvulsant screening for these compounds was evaluated in mice after intraperitoneal administration in the maximal electroshock (MES) and subcutaneous pentylenetetrazole (scPTZ) seizures tests. The acute neurological toxicity was determined by applying the rotorod test. The in vivo results in mice showed that the majority of 3-benzhydryl-pyrrolidine-2,5-dione derivatives revealed effectiveness, while 3-isopropyl-pyrrolidine-2,5-dione derivatives were practically devoid of activity. The quantitative evaluation in both tests revealed that the most active were N-[{4-(3-chlorophenyl)-piperazin-1-yl}-methyl]-3-benzhydryl-pyrrolidine-2,5-dione (9) with ED_{5 0} value?=42.71?mg/kg (MES), ED_{5 0} value?>150?mg/kg (scPTZ), and N-[{4-(3-trifluoromethylphenyl)-piperazin-1-yl}-methyl]-3-benzhydryl-pyrrolidine-2,5-dione (13) with ED_{5 0} value?=101.46?mg/kg (MES) and ED_{5 0} value?=72.59?mg/kg (scPTZ). These molecules showed higher potency and lower neurotoxicity than the reference antiepileptic drugs (ethosuximide and valproic acid). To explain the probable mechanism of action of selected active derivatives (9 and 13), their influence on Na_v1.2 and l-type calcium channel was evaluated in vitro.     

Synthesis,Protonation Behavior,Conformational Analysis,and Regioselective Enzymatic Acylation of the Novel Diamino Analogue of (E)-5-(2-Bromovinyl)-2′-deoxyuridine (BVDU)

Abstract

(E)-3′,5′-Diamino-5-(2-bromovinyl)-2′,3′,5′-trideoxyuridine (5), the diamino analogue of BVDU (1), was synthesized from BVDU. The protonation behavior of 5 has been studied by means of pH-metric measurements and NMR spectroscopy. This study allows the determination of the basicity constants and the stepwise protonation sites. Thus, the main species at physiological pH is the monoprotonated form. The conformational analysis of this nucleoside analogue was also carried out through ¹H NMR spectroscopy. In addition, a convenient synthesis of N-3′ and N-5′ acylated derivatives was developed by regioselective enzymatic acylation. Thus, Candida antarctica lipase B (CAL-B) selectively acylated the 5′-amino group, thus furnishing nucleosides 8. On the other hand, immobilized Pseudomonas cepacia lipase (PSL-C) exhibited the opposite selectivity, conferring acylation at the 3′-amino group, thus affording derivatives 9.     

Effects of Trialkyltin Chlorides on Escherichia coli Spheroplasts

Valsa ceratosperma, which is the pathogenic fungus of apple canker, was grown in a synthetic medium. The neutral extract from the culture filtrate was chromatographed on a silica gel column to give five isocoumarins. Their structures were determined by MS, UV, IR, ¹H and ¹³C NMR, and CD spectra. Three of them were known compounds; ( ? )-5-methylmellein (1), ( ? )-5-carboxylmellein (2) and ( ? )-5-hydroxylmethylmellein (3). Since the absolute configurations at C-3 in 2 and 3 were not known until now, both were determined to be R by chemical correlations. The two were new compounds; ( + )-(3R,4S)-trans-4-hydroxy-5-methylmellein (4) and ( ? )-(3R,4R)-cis-4-hydroxy-5-methylmellein (5). All the five compounds showed phytotoxicity in a bioassay using detached apple shoots and lettuce seedlings.     

Ganoderiol A and B,New Triterpenoids from the Fungus Ganoderma lucidum (Reishi)

Two new lanostane-type triterpenoids, ganoderiol A (1) and ganoderiol B (2) were isolated from the fruiting bodies of Ganoderma lucidum, together with known ganodermanontriol (3) and ganodermatriol (4). The compounds were identified as 5α-lanosta-7,9(11)-dien-3β,24,25,26-tetraol (1), 15α,26,27-trihydroxy-5α-lanosta-7,9(11),24-trien-3-one (2), 24,25,26-trihydroxy-5α-lanosta-7,9(11)-dien-3-one (3) and 5α-lanosta-7,9(ll),24-trien-3β,26,27-triol (4), respectively.     

Biotransformation of 5α-hydroxycaryophylla-4(12),8(13)-diene with Cunninghamella elegans and Rhizopus stolonifer

Abstract

Biotransformation of 5α-hydroxycaryophylla-4(12),8(13)-diene (1) was studied with Cunninghamella elegans and Rhizopus stolonifer. Incubation of 1 with C. elegans gave regioselective oxidative addition (hydration) and isomerization at the C-4(12) exocyclic double bond and hydroxylation at C-3 and C-15, and thus provided two polar metabolites, (3Z),8(14)-caryophylladiene-5α,(11R)-15-diol (2) and 3β,4β,5α-trihydroxycaryophylla-8(13)-ene (3). Incubation of 1 with R. stolonifer gave a transannular cyclization reaction and afforded 2β-methoxyclovan-9-one (4), clovan-2β-ol-9-one (5) and 8-methoxycaryolane-5α,13β-diol (6). Compounds 3 and 6 are new compounds described here for the first time; their structures were deduced with the help of different spectroscopic techniques.     

Nucleosides. LIV1 Synthesis and Properties of 3′-Azido- and 2′,3′-Dideoxy-6,7-diphenyllumazine Nucleosides

Abstract

The best approach for the synthesis of1-(3-azido-2,3-dideoxy-β-D-erythro-pento-furanosyl)lumazine (5) and its 6,7-dimethyl- (4) and 6,7-diphenyl derivatives (3) has been found in the interconversion of the corresponding 1-(2-deoxy- β-threo-pentofuranosyl)-lumazines. Monomethoxytritylation at the 5′-position (1 7, 3 4, 4 9) followed by mesylation at the 3′-OH group and subsequent nucleophilic displacement by lithium azide afforded 1 9, 2 9 and 4 7 which were deprotected by acid treatment to give 3–5 in good yields. The syntheses of 1-(2,3-dideoxy-β-D-glycero-pentofuranosyl)-6,7-diphenyllumazine (6) and its 6,7-dimethyl derivative (7) were achieved from 1-(2-deoxy-β-D-erythro-pentofuranosyl)-6,7-diphenyllumazine and the corresponding 6,7-dimethyllumazine (2 6) via their 5′-O-p-toluoyl- (2 0, 3 0), and 3′-deoxy-3′-iodo derivatives (2 4, 3 1) to form, after radical dehalogenation and final deprotection, 6 and 7. The newly synthesized lumazine nucleosides have been characterized by elemental analyses, UV-and NMR spectra.