Ultrastructure of Klebsiella O3 Lipopolysaccharide Isolated from Culture Supernatant: Comparison with Other Lipopolysaccharides

Klebsiella O3 lipopolysaccharide (KO3 LPS) isolated from the culture supernatant, which was found to exhibit a very strong adjuvant activity in augmenting antibody response and delayed-type hypersensitivity to protein antigens in mice, was examined by electron microscopy. When negatively stained with uranyl acetate or ammonium molybdate, the KO3 LPS was found to consist principally of flat ribbon-like structures branching freely (average width 16 nm and average thickness 7 nm) and to contain a small proportion of spheres (diameter 20–50 nm), both structures covered with fine hairy structures (average length approximately 10 nm). When the polysaccharide of KO3 LPS was stained by the periodic acid-thiosemicarbazide-silver proteinate procedure, silver granules were deposited on the ribbon-like structures and around the spheres, suggesting that the polysaccharide moiety is located on their surface and that the fine hairy structures consist of the polysaccharide moiety. Comparison by means of preparations stained with uranyl acetate or ammonium molybdate showed that KO3 LPS isolated from the culture supernatant has structural features in common with KO3 LPS isolated from bacterial cells, Escherichia coli O9 LPS isolated from the culture supernatant, and E. coli O127 LPS isolated from bacterial cells. On the basis of the present results, schematic representations of the common physical structure of LPS were drawn; the fine hairy structures attach to the wide surface of the flat ribbon-like structures along their lateral margin.     

Ultrastructure of Klebsiella O3 lipopolysaccharide isolated from culture supernatant: structure of various uniform salt forms

Various uniform salt forms of Klebsiella O3 lipopolysaccharide (KO3 LPS) isolated from culture supernatant were prepared as follows. Basic materials present in KO3 LPS were rigorously removed by electrodialysis and the electrodialyzed KO3 LPS was neutralized with NaOH, KOH, NH4OH, Ca(OH)2, tris(hydroxymethyl)aminomethane, or triethylamine. The ultrastructure of the uniform salt forms of KO3 LPS was examined using preparations stained with uranyl acetate. The sodium, potassium, ammonium, and trisaminomethane salt forms were structurally very similar to the natural form of KO3 LPS which consisted of a mixture of flat ribbon-like structures (average width of 16 nm and average thickness of 7 nm) and spheres with various diameters, both covered with fine hairy structures. When KO3 LPS was converted to the triethylamine salt form, the ribbon-like structures were disrupted into very small granules (7-9 nm X 9-15 nm). The calcium salt form consisted of particles and rods of various sizes and ribbon-like structures which were markedly extended (maximum width of 50 nm) and presented irregular shapes. When converted to the calcium salt form, the ribbon-like structures were extended and eventually divided into particles and rods. For reasons still unknown, the sodium salt of KO3 LPS was mostly stained positively with uranyl acetate in contrast to the natural form and the other uniform salt forms which were always negatively stained. In the positively stained preparation of the sodium salt form, it was clearly shown that the ribbon-like structures consisted of a bilayer.     

Amphotericin B-phospholipid interactions responsible for reduced mammalian cell toxicity.

When interacting with phospholipid in an aqueous environment, amphotericin B forms unusual structures of markedly reduced toxicity (Janoff et al. (1988) Proc. Natl. Acad. Sci. USA 85, 6122-6126). These structures, which appear ribbon-like by freeze-fracture electron microscopy (EM), are found exclusively at amphotericin B to lipid mole ratios of 1:3 to 1:1. At lower mole ratios they occur in combination with liposomes. Circular dichroism (CD) spectra revealed two distinct modes of lipid-amphotericin B interaction, one for liposomes and one for the ribbon-like structures. In isolated liposomes, amphotericin B which comprised 3-4 mole percent of the bulk lipid was monomeric and exhibited a hemolytic activity comparable to amphotericin B suspended in deoxycholate. Above 3-4 mole percent amphotericin B, ribbon-like structures emerged and CD spectra indicated drug-lipid complexation. Minimal inhibitory concentrations for Candida albicans of liposomal and complexed amphotericin B were comparable and could be attributed to amphotericin a release as a result of lipid breakdown within the ribbon-like material by a heat labile extracellular yeast product (lipase). Negative stain EM of the ribbon-like structures indicated that the ribbon-like appearance seen by freeze-fracture EM arises as a consequence of the cross-fracturing of what are aggregated, collapsed single lamellar, presumably interdigitated, membranes. Studies examining complexation of amphotericin B with either DMPC or DMPG demonstrated that headgroup interactions played little role in the formation of the ribbon-like structures. With these results we propose that ribbon-like structures result from phase separation of amphotericin B-phospholipid complexes within the phospholipid matrix such that amphotericin B release, and thus acute toxicity, is curtailed. Formation of amphotericin B-lipid structures such as those described here indicates a possible new role for lipid as a stabilizing matrix for drug delivery of lipophilic substances, specifically where a highly ordered packing arrangement between lipid and compound can be achieved.     

Formation of a hexagonal lattice structure by an R-form lipopolysaccharide of Klebsiella: comparative study of preparations extracted by the phenol-water and the phenol-chloroform-petroleum ether methods

An R-form lipopolysaccharide (LPS) extracted from Klebsiella strain LEN-111 (O3-:K1-) by the phenol-chloroform-petroleum ether method was compared with that extracted by the phenol-water method in the ability to form a hexagonal assembly. The LPS which was extracted by the phenol-water method and dialyzed against tap water to remove phenol showed ribbon-like structures, and it formed a hexagonal lattice structure with a lattice constant of 14.5 +/- 0.3 nm when it was precipitated by addition of two volumes of 10 mM MgCl2-ethanol. The LPS which was extracted by the phenol-chloroform-petroleum ether method and lyophilized consisted of ribbon-like structures and their fragments and it often formed small pieces of a hexagonal lattice, although the LPS before lyophilization did not form such a lattice. When the LPS extracted by the phenol-chloroform-petroleum ether method was precipitated by addition of two volumes of 10 mM MgCl2-ethanol, it formed essentially the same hexagonal lattice structure as that formed by the LPS extracted by the phenol-water method. From these results it is concluded that the ability of the LPS to form a hexagonal lattice structure does not depend upon the method of its extraction from bacterial cells.     

One-step purification of bacterial lipid macroamphiphiles by hydrophobic interaction chromatography

Bacterial lipid macroamphiphiles extracted with phenol/water can be purified in one step by hydrophobic interaction chromatography. Lipids and the major part of protein are separated from macroamphiphiles during phenol/water extraction. Coextracted nucleic acids, polysaccharides, and residual protein are effectively removed by column chromatography on octyl-Sepharose whereby macroamphiphiles are primarily adsorbed and later eluted with a buffered propanol gradient. The procedure is applicable to macroamphiphiles with various lipid structures as was demonstrated using the diacylglycerol-containing lipoglycan of Micrococcus luteus, the lipid A-containing lipopolysaccharide of Salmonella typhimurium, and the diglyceryl tetraether lipoglycans of Thermoplasma acidophilum and Thermoplasma volcanicum. On elution from octyl-Sepharose, separation into molecular species of different compositions was observed with the lipopolysaccharide of S. typhimurium and the lipoglycan of T. volcanicum. It was also shown that, after phenol/water extraction, membrane lipids are completely recoverable from the phenol layer, which makes it possible to isolate lipids along with macroamphiphiles from the same sample of bacteria.     

Ultrastructural localization of Thermoplasma acidophilum surface carbohydrate by using concanavalin A

Surface carbohydrate, presumably the lipopolysaccharide, of Thermoplasma acidophilum was visualized by means of the concanavalin A, horseradish peroxidase, and diaminobenzidine cytochemical staining procedure.     

Structure of a putative lipoate protein ligase from Thermoplasma acidophilum and the mechanism of target selection for post-translational modification

Lipoyl-lysine swinging arms are crucial to the reactions catalysed by the 2-oxo acid dehydrogenase multienzyme complexes. A gene encoding a putative lipoate protein ligase (LplA) of Thermoplasma acidophilum was cloned and expressed in Escherichia coli. The recombinant protein, a monomer of molecular mass 29 kDa, was catalytically inactive. Crystal structures in the absence and presence of bound lipoic acid were solved at 2.1 A resolution. The protein was found to fall into the alpha/beta class and to be structurally homologous to the catalytic domains of class II aminoacyl-tRNA synthases and biotin protein ligase, BirA. Lipoic acid in LplA was bound in the same position as biotin in BirA. The structure of the T.acidophilum LplA and limited proteolysis of E.coli LplA together highlighted some key features of the post-translational modification. A loop comprising residues 71-79 in the T.acidophilum ligase is proposed as interacting with the dithiolane ring of lipoic acid and discriminating against the entry of biotin. A second loop comprising residues 179-193 was disordered in the T.acidophilum structure; tryptic cleavage of the corresponding loop in the E.coli LplA under non-denaturing conditions rendered the enzyme catalytically inactive, emphasizing its importance. The putative LplA of T.acidophilum lacks a C-terminal domain found in its counterparts in E.coli (Gram-negative) or Streptococcus pneumoniae (Gram-positive). A gene encoding a protein that appears to have structural homology to the additional domain in the E.coli and S.pneumoniae enzymes was detected alongside the structural gene encoding the putative LplA in the T.acidophilum genome. It is likely that this protein is required to confer activity on the LplA as currently purified, one protein perhaps catalysing the formation of the obligatory lipoyl-AMP intermediate, and the other transferring the lipoyl group from it to the specific lysine residue in the target protein.     

Morphological variation of new Thermoplasma acidophilum isolates from Japanese hot springs.

We isolated 12 strains of Thermoplasma acidophilum from hot springs in Hakone, Japan. T. acidophilum strains showed morphological variation in the crystal-like structure in the cell and the fibrous structure on the cell surface. Two strains tested were sensitive to novobiocin. However, a novobiocin-resistant mutant was obtained by spontaneous mutation.     

Expression of functional Thermoplasma acidophilum proteasomes in Escherichia coli.

The two genes encoding the constituent subunits of the Thermoplasma acidophilum proteasome were expressed in Escherichia coli yielding fully assembled molecules as shown by electron microscopy. The recombinant proteasomes were purified to homogeneity and were shown to have proteolytic activity indistinguishable from proteasomes isolated from T. acidophilum.     

Black lipid membranes of tetraether lipids from Thermoplasma acidophilum.

Black lipid membranes were formed of tetraether lipids from Thermoplasma acidophilum and compared to the bilayer forming lipids diphytanoylphosphatidylcholine and diphythanylglucosylglycerol. Bilayer-forming lipids varied in thickness of black lipid membranes due to the organic solvent used. Measurements of the specific membrane capacitance (Cm = 0.744 microF/cm2) showed that the membrane-spanning tetraether lipids from Thermoplasma acidophilum form a monolayer of a constant thickness of 2.5-3.0 nm no matter from which solvent. This finding corresponds to the results of Gliozzi et al. for the lipids of another archaebacterium, Sulfolobus solfataricus. Black lipid membranes were formed at room temperature with a torus from bilayer-forming lipids, however, the torus could also be formed by the tetraether-lipid itself at room temperature and at defined concentration. In these stable black lipid membranes, conductance was measured in the presence of valinomycin, nonactin, and gramicidin. At 10(-7) M concentration, valinomycin mediated higher conductance in membranes from tetraether lipids (200-1200 microS/cm2) than from bilayer-forming lipids (125-480 microS/cm2). Nonactin, at 10(-6) M concentration, mediated a 6-fold higher conductance in a tetraether lipid membrane than in a bilayer, whereas conductance, in the presence of 5 x 10(-11) M gramicidin could reach higher values in bilayers than in tetraether lipid monolayers of comparable thickness. Monensin did not increase the conductance of black lipid membranes from tetraether lipids under all conditions applied in our experiments. Poly(L-lysine) destroyed black lipid membranes. Lipopolysaccharides from Thermoplasma acidophilum were not able to form stable black lipid membranes by themselves. The lipopolysaccharide complexes from Thermoplasma acidophilum and from Escherichia coli decreased the valinomycin-mediated conductance of monolayer and bilayer membranes. This influence was stronger than that of the polysaccharide dextran.     

Electron microscopic studies of lipopolysaccharides from phase I and phase II Coxiella burnetii

Lipopolysaccharides from phase I (LPSI) Coxiella burnetii Ohio and Nine Mile strains and from phase II (LPSII) Nine Mile stain were negatively and positively and examined with the electron microscope. The ultrastructure of LPSI and LPSII positively stained with uranyl formate or uranyl acetate was ribbon-like. When negatively stained with uranyl acetate, LPSI was ribbon-like but LPSII exhibited hexagonal lattice structures. However, LPSII stained negatively with sodium phosphotungstate and ammonium molybdate exhibited hexagonal lattice ultrastructures which were not identical to those observed when negatively stained with uranyl acetate. The hexagonal lattice structures formed in vitro were due to the interactions of LPSII and the staining reagents rather than to protein-LPS interactions. The differences in the ultrastructures of LPSI and LPSII are undoubtedly based on variations in their chemical composition.     

Occurrence of D-Amino Acids and a pyridoxal 5'-phosphate-dependent aspartate racemase in the acidothermophilic archaeon, Thermoplasma acidophilum

Free D-amino acid content in some archaea was investigated and D-forms of several amino acids were found in them. In the acidothermophilic archaeon, Thermoplasma acidophilum, the proportion of D-aspartate (D-Asp) to total Asp was as high as 39.7%. Crude extracts of Thermoplasma acidophilum had Asp-specific racemase activity that was pyridoxal 5'-phosphate (PLP)-dependent. The relative insensitivity to a SH-modifying reagent distinguished this activity from those of the PLP-independent Asp racemases found in other hyperthermophilic archaea (Matsumoto, M., et al., J. Bacteriol. 181, 6560-6563 1999). Thus, high levels of d-Asp should be produced by a new type(s) of Asp-specific racemase in Thermoplasma acidophilum, although the function of d-Asp in this archaeon remains unknown.     

Association of Lps gene with natural resistance of mouse macrophages against Legionella pneumophila

We have cloned a 1.6-kb region of chromosomal DNA from Thermoplasma acidophilum into Escherichia coli using as a probe part of the Methanococcus vannielii fus-gene. The sequence of the clone was highly homologous to part of the corresponding Methanococcus vannielii gene. By chromosome walking, a 4.7-kb EcoRI fragment containing the complete gene was isolated. Nucleotide sequencing revealed an open reading frame of 2196 nucleotides. The deduced amino acid sequence contains the known peptide sequence around the ADP-ribosylation site of T. acidophilum elongation factor 2, which unequivocally confirms that the fus-gene has been cloned. The amino acid sequence was compared to that of hamster and E. coli, as well as to known archaebacterial EF-2 sequences.     

Structural conservation of the isolated zinc site in archaeal zinc-containing ferredoxins as revealed by x-ray absorption spectroscopic analysis and its evolutionary implications.

The zfx gene encoding a zinc-containing ferredoxin from Thermoplasma acidophilum strain HO-62 was cloned and sequenced. It is located upstream of two genes encoding an archaeal homolog of nascent polypeptide-associated complex alpha subunit and a tRNA nucleotidyltransferase. This gene organization is not conserved in several euryarchaeoteal genomes. The multiple sequence alignments of the zfx gene product suggest significant sequence similarity of the ferredoxin core fold to that of a low potential 8Fe-containing dicluster ferredoxin without a zinc center. The tightly bound zinc site of zinc-containing ferredoxins from two phylogenetically distantly related Archaea, T. acidophilum HO-62 and Sulfolobus sp. strain 7, was further investigated by x-ray absorption spectroscopy. The zinc K-edge x-ray absorption spectra of both archaeal ferredoxins are strikingly similar, demonstrating that the same zinc site is found in T. acidophilum ferredoxin as in Sulfolobus sp. ferredoxin, which suggests the structural conservation of isolated zinc binding sites among archaeal zinc-containing ferredoxins. The sequence and spectroscopic data provide the common structural features of the archaeal zinc-containing ferredoxin family.     

5'-Methylbenzimidazolyl-cobamides are the corrinoids from some sulfate-reducing and sulfur-metabolizing bacteria

The sulfate-reducing bacteria Desulfobacterium autotrophicum, Desulfobulbus propionicus and Archaeoglobus fulgidus (VC-16) and the sulfur-metabolizing archaebacteria Desulfurolobus ambivalens and Thermoplasma acidophilum were found to contain considerable amounts of corrinoids, that were isolated and crystallized in their Co beta-cyano form. In three other sulfur-metabolizing archaebacteria, Thermoproteus neutrophilus, Pyrodictium occultum and Staphylothermus marinus significant amounts of corrinoids were not detected under the isolation methods used. The samples from the three sulfate-reducers were identified with Co alpha-[alpha-(5'-methylbenzimidazolyl)]-Co beta-cyanocobamide. This corrinoid was also obtained from a 5-methylbenzimidazole-supplemented Propionibacterium fermentation and was structurally characterized by ultraviolet/visible, CD, fast-atom-bombardment MS, 1H-and 13C-NMR spectroscopy. Also the major corrinoid from T. acidophilum was (tentatively) analyzed as a 5'-methylbenzimidazolyl-cobamide, whereas the main corrinoid from D. ambivalens was indicated to be vitamin B12 (a 5',6'-dimethylbenzimidazolyl-cobamide). The 5'-methylbenzimidazolylcobamides are found here as the common corrins of some sulfate-reducing and sulfur-metabolizing bacteria. The structural diversity due to the differing nucleotide bases of the corrins examined here and in methanogenic and acetogenic bacteria appears not to correlate to the biological function(s) of the corrins, but rather to be determined by biosynthetic properties of these organisms under natural growth conditions.     

Membranous Structure of Purified Escherichia coli Lipopolysaccharide

The ultrastructure of the purified and lyophilized endotoxin from Escherichia coli O111 was observed by ultrathin sectioning. Onion-like globular membrane structures were observed in addition to rod-like and ribbon-like structures, indicating the existence of a globular membrane structure even in the dried state.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.     

Purification and characterization of geranylgeranylglyceryl phosphate synthase from a thermoacidophilic archaeon,Thermoplasma acidophilum

We purified a geranylgeranylglyceryl phosphate (GGGP) synthase from Thermoplasma acidophilum by several steps of chromatography. Based on the proteinase-fragment-mass-pattern analysis of the SDS-PAGE band of the partially purified protein, the DNA sequence encoding the protein was identified from the whole genome sequence database of the species. The gene encoding GGGP synthase in T. acidophilum was cloned after PCR amplification of the gene from the genomic DNA. The recombinant enzyme was expressed in Escherichia coli and purified. A single band with a molecular mass of 27 kDa was obtained by SDS-PAGE analysis. The apparent native molecular mass of the enzyme was about 50 kDa based on gel filtration chromatography, suggesting that the enzyme is active as a homodimer. As the GGGP synthase from Methanobacterium thermoautotrophicum has been reported as a pentamer, the enzymes of the two organisms have different oligomeric structures. Other characteristics, including substrate specificity, are similar for the GGGPs of these organisms.