Evolutionary relationships amongst archaebacteria. A comparative study of 23 S ribosomal RNAs of a sulphur-dependent extreme thermophile, an extreme halophile and a thermophilic methanogen

The 23 S RNA genes representative of each of the main archaebacterial subkingdoms, Desulfurococcus mobilis an extreme thermophile, Halococcus morrhuae an extreme halophile and Methanobacterium thermoautotrophicum a thermophilic methanogen, were cloned and sequenced. The inferred RNA sequences were aligned with all the available 23 S-like RNAs of other archaebacteria, eubacteria/chloroplasts and the cytoplasm of eukaryotes. Universal secondary structural models containing six major structural domains were refined, and extended, using the sequence comparison approach. Much of the present structure was confirmed but six new helices were added, including one that also exists in the eukaryotic 5.8 S RNA, and extensions were made to several existing helices. The data throw doubt on whether the 5' and 3' ends of the 23 S RNA interact, since no stable helix can form in either the extreme thermophile or the methanogen RNA. A few secondary structural features, specific to the archaebacterial RNAs were identified; two of these were supported by a comparison of the archaebacterial RNA sequences, and experimentally, using chemical and ribonuclease probes. Seven tertiary structural interactions, common to all 23 S-like RNAs, were predicted within unpaired regions of the secondary structural model on the basis of co-variation of nucleotide pairs; two lie in the region of the 23 S RNA corresponding to 5.8 S RNA but they are not conserved in the latter. The flanking sequences of each of the RNAs could base-pair to form long RNA processing stems. They were not conserved in sequence but each exhibited a secondary structural feature that is common to all the archaebacterial stems for both 16 S and 23 S RNAs and constitutes a processing site. Kingdom-specific nucleotides have been identified that are associated with antibiotic binding sites at functional centres in 23 S-like RNAs: in the peptidyl transferase centre (erythromycin-domain V) the archaebacterial RNAs classify with the eukaryotic RNAs; at the elongation factor-dependent GTPase centre (thiostrepton-domain II) they fall with the eubacteria, and at the putative amino acyl tRNA site (alpha-sarcin-domain VI) they resemble eukaryotes. Two of the proposed tertiary interactions offer a structural explanation for how functional coupling of domains II and V occurs at the peptidyl transferase centre. Phylogenetic trees were constructed for the archaebacterial kingdom, and for the other two kingdoms, on the basis of the aligned 23 S-like RNA sequences.(ABSTRACT TRUNCATED AT 400 WORDS)     

Sequences of the 5S rRNAs of the thermo-acidophilic archaebacterium Sulfolobus solfataricus (Caldariella acidophila) and the thermophilic eubacteria Bacillus acidocaldarius and Thermus aquaticus.

We have determined the nucleotide sequences of the 5 S rRNAs of three thermophilic bacteria: the archaebacterium Sulfolobus solfataricus, also named Caldariella acidophila, and the eubacteria Bacillus acidocaldarius and Thermus aquaticus. A 5 S RNA sequence for the latter species had already been published, but it looked suspect on the basis of its alignment with other 5 S RNA sequences and its base-pairing pattern. The corrected sequence aligns much better and fits in the universal five helix secondary structure model, as do the sequences for the two other examined species. The sequence found for Sulfolobus solfataricus is identical to that determined by others for Sulfolobus acidocaldarius. The secondary structure of its 5 S RNA shows a number of exceptional features which distinguish it not only from eubacterial and eukaryotic 5 S RNAs, but also from the limited number of archaebacterial 5 S RNA structures hitherto published. The free energy change of secondary structure formation is large in the three examined 5 S RNAs.     

Evolutionary changes in the higher order structure of the ribosomal 5S RNA.

Comparative studies have been undertaken on the higher order structure of ribosomal 5S RNAs from diverse origins. Competitive reassociation studies show that 5S RNA from either a eukaryote or archaebacterium will form a stable ribonucleoprotein complex with the yeast ribosomal 5S RNA binding protein (YL3); in contrast, eubacterial RNAs will not compete in a similar fashion. Partial S1 ribonuclease digestion and ethylnitrosourea reactivity were used to probe the structural differences suggested by the reconstitution experiments. The results indicate a more compact higher order structure in eukaryotic 5S RNAs as compared to eubacteria and suggest that the archaebacterial 5S RNA contains features which are common to either group. The potential significance of these results with respect to a generalized model for the tertiary structure of the ribosomal 5S RNA and to the heterogeneity in the protein components of 5S RNA-protein complexes are discussed.     

Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli.

4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli.     

Evolution of HSP70 gene and its implications regarding relationships between archaebacteria,eubacteria, and eukaryotes

The 70-kDa heat-shock protein (HSP70) constitutes the most conserved protein present in all organisms that is known to date. Based on global alignment of HSP70 sequences from organisms representing all three domains, numerous sequence signatures that are specific for prokaryotic and eukaryotic homologs have been identified. HSP70s from the two archaebacterial species examined (viz., Halobacterium marismortui and Methanosarcina mazei) have been found to contain all eubacterial but no eukaryotic signature sequences. Based on several novel features of the HSP70 family of proteins (viz., presence of tandem repeats of a 9-amino-acid [a.a.] polypeptide sequence and structural similarity between the first and second quadrants of HSP70, homology of the N-terminal half of HSP70 to the bacterial MreB protein, presence of a conserved insert of 23–27 a.a. in all HSP70s except those from archaebacteria and gram-positive eubacteria) a model for the evolution of HSP70 gene from an early stage is proposed. The HSP70 homologs from archaebacteria and gram-positive bacteria lacking the insert in the N-terminal quadrants are indicated to be the ancestral form of the protein. Detailed phylogenetic analyses of HSP70 sequence data (viz., by bootstrap analyses, maximum parsimony, and maximum likelihood methods) provide evidence that archaebacteria are not monophyletic and show a close evolutionary linkage with the gram-positive eubacteria. These results do not support the traditional archaebacterial tree, where a close relationship between archaebacterial and eukaryotic homologs is observed. To explain the phylogenies based on HSP70 and other gene sequences, a model for the origin of eukaryotic cells involving fusion between archaebacteria and gram-negative eubacteria is proposed. Correspondence to: R. S. Gupta     

Sequence of the 16S rRNA gene from the thermoacidophilic archaebacteriumSulfolobus solfataricus and its evolutionary implications

Summary The sequence of the small-subunit rRNA from the thermoacidophilic archaebacteriumSulfolobus solfataricus has been determined and compared with its counterparts from halophilic and methanogenic archaebacteria, eukaryotes, and eubacteria. TheS. solfataricus sequence is specifically related to those of the other archaebacteria, to the exclusion of the eukaryotic and eubacterial sequences, when examined either by evolutionary distance matrix analyses or by the criterion of minimum change (maximum parsimony). The archaebacterial 16S rRNA sequences all conform to a common secondary structure, with theS. solfataricus structure containing a higher proportion of canonical base pairs and fewer helical irregularities than the rRNAs from the mesophilic archaebacteria.S. solfataricus is unusual in that its 16S rRNA-23S rRNA intergenic spacer lacks a tRNA gene.     

A brief note concerning archaebacterial phylogeny

Critical analysis of the recently proposed alternative to the normal archaebacterial tree, the new eocyte tree, shows that the latter's central topology, in which the eubacteria branch from an entirely different section of the unrooted archaebacterial tree than the eukaryotes, is consistent with an artifact. The effects of the alignment used and the particular composition of the sequence quartets analyzed to infer this tree are discussed in detail.     

Cloning and nucleotide sequence of an archaebacterial glutamine synthetase gene: Phylogenetic implications

Summary The glnA gene of the thermophilic sulphur-dependent archaebacterium Sulfolobus solfataricus was identified by hybridization with the corresponding gene of the cyanobacterium Spirulina platensis and cloned in Escherichia coli. The nucleotide sequence of the 1696 bp DNA fragment containing the structural gene for glutamine synthetase was determined, and the derived amino acid sequence (471 residues) was compared to the sequences of glutamine synthetases from eubacteria and eukaryotes. The homology between the archaebacterial and the eubacterial enzymes is higher (42%–49%) than that found with the eukaryotic counterpart (less than 20%). This was true also when the five most conserved regions, which it is possible to identify in both eubacterial and eukaryotic glutamine synthetases, were analysed.     

Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs

The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.     

Phylogenetic conservation of antigenic determinants in archaebacterial elongation factors (Tu proteins)

By using affinity chromatography methods, we have purified elongation factor Tu (EF-Tu) proteins from a host of archaebacteria covering all known divisions in the archaebacterial tree except halophiles, and from such distantly related eubacteria as Thermotoga maritima and Escherichia coli. Polyclonal antibodies were raised against the Tu proteins of Sulfolobus solfataricus, Thermoproteus tenax, Thermococcus celer, Pyrococcus wosei, Archaeoglobus fulgidus, Methanococcus thermolitotrophicus, Thermoplasma acidophilum, and Thermotoga and used to probe the immunochemical relatedness of elongation factors both within and across kingdom boundaries. A selection of the results, presented here, indicates that (i) every archaebacterial EF-Tu is closer (immunochemically) to every other archaebacterial EF-Tu than to the functionally analogous proteins of eubacteria and eukaryotes, with only one possible exception concerning the recognition of eukaryotic (EF-1 alpha) factors by Thermococcus EF-Tu antibodies, and (ii) within the archaebacteria there appears to be a correlation between EF-Tu immunochemical similarities and the phylogenetic relatedness of the organisms inferred from other (sequence) criteria. On the whole, immunochemical similarity data argue against the proposal that the archaebacterial taxon should be split and redistributed between two superkingdoms.     

The nucleotide sequence of the 5S rRNA from Spiroplasma species BC3 and Mycoplasma mycoides sp. capri PG3

Using in vitro labelling techniques, the complete nucleotide sequence of the 5S ribosomal RNAs isolated from the honeybee pathogen, Spiroplasma species BC3 and Mycoplasma mycoides sp. capri PG3, have been determined. The latter shows only 3 differences from the reported sequence of M. capricolum 5S rRNA, indicating that these two species are very closely related. The Spiroplasma sequence is also 107 nucleotides long and a comparative analysis of the sequence confirms that this Spiroplasma species is closely related to the Mycoplasma species and that they and the Gram-positive eubacteria have descended from a common ancestor and in the process the cell wall-less organisms have lost a large percentage of their genome.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Nucleotide sequence of the glyceraldehyde-3-phosphate dehydrogenase gene from the mesophilic methanogenic archaebacteria Methanobacterium bryantii and Methanobacterium formicicum. Comparison with the respective gene structure of the closely related extreme thermophile Methanothermus fervidus

The genes for glyceraldehyde-3-phosphate dehydrogenase (gap genes) from the mesophilic methanogenic archaebacteria Methanobacterium formicicum and Methanobacterium bryantii were cloned and sequenced. The deduced amino acid sequences show 95% identity to each other and about 70% identity to the glyceraldehyde-3-phosphate dehydrogenase from the thermophilic methanogenic archaebacterium Methanothermus fervidus. Although the sequence similarity between the archaebacterial glyceraldehyde-3-phosphate dehydrogenase and the homologous enzyme of eubacteria and eukaryotes is low, an equivalent secondary-structural arrangement can be deduced from the profiles of the physical parameters hydropathy, chain flexibility and amphipathy. In order to find possible thermophile-specific structural features of the enzyme from M. fervidus, a comparative primary-sequence analysis was performed. Amino acid exchanges leading, to a stabilization of the main-chain conformation, could be found throughout the sequence of the thermophile enzyme. Striking features of the thermophile sequence are the preference for isoleucine, especially in beta-sheets, and a low arginine/lysine ratio of 0.54.     

Contributions of phylogenetically variable structural elements to the function of the ribozyme ribonuclease P.

Ribonuclease P (RNase P) is a ribonucleoprotein enzyme which participates in processing precursor tRNAs. The RNA subunit contains the catalytic site and is capable of catalysis in the absence of the protein subunit. RNase P RNAs from various eubacteria consist of a core of conserved sequence and secondary structure which is evolutionarily modified in different organisms by the presence of discrete helical elements at various sites in the RNAs. The variable occurrence of these helical elements suggests that they have no important functional role in the enzyme. The Escherichia coli RNase P RNA contains four such elements. It has been shown that simultaneous deletion of all four of them produces an RNA that is functional but has several significant defects which could arise from general disruption of the RNA or from the loss of element-specific functions. This paper describes a more detailed analysis of the role of the variable elements in E. coli RNase P RNA. Removal of one of the elements had no apparent effect on RNase P activity in vitro. Two other elements are required for correct folding of the RNA: their absence confers a requirement for extremely high monovalent salt concentrations, apparently to reduce intramolecular electrostatic repulsion. The fourth element that was tested participates in a long-range structural interaction (pseudoknot) which contributes to the structural stability of the enzyme and affects substrate binding affinity. In the absence of this helix, the RNA becomes temperature-sensitive, and the KM increases 100-fold.(ABSTRACT TRUNCATED AT 250 WORDS)     

Thermus thermophilus contains an eubacterial and an archaebacterial aspartyl-tRNA synthetase

Thermus thermophilus possesses two aspartyl-tRNA synthetases (AspRSs), AspRS1 and AspRS2, encoded by distinct genes. Alignment of the protein sequences with AspRSs of other origins reveals that AspRS1 possesses the structural features of eubacterial AspRSs, whereas AspRS2 is structurally related to the archaebacterial AspRSs. The structural dissimilarity between the two thermophilic AspRSs is correlated with functional divergences. AspRS1 aspartylates tRNA(Asp) whereas AspRS2 aspartylates tRNA(Asp), and tRNA(Asn) with similar efficiencies. Since Asp bound on tRNA(Asn) is converted into Asn by a tRNA-dependent aspartate amidotransferase, AspRS2 is involved in Asn-tRNA(Asn) formation. These properties relate functionally AspRS2 to archaebacterial AspRSs. The structural basis of the dual specificity of T. thermophilus tRNA(Asn) was investigated by comparing its sequence with those of tRNA(Asp) and tRNA(Asn) of strict specificity. It is shown that the thermophilic tRNA(Asn) contains the elements defining asparagine identity in Escherichia coli, part of which being also the major elements of aspartate identity, whereas minor elements of this identity are missing. The structural context that permits expression of aspartate and asparagine identities by tRNA(Asn) and how AspRS2 accommodates tRNA(Asp) and tRNA(Asn) will be discussed. This work establishes a distinct structure-function relationship of eubacterial and archaebacterial AspRSs. The structural and functional properties of the two thermophilic AspRSs will be discussed in the context of the modern and primitive pathways of tRNA aspartylation and asparaginylation and related to the phylogenetic connexion of T. thermophilus to eubacteria and archaebacteria.