Cloning and characterization of bovine cytochrome P-450(11 beta) genes

We isolated 4 different clones of the P-450(11 beta) gene from a bovine genomic library. These genomic clones were highly homologous with each other. Two of the isolated clones were pseudogenes. Determination of its nucleotide sequences indicated that the bovine P-450(11 beta) gene is divided into 9 exons by 8 introns and that it is about 8.5 kb in total length. The number of exons and the locations of intron insertion into the P-450(11 beta) gene are identical with those in the case of P-450(SCC), but different from those of other microsomal P-450s.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)     

Expression of two kinds of cytochrome P-450(11 beta) mRNA in bovine adrenal cortex

Using pcP-450(11 beta)-2 cDNA (Morohashi et al. (1987) J. Biochem. 102, 559-568) as the probe, a different cDNA clone, pcP-450(11 beta)-3, was isolated from a cDNA library of bovine adrenal cortex. The restriction enzyme map of pcP-450(11 beta)-3 was highly homologous but not identical with that of pcP-450(11 beta)-2. Nucleotide sequence determination revealed the substitutions of 14 nucleotides and 3 amino acids between pcP-450(11 beta)-2 and -3. Blotting analysis involving two different oligonucleotide probes specific to these two cDNAs indicated that at least two kinds of P-450(11 beta) mRNA were expressed in individual animals and that at least two kinds of P-450(11 beta) genes exist in the bovine genome.     

Contributions of cytoplasmic free and membrane-bound ribosomes to the synthesis of mitochondrial cytochrome P-450(SCC) and P-450(11 beta) and microsomal cytochrome P-450(C-21) in bovine adrenal cortex

Rabbit antibodies against cytochrome P-450 (SCC), P-450 (11 beta), and P-450 (C-21) from bovine adrenal cortex were prepared, and it was confirmed that these three cytochrome P-450 species are immunologically distinct from one another. Cytoplasmic sites of synthesis of P-450 (SCC), P-450 (11 beta), and P-450 (C-21) in bovine adrenal cortex were determined by examining the presence of their nascent peptides on isolated free and bound ribosomes. Nascent peptides were released in vitro from ribosomes by [3H]puromycin in a high salt buffer in the presence of a detergent, and the nascent peptides of P-450 (SCC), P-450 (11 beta), and P-450 (C-21) were isolated by immunoprecipitation. The nascent peptides of these three cytochrome P-450 species were found in both free and bound ribosomal fractions, suggesting that they share common sites of synthesis in the cytoplasm. However, the nascent peptides of mitochondrial P-450 (SCC) and P-450 (11 beta) were more concentrated in the free ribosomal fraction, whereas those of microsomal P-450 (C-21) were more abundant in the bound ribosomal fraction. The nascent peptides of the three cytochrome P-450 species were released from the membrane-bound ribosomes of rough microsomes into the cytoplasmic surface of microsomal vesicles by puromycin treatment.     

Enzymatic activities of P-450(11 beta)s expressed by two cDNAs in COS-7 cells

Expression plasmids were constructed using two cDNA clones of P-450(11 beta), pcP-450-(11 beta)-2, and pcP-450(11 beta)-3 (Morohashi et al. (1987) J. Biochem. 102, 559-568 and Kirita et al. (1988) J. Biochem. 104, 683-686), and introduced into COS-7 cells by electroporation. The expression of P-450(11 beta) proteins and their localization in the mitochondria were demonstrated by immunoblotting, immunofluorescence microscopy, and immunoelectron microscopy. The enzymatic activities of the expressed P-450(11 beta)s were determined using deoxycorticosterone (DOC), deoxycortisol, and corticosterone as substrates. Though the activities of the two P-450(11 beta)s for 11-, 18-, and 19-hydroxylation of DOC were almost equal, the production of 18-hydroxycorticosterone and aldosterone from corticosterone by P-450(11 beta)-3 was greater than that by P-450(11 beta)-2.     

Active site of bovine adrenocortical cytochrome P-450(11) beta studied by resonance Raman and electron paramagnetic resonance spectroscopies: distinction from cytochrome P-450scc

Cytochrome P-45011 beta was purified as the 11-deoxycorticosterone-bound form from bovine adrenocortical mitochondria and its active site was investigated by resonance Raman and EPR spectroscopies. Resonance Raman spectra of the purified sample revealed that the heme iron adopts the pure pentacoordinated ferric high-spin state on the basis of the nu 10 (1629cm-1) and nu 3 (1490 cm-1) mode frequencies, which are higher than those of the hexacoordinated ferric high-spin cytochrome P-450scc-substrate complexes. In the ferrous-CO state, a Fe2(+)-CO stretching mode was identified at 481.5 cm-1 on the basis of an isotopic substitution technique; this frequency is very close to that of cytochrome P-450scc in the cholesterol-complexed state (483 cm-1). The EPR spectra of the purified sample at 4.2 K showed ferric high-spin signals (at g = 7.98, 3.65, and 1.71) that were clearly distinct from the cytochrome P-450scc ferric high-spin signals (g = 8.06, 3.55, and 1.68) and confirmed previous assignments of ferric high-spin signals in adrenocortical mitochondria. The EPR spectra of the nitric oxide (NO) complex of ferrous cytochrome P-45011 beta showed EPR signals with rhombic symmetry (gx = 2.068, gz = 2.001, and gy = 1.961) very similar to those of the ferrous cytochrome P-450scc-NO complex in the presence of 22(S)-hydroxycholesterol and 20(R),22-(R)-dihydroxycholesterol at 77 K.(ABSTRACT TRUNCATED AT 250 WORDS)     

Lipid regulation of bovine cytochrome P450(11) beta activity

Purified bovine adrenocortical cytochrome P450(11) beta has been reconstituted into phospholipid vesicles using a detergent dialysis procedure. Using this reconstituted system, we have examined the effect of changes in the fatty acyl substituents of the lipids on the catalytic activity of the enzyme. The studies reported here show that cytochrome P450(11) beta exhibits a completely different response to changes in the fatty acyl groups from that shown by cytochrome P450scc. Cytochrome P450(11) beta displays maximal activity in lipid vesicles composed of saturated lipids, such as dipalmitoyl and dimyristoyl phosphatidylcholines, with turnover numbers ranging from 35 to 60 min-1. Incremental increases of phospholipids such as diphytanoyl and dioleoyl phosphatidylcholines result in a progressive inhibition of 11 beta hydroxylase activity; most of this kinetic effect is attributable to a significant decrease in Vmax accompanied by modest changes in Km for the steroid substrate deoxycorticosterone. Diphosphatidyl glycerol (cardiolipin), which has been previously shown to activate cytochrome P450scc, is a potent inhibitor of the 11 beta hydroxylase activity of cytochrome P450(11) beta, with half maximum inhibition observed in vesicles containing 4-5 mol% diphosphatidyl glycerol. Kinetic analysis demonstrates that this inhibition by diphosphatidyl glycerol is reflected in both a decrease in Vmax and relatively large increases (up to sevenfold) in Km for the steroid substrate. These effects on the 11 beta hydroxylase activity may have important implications for the in vivo regulation of not only the 11 beta hydroxylase activity, but also the other catalytic activities of this enzyme, particularly 18- and 19-hydroxylase and oxidase activities.     

Purification and properties of cytochrome P-450(11beta) from adrenocortical mitochondria.

A cytochrome P-450, which is functional in the steroid methylene 11β-hydroxylation (P-450_11β), has been purified to a protein weight of 85 kg per heme from bovine adrenocortical mitochondria. The purification is accomplished in the presence of deoxycorticosterone as a substrate stabilizer. The procedure involved solubilization of sonicated mitochondrial pellets, ammonium sulfate fractionation, alumina Cγ gel treatment and aniline-substituted Sepharose 4B chromatography.The purified preparation when freed from deoxycorticosterone, has a low spin type absorption spectrum which can rapidly be converted into a typical high spin substrate-bound form by the addition of an 11β-hydroxylatable steroid, either deoxycorticosterone or testosterone. The preparation exhibits high 11β-hydroxylase activity and is free from the cholesterol side-chain cleavage cytochrome P-450 (P-450_scc).The purified P-450_11β, when submitted to SDS-polyacrylamide gel electrophoresis, exhibits a single protein band (molecular weight of 46 kilodaltons) which is clearly distinguished from P-450_scc. As determined by the sedimentation equilibrium method, the molecular weight of the guanidine-treated P-450_11β is estimated to be 43 kilodaltons.     

Spectrophotometric study of cytochrome P-450 (11 beta) interaction with physiological effectors

Using the optical absorbance spectroscopy method, the interaction of a number of biospecific ligands (steroids, adrenodoxin) with homogeneous cytochrome P-450 (11 beta) from bovine adrenal mitochondria was investigated. The parameters of the steroid-protein interaction in a number of substrates and products of the 11 beta- and 18 (19)-hydroxylation with the active site of cytochrome P-450 (11 beta) were determined. A sharp decrease in the cytochrome affinity for steroids upon the insertion of the first hydroxy group was observed, which provides for a predominant formation of monohydroxylated products from the substrate and minimum amounts of dihydroxylated ones, despite the presence of more than one position for the substrate hydroxylation by cytochrome P-450 (11 beta). Some structural elements of the steroid molecule were determined as any alterations in these strongly affect the enzyme affinity for the steroid. These structures are: 1) delta 4-3-oxo structure; 2) either 21-hydroxy group of pregnen steroids or the one fulfilling its functions, 17 beta-hydroxy or 17-oxo group of androsten steroids, and 3) the 11th position of all the substrates under study. It was shown that the binding of various substrates into stoichiometric (1:1) steroid-protein complexes provides a transition to high spin state from 30-40% (cortisol, corticosterone) to 90-95% (11-deoxycorticosterone) of hemoprotein iron. Using the experimental system containing individual cytochrome P-450 (11 beta) and adrenodoxin, as well as the steroid and nonionic detergent Tween 20, it was shown that the parameters of substrate binding and hemoprotein spin equilibrium did not differ from the corresponding parameters of the cytochrome-adrenodoxin dienzyme complex. The peculiarities of the multiligand interactions in the 11 beta-hydroxylase system, involving cytochrome, substrates and ferredoxin demonstrate some analogy with a bacterial camphor hydroxylase system and some differences from the mitochondrial system for the side chain cleavage of cholesterol.     

Hydroxylation of 19-norandrostenedione by adrenal cortex mitochondrial P-450(11)beta

The activity of purified bovine adrenocortical P-450(11)beta on the C18-steroid, 4-estrene-3,17-dione (19-norandrostenedione), is described. The major steroid products were separated by HPLC and identified by GC-MS, and 1H- and 13C-NMR as 11 beta-, 18- and 6 beta-hydroxylated derivatives of 19-norandrostenedione. The turnover numbers of the 11 beta-, 18- and 6 beta-hydroxylase reactions were 45, 7.5 and 1.9 (mol/min/mol of P-450(11)beta), respectively, with a common Km of 44 microM. All of these activities required the presence of the electron donating system consisting of NADPH, adrenal ferredoxin (adrenodoxin) and its reductase. These findings provide additional insights into the versatile catalytic roles of P-450(11)beta in the adrenal cortex, in which it may act on C18-19-nor-steroids in addition to its known activities on C21- and C19-steroids.     

A novel method for the preparation of substrate-free cytochrome P-450(11) beta

A new method for the removal of the stabilizing substrate, deoxycorticosterone, from adrenal cytochrome P-450(11) beta, has been developed. Dextran coated charcoal is used for the adsorption of the steroid and the adsorbed steroid is separated from the cytochrome P-450-preparation by low speed centrifugation. The substrate-free enzyme, obtained in this manner, has all the characteristic spectral properties of low-spin cytochrome P-450(11) beta and may be converted to the high-spin form by the addition of deoxycorticosterone. The dextran coated charcoal method has the following advantages over the previously used method of substrate removal. It does not require the addition of the cofactors for cytochrome P-450-dependant hydroxylation of deoxycorticosterone, small amounts of enzyme may be prepared in a short time and the enzyme preparation is not diluted to any great extent during the process.     

Aromatase and nonaromatizing 10-demethylase activity of adrenal cortex mitochondrial P-450(11)beta

19-Oxoandrostenedione, the product of 19-hydroxyandrostenedione by the 19-oxidase activity of the purified P-450(11)beta system of adrenal cortex mitochondria, was further oxidized and demethylated at the 10-position to give the C18-steroids, estrone (aromatase reaction) and 19-norandrostenedione (nonaromatizing 10-demethylase or C10-19 lyase reaction). These reactions, together with the initial hydroxylation of androstenedione at C19, form a sequence of P-450(11)beta-catalyzed C19-steroid 19-monooxygenase reactions. P-450(11)beta is thus similar to placental endoplasmic P-450AROM in some of its substrate specificity, but the two forms of P-450 appear to be different in both physiology and properties.     

Production of 19-hydroxy-11-deoxycorticosterone and 19-oxo-11-deoxycorticosterone from 11-deoxycorticosterone by cytochrome P-450(11)beta

Incubation of 11-deoxycorticosterone with a cytochrome P-450(11)beta-reconstituted system yielded, in addition to corticosterone and 18-hydroxy-11-deoxycorticosterone, a new steroid product. The retention time of the new product was identical with that of authentic 19-hydroxy-11-deoxycorticosterone on high performance liquid chromatography (HPLC). The turnover number of 19-hydroxy-11-deoxycorticosterone formation was 7.0 mol/min/mol P-450. When a large amount of cytochrome P-450(11)beta was used for the reaction and the products were analyzed by HPLC, the 19-hydroxy-11-deoxycorticosterone peak disappeared from the chromatogram and concomitantly new unidentified peaks appeared. These results suggest that 19-hydroxy-11-deoxycorticosterone was further metabolized to other steroids by cytochrome P-450(11)beta. Therefore, we next incubated 19-hydroxy-11-deoxycorticosterone with cytochrome P-450(11)beta and analyzed the reaction products by HPLC. The above-mentioned unidentified peaks appeared again in the chromatogram. The retention time of one of the peaks coincided with that of authentic 19-oxo-11-deoxycorticosterone. This peak substance was purified by repeated HPLC and subjected to mass spectrometry and 1H NMR analyses. Its field desorption mass spectrum (FD-MS) showed a M+ peak at m/e 344. The 1H NMR spectrum showed the signal of an aldehyde proton instead of those of hydroxymethyl protons at the C-19 position. These results suggest that cytochrome P-450(11)beta can catalyze the 19-hydroxylation of 11-deoxycorticosterone, and the 19-hydroxy-11-deoxycorticosterone produced is further oxidized at the C-19 position to 19-oxo-11-deoxycorticosterone.     

P-450(11beta)-dependent conversion of androgen to estrogen, the aromatase reaction

Purified bovine adrenal P-450(11)beta has been shown to act as an aromatase which catalyzes conversion of 19-oxoandrostenedione to estrone. No conversions took place when any one of the required components such as NADPH, NADPH:adrenodoxin reductase, adrenodoxin and P-450(11)beta was omitted from the complete reconstituted system. P-450scc, another mitochondrial P-450 obtained from adrenal cortex, did not substitute for the P-450(11)beta in the aromatase reaction. These results show that P-450(11)beta is able to catalyze a series of reaction which can generate adrenal estrogen through androstenedione and its 19-hydroxy- and 19-oxo-derivatives. The P-450(11)beta-dependent reaction appears to be quite different from the placental aromatase reaction in that the latter is catalyzed by a microsomal P-450.     

Interaction of CYP11B1 (cytochrome P-45011 beta) with CYP11A1 (cytochrome P-450scc) in COS-1 cells.

The interactions of CYP11B1 (cytochrome P-45011beta), CYP11B2 (cytochrome P-450aldo) and CYP11A1 (cytochrome P-450scc) were investigated by cotransfection of their cDNA into COS-1 cells. The effect of CYP11A1 on CYP11B isozymes was examined by studying the conversion of 11-deoxycorticosterone to corticosterone, 18-hydroxycorticosterone and aldosterone. It was shown that when human or bovine CYP11B1 and CYP11A1 were cotransfected they competed for the reducing equivalents from the limiting source contained in COS-1 cells; this resulted in a decrease of the CYP11B activities without changes in the product formation patterns. The competition of human CYP11A1 with human CYP11B1 and CYP11B2 could be diminished with excess expression of bovine adrenodoxin. However, the coexpression of bovine CYP11B1 and CYP11A1 in the presence of adrenodoxin resulted in a stimulation of 11beta-hydroxylation activity of CYP11B1 and in a decrease of the 18-hydroxycorticosterone and aldosterone formation. These results suggest that the interactions of CYP11A1 with CYP11B1 and CYP11B2 do not have an identical regulatory function in human and in bovine adrenal tissue.