Crystal structure and improved antisense properties of 2'-O-(2-methoxyethyl)-RNA.

2'-O-(2-Methoxyethyl)-RNA (MOE-RNA) is a nucleic acid analog with promising features for antisense applications. Compared with phosphorothioate DNA (PS-DNA), the MOE modification offers improved nuclease resistance, enhanced RNA affinity, improved cellular uptake and intestinal absorption, reduced toxicity and immune stimulation. The crystal structure of a fully modified MOE-RNA dodecamer duplex (CGCGAAUUCGCG) was determined at 1.7 A resolution. In the majority of the MOE substituents, the torsion angle around the ethylene alkyl chain assumes a gauche conformation. The conformational preorganization of the MOE groups is consistent with the improved RNA affinity and the extensive hydration of the substituents could play a role in the improved cellular uptake of MOE-RNA. A specific hydration pattern that bridges substituent and phosphate oxygen atoms in the minor groove of MOE-RNA may explain its high nuclease resistance.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Molecular dynamics simulations of A. T-rich oligomers: sequence-specific binding of Na+ in the minor groove of B-DNA

Molecular dynamics simulations have been employed to probe the sequence-specific binding of sodium ions to the minor groove of B-DNA of three A. T-rich oligomers having identical compositions but different orders of the base pairs: C(AT)(4)G, CA(4)T(4)G, and CT(4)A(4)G. Recent experimental investigations, either in crystals or in solution, have shown that monovalent cations bind to DNA in a sequence-specific mode, preferentially in the narrow minor groove regions of uninterrupted sequences of four or more adenines (A-tracts), replacing a water molecule of the ordered hydration structure, the hydration spine. Following this evidence, it has been hypothesized that in A-tracts these events may be responsible for structural peculiarities such as a narrow minor groove and a curvature of the helix axis. The present simulations confirm a sequence specificity of the binding of sodium ions: Na(+) intrusions in the first layer of hydration of the minor groove, with long residence times, up to approximately 3 ns, are observed only in the minor groove of A-tracts but not in the alternating sequence. The effects of these intrusions on the structure of DNA depend on the ion coordination: when the ion replaces a water molecule of the spine, the minor groove becomes narrower. Ion intrusions may also disrupt the hydration spine modifying the oligomer structure to a large extent. However, in no case intrusions were observed to locally bend the axis toward the minor groove. The simulations also show that ions may reside for long time periods in the second layer of hydration, particularly in the wider regions of the groove, often leading to an opening of the groove.     

DNA minor groove electrostatic potential: influence of sequence-specific transitions of the torsion angle gamma and deoxyribose conformations

The structural adjustments of the sugar-phosphate DNA backbone (switching of the γ angle (O5′–C5′–C4′–C3′) from canonical to alternative conformations and/or C2′-endo → C3′-endo transition of deoxyribose) lead to the sequence-specific changes in accessible surface area of both polar and non-polar atoms of the grooves and the polar/hydrophobic profile of the latter ones. The distribution of the minor groove electrostatic potential is likely to be changing as a result of such conformational rearrangements in sugar-phosphate DNA backbone. Our analysis of the crystal structures of the short free DNA fragments and calculation of their electrostatic potentials allowed us to determine: (1) the number of classical and alternative γ angle conformations in the free B-DNA; (2) changes in the minor groove electrostatic potential, depending on the conformation of the sugar-phosphate DNA backbone; (3) the effect of the DNA sequence on the minor groove electrostatic potential. We have demonstrated that the structural adjustments of the DNA double helix (the conformations of the sugar-phosphate backbone and the minor groove dimensions) induce changes in the distribution of the minor groove electrostatic potential and are sequence-specific. Therefore, these features of the minor groove sizes and distribution of minor groove electrostatic potential can be used as a signal for recognition of the target DNA sequence by protein in the implementation of the indirect readout mechanism.     

Structure and stability of the consecutive stereoregulated chiral phosphorothioate DNA duplex

The duplex structures of the stereoregulated phosphorothioate DNAs, [R(p),R(p)]- and [S(p),S(p)]-[d(GC(ps)T(ps)ACG)] (ps, phosphorothioate; PS-DNA), with their complementary RNA have been investigated by combined use of (1)H NMR and restrained molecular dynamics calculation. Compared to those obtained for the unmodified duplex structures (PO-DNA.RNA), the NOE cross-peak intensities are virtually identical for the PS-DNA.RNA hybrid duplexes. The structural analysis on the basis of the NOE restraints reveals that all of the three DNA.RNA duplexes take a A-form conformation and that there is no significant difference in the base stacking for the DNA.RNA hybrid duplexes. On the other hand, the NOE cross-peak intensities of the protons around the central T(ps)A step of the PS-DNA.DNA duplexes are apparently different from those of PO-DNA. DNA. The chemical shifts of H8/6 and H1' at the T(ps)A step are also largely different among PS-DNA.DNAs and PO-DNA.DNA, suggesting that the DNA.DNA structure is readily changed by the introduction of the phosphorothioate groups to the central T(p)A step. The structure calculations indicate that all of these DNA.DNA duplexes are B-form although there exist some small differences in helical parameters between the [R(p),R(p)]- and [S(p),S(p)]PS-DNA.DNA duplexes. The melting temperatures (T(m)) were determined for all of the duplexes by plotting the chemical shift change of isolated peaks as a function of temperature. For the PS-DNA.RNA hybrid duplexes, the [S(p),S(p)] isomer is less stable than the [R(p),R(p)] isomer while this trend is reversed for the PS-DNA.DNA duplexes. Consequently, although the PS-DNA.RNA duplexes take the similar A-form structure, the duplex stability is different between PS-DNA.RNA duplexes. The stability of the DNA.RNA duplexes may not be governed by the A-form structure itself but by some other factors such as the hydration around the phosphorothioate backbone, although the T(m) difference of the DNA.DNA duplexes could be explained by the structural factor.     

Dependence of the hydration shell structure in the minor groove of the DNA double helix on the groove width as revealed by Monte Carlo simulation.

The hydration shell of several conformations of the polynucleotides poly(dA).poly(dT), poly(dA).poly(dU), and poly(dA-dI).poly(dT-dC) has been simulated using the Monte Carlo method (Metropolis sampling). Calculations have shown that the structure of the hydration shell of the minor groove greatly depends on its width. In conformations with a narrowed minor groove, the first layer of the hydration shell of this groove has only one molecule per nucleotide pair that forms H bonds with purine N3 of one pair and pyrimidine O2 of the next pair. The second layer of the hydration shell of such conformations contains molecules that form H bonds between two adjacent molecules of the first layer. The probability of formation of hydration spine is about 20% while the bridges of the first layer are formed with a probability of about 70%. In the first layer of the minor groove of the B-DNA conformation with wide minor groove there are approximately two water molecules per base pair that form H bonds with purine N3 or pyrimidine O2 and with the sugar ring oxygen of the adjacent nucleotide. The probability of simultaneous H bonding of a water molecule with N3 (or O2) and O of sugar ring is about 30%. The results of simulation suggest that hydration spine proposed for the narrowed minor groove of oligonucleotide crystals [H. R. Drew, and R. E. Dickerson (1981) Journal of Molecular Biology, Vol. 151, pp. 535-556] can be formed in fibers of poly(dA).poly(dT), poly(dA).poly(dU), and poly(dA-dI).poly(dT-dC) as well as in DNA fragments of these sequences in solution.(ABSTRACT TRUNCATED AT 250 WORDS)     

DNA B to D transition can be explained in terms of hydration economy of the minor groove atoms

Adjacent phosphate oxygen atoms in A and Z-DNA are located much closer together than in the B form and can be hydrated more economically due to the formation of water bridges between them, whereas in the B form phosphates are hydrated individually. This principle of hydration economy of phosphate groups discovered by Saenger and colleagues could not be applied to the B-D transition, which, like the B-A and B-Z transitions, occurs in a situation of water deficiency, because the distances between adjacent phosphates of individual polynucleotide chains in the D form are not much different from B-DNA. It follows from our calculations of B and D-DNA accessibility to solvent performed by the method of Lee & Richards, and from a simulation of solvent structure near DNA, that there is an economy of hydration only for the minor groove atoms. This feature and some experimental data can explain why only a limited range of sequences consisting of A.T or I.C pairs undergo the transition to the D form. The conformational transition in DNAs with such sequences to a poly[d(A]).poly[d(T])-like conformation (Bh-DNA), which is accompanied by a narrowing of the minor groove, can be explained in the same way. Calculations suggest that in the D-form minor groove of different A-T or I-C DNAs there is a double-layer hydration spine similar to that observed by Drew & Dickerson in the A-T tract of the d(C-G-C-G-A-A-T-T-C-G-C-G) dodecamer. The B-D and B-Bh transitions in A + T-rich DNAs can have biological implications, e.g. they can facilitate DNA bending upon the interaction with proteins.     

Complicated water orientations in the minor groove of the B-DNA decamer d(CCATTAATGG)2 observed by neutron diffraction measurements

It has long been suspected that the structure and function of a DNA duplex can be strongly dependent on its degree of hydration. By neutron diffraction experiments, we have succeeded in determining most of the hydrogen (H) and deuterium (D) atomic positions in the decameric d(CCATTAATGG)₂ duplex. Moreover, the D positions in 27 D₂O molecules have been determined. In particular, the complex water network in the minor groove has been observed in detail. By a combined structural analysis using 2.0 Å resolution X-ray and 3.0 Å resolution neutron data, it is clear that the spine of hydration is built up, not only by a simple hexagonal hydration pattern (as reported in earlier X-ray studies), but also by many other water bridges hydrogen-bonded to the DNA strands. The complexity of the hydration pattern in the minor groove is derived from an extraordinary variety of orientations displayed by the water molecules.     

Solution structure of [d(GGTATACC)]2: wrinkled D structure of the TATA moiety

Phase-sensitive two-dimensional nuclear Overhauser effect spectra of [d(GGTATACC)]2 in aqueous deuterium oxide solution at four mixing times were quantified to give all nonoverlapping cross-peak intensities. A structural model for [d(GGTATACC)]2 was built in which the GG- and -CC moieties were in the B-DNA form, while the middle -TATA- moiety was in the wrinkled-D form (BDB model). This model was subjected to energy refinement by molecular mechanics calculations with the program AMBER. Counterions (Na+) were added to neutralize the charges, and water molecules were placed bridging across the minor groove. A complete relaxation matrix analysis was used to calculate two-dimensional nuclear Overhauser effect spectra of [d(GGTATACC)]2 from the above models (before and after energy refinement) and from four other [d(GGTATACC)]2 structural models: regular A, crystalline A, regular B, and energy-minimized B. Among them, the energy-minimized BDB model yielded a set of theoretical spectra that gave the best fit to the experimental spectra. It was also the energetically most stable. Therefore, it is a good representation of the ensemble- and time-averaged structure of the octamer in solution. This model has backbone torsion angles similar to those of B-form DNA in the GG- and -CC moieties and torsion angles similar to those of wrinkled D form DNA in the -TATA- moiety. The base stacking and base pairing are not interrupted at the junctions between the two structural moieties. Its minor groove is narrower than that of B DNA, and the solvent-accessible surface of the minor groove forms a closed hydration tunnel in the middle -TATA- segment.     

Structure, dynamics and hydration of the nogalamycin-d(ATGCAT)2Complex determined by NMR and molecular dynamics simulations in solution.

The structure of the 1:1 nogalamycin:d(ATGCAT)2 complex has been determined in solution from high-resolution NMR data and restrained molecular dynamics (rMD) simulations using an explicit solvation model. The antibiotic intercalates at the 5'-TpG step with the nogalose lying along the minor groove towards the centre of the duplex. Many drug-DNA nuclear Overhauser enhancements (NOEs) in the minor groove are indicative of hydrophobic interactions over the TGCA sequence. Steric occlusion prevents a second nogalamycin molecule from binding at the symmetry-related 5'-CpA site, leading to the conclusion that the observed binding orientation in this complex is the preferred orientation free of the complication of end-effects (drug molecules occupy terminal intercalation sites in all X-ray structures) or steric interactions between drug molecules (other NMR structures have two drug molecules bound in close proximity), as previously suggested. Fluctuations in key structural parameters such as rise, helical twist, slide, shift, buckle and sugar pucker have been examined from an analysis of the final 500 ps of a 1 ns rMD simulation, and reveal that many sequence-dependent structural features previously identified by comparison of different X-ray structures lie within the range of dynamic fluctuations observed in the MD simulations. Water density calculations on MD simulation data reveal a time-averaged pattern of hydration in both the major and minor groove, in good agreement with the extensive hydration observed in two related X-ray structures in which nogalamycin is bound at terminal 5'-TpG sites. However, the pattern of hydration determined from the sign and magnitude of NOE and ROE cross-peaks to water identified in 2D NOESY and ROESY experiments identifies only a few "bound" water molecules with long residence times. These solvate the charged bicycloaminoglucose sugar ring, suggesting an important role for water molecules in mediating drug-DNA electrostatic interactions within the major groove. The high density of water molecules found in the minor groove in X-ray structures and MD simulations is found to be associated with only weakly bound solvent in solution.     

Hydration of the RNA duplex r(CGCAAAUUUGCG)2 determined by NMR.

The so-called spine of hydration in the minor groove of AnTn tracts in DNA is thought to stabilise the structure, and kinetically bound water detected in the minor groove of such DNA species by NMR has been attributed to a narrow minor groove [Liepinsh, E., Leupin, W. and Otting, G. (1994) Nucleic Acids Res. 22, 2249-2254]. We report here an NMR study of hydration of an RNA dodecamer which has a wide, shallow minor groove. Complete assignments of exchangeable protons, and a large number of non-exchangeable protons in r(CGCAAAUUUGCG)2 have been obtained. In addition, ribose C2'-OH resonances have been detected, which are probably involved in hydrogen bonds. Hydration at different sites in the dodecamer has been measured using ROESY and NOESY experiments at 11.75 and 14.1 T. Base protons in both the major and minor grooves are in contact with water, with effective correlation times for the interaction of approximately 0.5 ns, indicating weak hydration, in contrast to the hydration of adenine C2H in the homologous DNA sequence. NOEs to H1' in the minor groove are consistent with hydration water present that is not observed in the analogous DNA sequence. Hydration kinetics in nucleic acids may be determined by chemical factors such as hydrogen-bonding more than by simple conformational factors such as groove width.     

An iterative approach to placing counterions around DNA

An iterative approach, in which the effect of placing counter ions around DNA influences the electrostatic potential that the other subsequently approaching ions feel, has been used to place sodium ions around polynucleotides. The main focus of this report is to study the sequence and structure dependence on the distribution of ions around DNA, particularly that of tightly bound ions. The interesting results of the calculations are that there is significant sequence dependence on the electrostatic potentials in the B form of DNA, whereas relatively less difference in A form. In the case of Z form, the cations bridge the inter-stand phosphates along the minor groove.     

Alteration of the groove width of DNA induced by the multimodal hydrogen bonding of denaturants with DNA bases in its grooves affects their stability

BackgroundDenaturants, namely, urea and guanidinium chloride (GdmCl) affect the stability as well as structure of DNA. Critical assessment of the role of hydrogen bonding of these denaturants with the different regions of DNA is essential in terms of its stability and structural aspect. However, the understanding of the mechanistic aspects of structural change of DNA induced by the denaturants is not yet well understood.MethodsIn this study, various spectroscopic along with molecular dynamics (MD) simulation techniques were employed to understand the role of hydrogen bonding of these denaturants with DNA bases in their stability and structural change.Results and conclusionIt has been found that both, GdmCl and urea intrude into groove region of DNA by striping surrounding water. The hydrogen bonding pattern of Gdm⁺ and urea with DNA bases in its groove region is multimodal and distinctly different from each other. The interaction of GdmCl with DNA is stabilized by electrostatic interaction whereas electrostatic and Lennard-Jones interactions both contribute for urea. Gdm⁺ forms direct hydrogen bond with the bases in the minor groove of DNA whereas direct and water assisted hydrogen bond takes place with urea. The hydrogen bond formed between Gdm⁺ with bases in the groove region of DNA is stronger than urea due to strong electrostatic interaction along with less self-aggregation of Gdm⁺ than urea. The distinct hydrogen bonding capability of Gdm⁺ and urea with DNA bases in its groove region affects its width differently. The interaction of Gdm⁺ decreases the width of the minor and major groove which probably increases the strength of hydrogen bond between the Watson-Crick base pairs of DNA leading to its stability. In contrast, the interaction of urea does not affect much to the width of the grooves except the marginal increase in the minor groove width which probably decreases the strength of hydrogen bond between Watson Crick base pairs leading to the destabilization of DNA.General significanceOur study clearly depicts the role of hydrogen bonding between DNA bases and denaturants in their stability and structural change which can be used further for designing of the guanidinium based drug molecules.     

Ordered water structure around a B-DNA dodecamer: A quantitative study

The crystal structure of the double-helical B-DNA dodecamer of sequence C-G-C-G-A-A-T-T-C-G-C-G has been solved and refined independently in three forms: (1) the parent sequence at room temperature; (2) the same sequence at 16 K; and (3) the 9-bromo variant C-G-C-G-A-A-T-T^BrC-G-C-G at 7 °C in 60% (v/v) 2-methyl-2.4-pentanediol. The latter two structures show extensive hydration along the phosphate backbone, a feature that was invisible in the native structure because of high temperature factors (indicating thermal or static disorder) of the backbone atoms. Sixty-five solvent peaks are associated with the phosphate backbone, or an average of three per phosphate group. Nineteen other molecules form a first shell of hydration to base edge N and O atoms within the major groove, and 36 more are found in upper hydration layers. The latter tend to occur in strings or clusters spanning the major groove from one phosphate group to another. A single spermine molecule also spans the major groove. In the minor groove, the zig-zag spine of hydration that we believe to be principally responsible for stabilizing the B form of DNA is found in all three structures. Upper level hydration in the minor groove is relatively sparse, and consists mainly of strings of water molecules extending across the groove, with few contacts to the spine below. Sugar O-1′ atoms are closely associated with water molecules, but these are chiefly molecules in the spine, so the association may reflect the geometry of the minor groove rather than any intrinsic attraction of O-1′ atoms for hydration. The phosphate O-3′ and O-5′ atoms within the backbone chain are least hydrated of all, although no physical or steric impediment seems to exist that would deny access to these oxygen atoms by water molecules.     

Structural insights into the effect of hydration and ions on A-tract DNA: a molecular dynamics study

DNA structure is known to be sensitive to hydration and ionic environment. To explore the dynamics, hydration, and ion binding features of A-tract sequences, a 7-ns Molecular dynamics (MD) study has been performed on the dodecamer d(CGCAAATTTGCG)(2). The results suggest that the intrusion of Na(+) ion into the minor groove is a rare event and the structure of this dodecamer is not very sensitive to the location of the sodium ions. The prolonged MD simulation successfully leads to the formation of sequence dependent hydration patterns in the minor groove, often called spine of hydration near the A-rich region and ribbon of hydration near the GC regions. Such sequence dependent differences in the hydration patterns have been seen earlier in the high resolution crystal structure of the Drew-Dickerson sequence, but not reported for the medium resolution structures (2.0 approximately 3.0 A). Several water molecules are also seen in the major groove of the MD simulated structure, though they are not highly ordered over the extended MD. The characteristic narrowing of the minor groove in the A-tract region is seen to precede the formation of the spine of hydration. Finally, the occurrence of cross-strand C2-H2.O2 hydrogen bonds in the minor groove of A-tract sequences is confirmed. These are found to occur even before the narrowing of the minor groove, indicating that such interactions are an intrinsic feature of A-tract sequences.     

C-C-A-G-G-C-m5C-T-G-G. Helical fine structure, hydration, and comparison with C-C-A-G-G-C-C-T-G-G.

The self-complementary DNA duplex C-C-A-G-G-C-m5C-T-G-G has been refined against 1.75-A x-ray diffraction data to an R value of 17.4%. In the crystal of space group P6, 10-base pair DNA fragments with characteristic sequence-related fine structure stack end to end to form long antiparallel B-type double helices. As shown by a structure analysis at lower resolution (Heinemann, U., and Alings, C. (1991) EMBO J. 10, 35-43), the overall geometry of C-C-A-G-G-C-m5C-T-G-G is similar to that of the unmethylated analog C-C-A-G-G-C-C-T-G-G despite a different crystal environment. The present high resolution structure analysis permits a detailed comparison of the two duplexes and their hydration spheres. Helical parameters are significantly correlated between both molecules, with the exception of the base pair propeller. Sugar pucker and backbone torsion angles alpha, gamma, delta, and chi show similar mean values, but their individual values deviate significantly between duplexes. In contrast, torsion angles beta, epsilon, and zeta change along the strands of both duplexes in much the same way. The effect of single-site methylation on DNA conformation appears to be small and limited to the base pairs directly involved. Methylation tends to push base pairs toward the minor groove of the helix. A regular minor groove hydration pattern involves dual hydrogen bonding of water molecules to O-4' and base atoms of C-C-A-G-G-C-m5C-T-G-G.     

An Iterative Approach to Placing Counterions Around DNA

Abstract

An iterative approach, in which the effect of placing counter ions around DNA influences the electrostatic potential that the other subsequently approaching ions feel, has been used to place sodium ions around polynucleotides. The main focus of this report is to study the sequence and structure dependence on the distribution of ions around DNA, particularly that of tightly bound ions. The interesting results of the calculations are that there is significant sequence dependence on the electrostatic potentials in the B form of DNA, whereas relatively less difference in A form. In the case of Z form, the cations bridge the inter-stand phosphates along the minor groove.     

The structure of DAPI bound to DNA

The structure of the DNA fluorochrome 4'-6-diamidine-2-phenyl indole (DAPI) bound to the synthetic B-DNA oligonucleotide C-G-C-G-A-A-T-T-C-G-C-G has been solved by single crystal x-ray diffraction methods, at a resolution of 2.4 A. The structure is nearly isomorphous with that of the native DNA molecule alone. With one DAPI and 25 waters per DNA double helix, the residual error is 21.5% for the 2428 reflections above the 2-sigma level. DAPI inserts itself edgewise into the narrow minor groove, displacing the ordered spine of hydration. DAPI and a single water molecule together span the four AT base pairs at the center of the duplex. The indole nitrogen forms a bifurcated hydrogen bond with the thymine O2 atoms of the two central base pairs, as with netropsin and Hoechst 33258. The preference of all three of these drugs for AT regions of B-DNA is a consequence of three factors: (1) The intrinsically narrower minor groove in AT regions than in GC regions of B-DNA, leading to a snug fit of the flat aromatic drug rings between the walls of the groove. (2) The more negative electrostatic potential within the minor groove in AT regions, attributable in part to the absence of electropositive-NH2 groups along the floor of the groove, and (3) The steric advantage of the absence of those same guanine-NH2 groups, thus permitting the drug molecule to sink deeper into the groove. Groove width and electrostatic factors are regional, and define the relative receptiveness of a section of DNA since they operate over several contiguous base pairs. The steric factor is local, varying from one base pair to the next, and hence is the means of fine-tuning sequence specificity.