共查询到20条相似文献,搜索用时 15 毫秒
1.
Cerebroside (monohexosylceramide) components were identified in neutral lipids extracted from both the yeast and mycelial forms of the thermally dimorphic mycopathogen Histoplasma capsulatum. The components were purified from both forms and their structures elucidated by 1- and 2-dimensional nuclear magnetic resonance (NMR) spectroscopy, electrospray ionization mass spectrometry (ESI-MS), and low energy tandem collision-induced dissociation mass spectrometry (ESI-MS/CID-MS). Both components were characterized as beta-glucopyranosylceramides (GlcCers) containing (4E,8E)-9-methyl-4,8-sphingadienine as the long-chain base, attached to 18-carbon 2-hydroxy fatty N-acyl components. However, while the fatty acid of the yeast form GlcCer was virtually all N-2'-hydroxyoctadecanoate, the mycelium form GlcCer was characterized by almost exclusive expression of N-2'-hydroxy-(E)-delta(3)-octadecenoate. These results suggest that the yeast-mycelium transition is accompanied by up-regulation of an as yet uncharacterized ceramide or cerebroside 2-hydroxy fatty N-acyl (E)-delta(3)-desaturase activity. They also constitute further evidence for the existence of two distinct pathways for ceramide biosynthesis in fungi, since glycosylinositol phosphorylceramides (GIPCs), the other major class of fungal glycosphingolipids, are found with ceramides consisting of 4-hydroxysphinganine (phytosphingosine) and longer chain 2-hydroxy fatty acids. In addition to identification of the major glucocerebroside components, minor components (< 5%) detectable by molecular weight differences in the ESI-MS profiles were also characterized by tandem ESI-MS/CID-MS analysis. These minor components were identified as variants differing in fatty acyl chain length, or the absence of the sphingoid 9-methyl group or (E)-delta(8)-unsaturation, and are hypothesized to be either biosynthetic intermediates or the result of imperfect chemical transformation by the enzymes responsible for these features. Possible implications of these findings with respect to chemotaxonomy, compartmentalization of fungal glycosphingolipid biosynthetic pathways, and regulation of morphological transitions in H.capsulatum and other dimorphic fungi are discussed. 相似文献
2.
The onychophoran sperm tail contains several kinds of microtubulcs; probably more than that of any other animal group. There are thus a peripheral manchette consisting of many tightly spaced microtubules, a ring of nine 'peripheral singlets' and a central axoneme of the classical 9 + 2 type (nine doublets and two central singlets). The protofilament organization of these various microtubules was examined and compared to the structure and mode of formation of the peripheral singlets with that of its analogues in other animal groups. The onychophoran peripheral singlets were found to differ in two respects from those in insects: they are formed from the manchette rather than from the axonemal doublets and their transient connection to the axoneme is to the A-subtubules of the doublet rather than to the B-subtubules. The manchette microtubules as well as the peripheral singlets consist of 13 protoh'laments. The manchette may serve a mechanical function (to strengthen the unusually thick sperm tail) hut the role of the peripheral singlets remains unknown. 相似文献
3.
4.
The metabolomic analysis of Brassica rapa leaves treated with methyl jasmonate was performed using 2-dimensional J-resolved NMR spectroscopy combined with multivariate data analysis. The principal component analysis of the J-resolved NMR spectra showed discrimination between control and methyl jasmonate treated plants by principal components 1 and 2. While the level of glucose, sucrose and amino acids showed a decrease after methyl jasmonate treatment, hydroxycinnamates and glucosinolate were highly increased. Methyl jasmonate treatment resulted in a long-term accumulation of indole glucosinolate and indole-3-acetic acid, lasting up to 14 days after treatment. Malate conjugated hydroxycinnamates also exhibited an increase until 14 days after methyl jasmonate treatment, these compounds might play an important role in plant defence responses mediated by methyl jasmonate. 相似文献
5.
《FEBS letters》1987,216(1):4-6
The competitive oxidation of 13CH3OH and 13CD3OH has been observed using in vivo 13C NMR spectroscopy. Simultaneous 1H and 2H decoupling gave isotopically shifted 13C singlets for the two methanol isotopomers. The measured enzymic isotope effect, kH/kD is approx. 1.8, indicating that CH bond cleavage is not rate-determining. 相似文献
6.
Xiaowei Zhang Lan Sun Wei Chen Shanna Wu Yanmeng Li Xiaojin Li 《Cell Adhesion & Migration》2019,13(1):170-182
The actin cytoskeleton of hepatic stellate cells (HSCs) is reorganized when they are cultured in 3D collagen matrices. Here, we investigated the molecular mechanism of actin cytoskeleton reorganization in HSCs cultured in 3D floating collagen matrices (FCM) compared to those on 2D polystyrene surfaces (PS). First, we found that the generation of dendritic cellular processes was controlled by Rac1. Next, we examined the differential gene expression of HSCs cultured on 2D PS and in 3D FCM by RNA-Seq and focused on the changes of actin cytoskeleton reorganization-related molecular components and guanine nucleotide exchange factors (GEFs). The results showed that the expression of genes associated with actin cytoskeleton reorganization-related cellular components, filopodia and lamellipodia, were significantly decreased, but podosome-related genes was significantly increased in 3D FCM. Furthermore, we found that a Rac1-specific GEF, ARHGEF4, played roles in morphological changes, migration and podosome-related gene expression in HSCs cultured in 3D FCM.
Abbreviations: 2D PS: 2-dimensional polystyrene surface; 3D FCM: 3-dimensional floating collagen matrices; ARHGEF4: Rho guanine nucleotide exchange factor 4; ARHGEF6: Rho guanine nucleotide exchange factor 6; GEF: guanine nucleotide exchange factor; HSC: hepatic stellate cell 相似文献
7.
The structural remodeling of collagen is important in biological processes such as fibrosis, developmental morphogenesis and wound repair. Highly ordered collagen macromolecules produce second harmonic generation signals without the need for any exogenous label. Conversely, the cellular components stained with exogenous labels generate multiphoton excitation fluorescence signals. Both these signals can be captured simultaneously to provide spatially resolved structural reorganization of a collagen matrix and cells. This study dealt with an in vitro collagen gel contraction model of wound repair, in which fibroblasts are seeded into a 3-dimensional type I collagen matrix. When cells are stimulated to trigger collagen contraction, we found the fibroblasts to be highly elongated as well as interconnected in 2-dimensional space, and the collagen, in the form of a visibly clear fibril structure, accumulated around the cells. In the absence of contraction, on the other hand, the cells were predominantly round in shape and no sign of collagen accumulation around the cell was evident despite the presence of the fibrillar collagen morphology in the matrix. Our data suggest second harmonic and multiphoton excitation fluorescence signals can be used in tandem to provide spatially resolved 3-dimensional structural remodeling of a collagen matrix during wound repair. 相似文献
8.
MIKIO SUHAMA 《The Journal of eukaryotic microbiology》1990,37(5):344-352
ABSTRACT. In the ciliate Glaucoma scintillans , the process of transformation of unbalanced homopolar doublets to singlets was investigated. Cells were fixed 1–3 days after inoculation and impregnated with silver according to the Chatton-Lwoff technique. The two oral apparatuses (OAs) approached each other partly due to a loss of ciliary rows in one of the two components (semicells) consisting of a doublet. The contractile vacuole pore (CVP) in the narrow semicell (sc1) was lost at an early stage of regulation, while the position of CVP in the broad semicell (sc2) shifted toward the right after the loss of sc1. The sc1 of 20 row-intervals in breadth was a transition point above which the sc1 was able to persist for awhile, and beneath which it was actively lost. There was no evidence for an independent effect of sc2 on the transformation of doublets to singlets. In cell division, an additional reversed oral primordium (sOP) was formed in unbalanced doublets, usually within a narrow sc1 of 11–20 row-intervals. The position of the sOP was generally 4–6 row-intervals distant from the right side of the oral meridian (OM1) with the cell's left OA. Most of the doublets with an sOP lacked an oral primordium in the OM1. No mature triplet with 2 normal OAs and an abnormal OA was found in these preparations. The pathway of regulation, the movement of the CVP, and the formation of an sOP are discussed. 相似文献
9.
Six breeds of swine were used to study the structure of swine leukocyte antigen class I (SLA-I). SLA-I complexes were produced by linking SLA-2 genes and β(2)m genes via a linker encoding a 15 amino acid glycine-rich sequence, (G4S)3, using splicing overlap extension (SOE)-PCR in vitro. The six recombinant SLA-2-linker-β(2)m genes were each inserted into p2X vectors and their expression induced in Escherichia coli TB1. The expressed proteins were detected by SDS-PAGE and western blotting. The maltose binding protein (MBP)-SLA-I fusion proteins were purified by amylose affinity chromatography followed by cleavage with factor Xa and separation of the SLA-I protein monomers from the MBP using a DEAE Ceramic Hyper D F column. The purified SLA-I monomers were detected by circular dichroism (CD) spectroscopy and the 3-dimensional (3D) structure of the constructed single-chain SLA-I molecules were analyzed by homology modeling. Recombinant SLA-2-Linker-β(2)m was successfully amplified from all six breeds of swine by SOE-PCR and expressed as fusion proteins of 84.1 kDa in pMAL-p2X, followed by confirmation by western blotting. After purification and cleavage of the MBP-SLA-I fusion proteins, SLA-I monomeric proteins of 41.6 kDa were separated. CD spectroscopy demonstrated that the SLA-I monomers had an α-helical structure, and the average α-helix, β-sheet, turn and random coil contents were 21.6%, 37.9%, 15.0% and 25.5%, respectively. Homology modeling of recombinant single-chain SLA-I molecules showed that the heavy chain and light chain constituted SLA-I complex with an open antigenic peptide-binding groove. It was concluded that the expressed SLA-I proteins in pMAL-p2X folded correctly and could be used to bind and screen nonameric peptides in vitro. 相似文献
10.
Stockner T Plugariu C Koraimann G Högenauer G Bermel W Prytulla S Sterk H 《Biochemistry》2001,40(11):3370-3377
The solution structure of the DNA-binding domain of the TraM protein, an essential component of the DNA transfer machinery of the conjugative resistance plasmid R1, is presented. The structure has been determined using homonuclear 2-dimensional NMR spectroscopy as well as 15N labeled heteronuclear 2- and 3-dimensional NMR spectroscopy. It turns out that the solution structure of the DNA binding domain of the TraM protein is globular and dominantly helical. The very first amino acids of the N-terminus are unstructured. 相似文献
11.
Brecknock S Dibbayawan TP Vesk M Vesk PA Faulkner C Barton DA Overall RL 《Planta》2011,234(4):749-758
Symplastic transport occurs between neighbouring plant cells through functionally and structurally dynamic channels called
plasmodesmata (PD). Relatively little is known about the composition of PD or the mechanisms that facilitate molecular transport
into neighbouring cells. While transmission electron microscopy (TEM) provides 2-dimensional information about the structural
components of PD, 3-dimensional information is difficult to extract from ultrathin sections. This study has exploited high-resolution
scanning electron microscopy (HRSEM) to reveal the 3-dimensional morphology of PD in the cell walls of algae, ferns and higher
plants. Varied patterns of PD were observed in the walls, ranging from uniformly distributed individual PD to discrete clusters.
Occasionally the thick walls of the giant alga Chara were fractured, revealing the surface morphology of PD within. External structures such as spokes, spirals and mesh were
observed surrounding the PD. Enzymatic digestions of cell wall components indicate that cellulose or pectin either compose
or stabilise the extracellular spokes. Occasionally, the PD were fractured open and desmotubule-like structures and other
particles were observed in their central regions. Our observations add weight to the argument that Chara PD contain desmotubules and are morphologically similar to higher plant PD. 相似文献
12.
13.
R P Gorshkova E N Kalmykova V V Isakov Y S Ovodov 《European journal of biochemistry》1985,150(3):527-531
Lipopolysaccharides from Yersinia enterocolitica serovars O:1,2a,3, O:2a,2b,3 and O:3 have been isolated and characterized. 6-Deoxy-L-altrose residues were shown to be the main constituents of lipopolysaccharides isolated in addition to residues of L-rhamnose, D-glucose, D-galactose, 2-acetamido-2-deoxy-D-glucose, 2-acetamido-2-deoxy-D-galactose, D-glycero-D-manno-heptose and L-glycero-D-manno-heptose, 3-deoxy-D-manno-octulosonic acid being minor components of sugar chains. Mild hydrolysis of lipopolysaccharides with acetic acid furnished O-specific polysaccharides, which are composed of 6-deoxy-L-altrose. Using 13C-NMR spectroscopy and methylation data, the structural features of backbones have been elucidated as follows: ----2)-6d-L-Altp(beta 1----2)-6d-L-Altp(beta 1----3)-6d-L-Altp)(beta 1----for serovars O:1,2a,3 and O:2a,2b,3;----2)-6d-L-Altp(beta 1----for serovar O:3. In addition, O-polysaccharide of serovar O:2a,2b,3 was found to contain an O-acetyl group at the C-3 position of some 1,2-linked sugar residues. 相似文献
14.
Noriko Takahashi Tsukasa Matsuda Kazuno Shikami Ichio Shimada Yoji Arata Ryo Nakamura 《Glycoconjugate journal》1993,10(6):425-434
Asparagine-linked oligosaccharides of duck ovomucoid were released quantitatively from the protein by digestion with glycoamidase A (from almond), the reducing ends of the oligosaccharide chains thus obtained were aminated with a fluorescent reagent, 2-aminopyridine, and the mixture of pyridylamino derivatives of the oligosaccharides was separated using two different types of high performance liquid chromatography (HPLC) on a reversed phase column and an amide adsorption column. More than sixteen different oligosaccharides were separated and the structures were characterized by a combination of the 2-dimensional sugar mapping technique using HPLC, exoglycosidase digestion, and proton nuclear magnetic resonance measurements (1- and 2-dimensional). Furthermore, the HPLC profile of duck ovomucoid oligosaccharides was compared with previously reported profiles obtained from quail and chicken ovomucoids.Abbreviations COSY
chemical shift-correlated spectroscopy
- DQF-COSY
double quantum filtered COSY
- DSS
sodium, 4,4-dimethyl-4-silapentane 1-sulfonate
- Gal
D-galactose
- GlcNAc or GN
N-acetyl-D-glucosamine
- HOHAHA
homonuclear Hartmann-Hahn spectroscopy
- Man or M
D-mannose
- NOE
nuclear Overhauser enhancement
- ODS
octadecylsilyl
- PA
pyridylamino
- ROESY
rotating frame nuclear Overhauser effect spectroscopy
- SDS/PAGE
sodium dodecyl sulfate/polyacrylamide gel electrophoresis 相似文献
15.
Sequence-specific 1H NMR assignments are presented for a non-selfcomplementary 23-base-pair DNA duplex of molecular weight 15,000 daltons, containing the OR3 repressor binding site of bacteriophage as the central core. The NMR techniques used were mainly phase-sensitive two-dimensional NOE and 2Q spectroscopy, the latter to overcome overlap problems within the spectral region of the deoxyribose spin-systems. Direct sequential NOE connectivities are observed between adenine 2H and deoxyribose 1 protons. We propose the use of these connectivities as a check of the assignments of C1 and A2 protons, which have independently been derived via other assignment pathways.Abbreviation COSY
2-dimensional correlated spectroscopy
- NOESY
2-dimensional nuclear-Overhauser-enhancement spectroscopy
- RELAYED-COSY
2-dimensional relayed coherence transfer spectroscopy
- 2Q
two-quantum
- ppm
parts per million
- 23-bp DNA
d-(ATCTATCACCGCAAGGGATAAAT) · d-(ATTTATCCCTTGCGGTGATAGAT)
- 17-bp DNA (OR3)
d-(TATCACCGCAAGGGATA) · d-(TATCCCTTGCGGTGATA)
- di(X;Y)
intra-residue distance between protons X and Y
- ds(X;Y)
sequential distance between protons X and Y located in sequentially neighbouring nucleotides, where the direction from X to Y is always from 5 to 3 相似文献
16.
Wu H Zhang X Liao P Li Z Li W Li X Wu Y Pei F 《Journal of inorganic biochemistry》2005,99(11):2151-2160
An integrated metabonomic approach based on high-resolution (1)H NMR spectroscopy has been applied to the investigation of the acute biochemical effects caused by Ce(NO(3))(3) in rats. Male Wistar rats were separated into 8 groups and each was treated with one of following compounds, mercury II chloride (HgCl(2)), 2-bromoethanamine hydrobromide (BEA), carbon tetrachloride (CCl(4)), alpha-naphthylisothiocyanate (ANIT), and three doses of Ce(NO(3))(3) (i.p. 2, 10 and 50mg/kg body weight). Urine was collected over a 48-h time course, and serum and tissue samples (liver and kidney) were gained after exposure to Ce(NO(3))(3) for 48 h. Histopathology and plasma clinical chemistry were also performed for all the tissue and plasma samples. Urine and serum samples were analyzed by 600 MHz (1)H NMR spectroscopy. All the (1)H NMR spectra were data-processed and analyzed using principal components analysis or hierarchical clustering analysis to show the time- and dose-dependent biochemical variations induced by Ce(NO(3))(3). Metabolic profiles of urinary (1)H NMR spectra from animals treated with Ce(NO(3))(3) exhibited an increase in trimethylamine N-oxide (TMAO), dimethylamine (DMA), dimethylglycine (DMG), taurine (Tau) and amino acids (valine, leucine and isoleucine), together with a decrease in citrate. The (1)H NMR spectral analysis of serum presented the elevation of acetone, acetoacetate, lactate and creatinine levels. These findings indicated the impairment of fatty acid beta-oxidation in liver mitochondria and renal lesions. This work illustrates the high reliability of NMR-based metabonomic approach on the study of the biochemical effects induced by rare earths. 相似文献
17.
Escherichia coli DNA photolyase, which photorepairs cyclobutane pyrimidine dimers, contains two chromophore cofactors, 1,5-dihydroflavin adenine dinucleotide (FADH2) and 5,10-methenyltetrahydrofolate (MTHF). Previous work has shown that MTHF is the primary photoreceptor which transfers energy to the FADH2 cofactor; the FADH2 singlet excited state then repairs the photodimer by electron transfer. In this study, we have determined the rate constants for these photophysical processes by time-resolved fluorescence and absorption spectroscopy. From time-resolved fluorescence, we find that energy transfer from MTHF to FADH2 and FADH degrees occurs at rates of 4.6 x 10(9) and 3.0 x 10(10) s-1, respectively, and electron transfer from FADH2 to a pyrimidine dimer occurs at a rate of 5.5 x 10(9) s-1. Using F?rster theory for long-range energy transfer and assuming K2 = 2/3, the interchromophore distances were estimated to be 22 A in the case of the MTHF-FADH2 pair and 21 A for the MTHF-FADH degrees pair. Picosecond absorption spectroscopy identified an MTHF single state which decays to yield the first excited singlet state of FADH2. The lifetimes of MTHF and FADH2 singlets and the rates of interchromophore energy transfer, as well as the rate of electron transfer from FADH2 to DNA measured by time-resolved fluorescence, were in excellent agreement with the values obtained by picosecond laser flash photolysis. Similarly, fluorescence or absorption lifetime studies of the folate-depleted enzyme with and without photodimer suggest that FADH2, in its singlet excited state, transfers an electron to the dimer with 89% efficiency. The distance between FADH2 and the photodimer was calculated to be ca. 14 A. 相似文献
18.
Synthetically prepared 3-dehydroecdysone shows by n.m.r. spectroscopy a mixture of two and three components in 2H2O and [2H4]methanol respectively; only 3-dehydroecdysone is indicated in [2H5]pyridine. Although 3-dehydroecdysone is the sole component in [2H5]pyridine, it represents only 62% and 55% in 2H2O and [2H4]methanol respectively. Evidence indicates that the other component in 2H2O is a 3-[2H2]hydrate of 3-dehydroecdysone, and that in [2H4]methanol the other two components are isomeric [2H3]hemiacetals of 3-dehydroecdysone. 相似文献
19.
Nicholas S. Kirkby Lucinda Low Junxi Wu Eileen Miller Jonathan R. Seckl Brian R. Walker David J. Webb Patrick W. F. Hadoke 《Journal of visualized experiments : JoVE》2015,(99)
The generation and analysis of vascular lesions in appropriate animal models is a cornerstone of research into cardiovascular disease, generating important information on the pathogenesis of lesion formation and the action of novel therapies. Use of atherosclerosis-prone mice, surgical methods of lesion induction, and dietary modification has dramatically improved understanding of the mechanisms that contribute to disease development and the potential of new treatments.Classically, analysis of lesions is performed ex vivo using 2-dimensional histological techniques. This article describes application of optical projection tomography (OPT) to 3-dimensional quantitation of arterial lesions. As this technique is non-destructive, it can be used as an adjunct to standard histological and immunohistochemical analyses.Neointimal lesions were induced by wire-insertion or ligation of the mouse femoral artery whilst atherosclerotic lesions were generated by administration of an atherogenic diet to apoE-deficient mice.Lesions were examined using OPT imaging of autofluorescent emission followed by complementary histological and immunohistochemical analysis. OPT clearly distinguished lesions from the underlying vascular wall. Lesion size was calculated in 2-dimensional sections using planimetry, enabling calculation of lesion volume and maximal cross-sectional area. Data generated using OPT were consistent with measurements obtained using histology, confirming the accuracy of the technique and its potential as a complement (rather than alternative) to traditional methods of analysis.This work demonstrates the potential of OPT for imaging atherosclerotic and neointimal lesions. It provides a rapid, much needed ex vivo technique for the routine 3-dimensional quantification of vascular remodelling. 相似文献
20.
Chou KC 《Journal of proteome research》2005,4(5):1657-1660
A 3-dimensional model for a DNA-protein interaction has been developed. The protein component is the 61-residue fragment (res. 11-71) of subunit b of the yeast centromeric DNA binding factor 3, CBF3b. The CBF3b fragments bind to the 17 base pairs (5'-CGGAGGACTGTCCTCCG-3') as a symmetric homodimer, with each folded into three distinct conformations: a compact, zinc-binding domain (res. 11-44); an extended linker (res. 45-57); and an alpha-helical dimerization element (res. 58-71). The DNA fragment in the complex is featured by a relatively straight conformation with only slight deviation from a standard B-structure, and a large part of the major groove not blocked by the protein. The large DNA open area provides the necessary space for the other subunits of CBF3 to bind coordinately with CBF3b, fully consistent with the observation that the cooperation of all four CBF3 components is absolutely required to constitute an activity that specifically interacts with centromere DNA. The model also provides a footing for further considering the possible binding arrangements of the other three subunits, namely CBF3a, CBF3c, and CBF3d. 相似文献