Role of DNA superhelicity in partitioning of the pSC101 plasmid

Previous work has shown that a cis-acting locus (termed par for partitioning) on the pSC101 plasmid accomplishes its stable inheritance in dividing cell populations. We report here that the DNA of pSC101 derivatives lacking the par region shows a decrease in overall superhelical density as compared with DNA of wild-type pSC101. Chemicals and bacterial mutations that reduce negative DNA supercoiling increase the rate of loss of par plasmids and convert normally stable plasmids that have minimal par region deletions into unstable replicons. topA gene mutations, which increase negative DNA supercoiling, reverse the instability of partition-defective plasmids that utilize the pSC101, p15A, F, or oriC replication systems. Our observations show that the extent of negative supercoiling of plasmid DNA has major effects on the plasmid's inheritance and suggest a mechanism by which the pSC101 par region may exert its stabilizing effects.     

Differential sequence dynamics of homopolymeric and alternating AT tracts in a small plasmid DNA

The location of OsO4 bispyridine hyper- and hyporeactivity in a small deletion derivative of plasmid ColE1 (PTC12, 1727 bp) has been determined for approximately 70% of the molecule. Thymine bases in homopolymeric (dA)n.(dT)n tracts (n greater than or equal to 4) were always found to be resistant toward OsO4 modification. DNA supercoiling did not destabilize these tracts. The extent of OsO4 bispyridine reactivity of homopolymeric (dA)n.(dT)n tracts, where n = 3, was found to be dependent on the rate of base unpairing of the sequence immediately 5' and 3' to the tract. Repressed OsO4 reactivity of thymine bases in (dA)3.(dT)3 tracts was observed if immediately both 5' and 3' to the tract were stable DNA sequences composed of GC base pairs and/or a homopolymeric (dA)n.(dT)n tract (n greater than or equal to 4). Homopolymeric tracts of n = 3 not having adjacent sequences with repressed unpairing rates did not show reduced levels of OsO4 bispyridine reactivity. Alternating d(TA)n tracts (n greater than or equal to 2) were found to exhibit hyperreactivity with OsO4. The extent of this hyperreactivity was dependent on the length of the tract and superhelical torsional stress. The distribution and frequency of homopolymeric (dA)n.(dT)n (n greater than or equal to 4) tracts in Escherichia coli promoter sequences were examined, and the possible implications of these tracts on promoter function are discussed.     

The partition locus of plasmid pSC101 is a specific binding site for DNA gyrase.

A protein in extracts of Escherichia coli that specifically binds the stabilizing par sequence of pSC101 was identified as DNA gyrase. The purified enzyme protects par against digestion by DNase I and exonuclease III. Competition assays demonstrate that gyrase has a 40-fold higher affinity for the 100-bp par sequence than for nonspecific DNA and that par is the major gyrase-binding site in pSC101 derivatives used in this and other studies. Within par, AT-rich sequences occur with a pronounced 10-bp periodicity that is shifted by 5 bp from a similar periodicity of GC-rich sequences. As judged by DNase I digestion, the GC sequences are exposed on the outside of the DNA wrapped around gyrase. The data suggest that the site-specificity of DNA gyrase may be partly determined by the bendability of the DNA. A 4-bp deletion that interferes with Par function in vivo also reduces the affinity for gyrase in vitro. However, a deletion of par causes little reduction in superhelical density in vivo. We conclude that DNA gyrase, while involved in the Par function, may not affect plasmid stability through its supercoiling activity or by an influence on DNA replication.     

Isolation and characterization of plasmid mutations that enable partitioning of pSC101 replicons lacking the partition (par) locus.

Second-site mutations that allow stable inheritance of partition-defective pSC101 plasmids mapped to seven distinct sites in the 5' half of the plasmid repA gene. While the mutations also elevated pSC101 copy number, there was no correlation between copy number increase and plasmid stability. Combinations of mutations enabled pSC101 DNA replication in the absence of integration host factor and also stabilized par-deleted plasmids in cells deficient in DNA gyrase or defective in DnaA binding. Our findings suggest that repA mutations compensate for par deletion by enabling the origin region RepA-DNA-DnaA complex to form under suboptimal conditions. They also provide evidence that this complex has a role in partitioning that is separate from its known ability to promote plasmid DNA replication.     

Boundaries of the pSC101 minimal replicon are conditional.

The DNA segment essential for plasmid replication commonly is referred to as the core or minimal replicon. We report here that host and plasmid genes and sites external to the core replicon of plasmid pSC101 determine the boundaries and competence of the replicon and also the efficiency of partitioning. Missense mutations in the plasmid-encoded RepA protein or mutation of the Escherichia coli topoisomerase I gene enable autonomous replication of a 310-bp pSC101 DNA fragment that contains only the actual replication origin plus binding sites for RepA and the host-encoded DnaA protein. However, in the absence of a repA or topA mutation, the DNA-bending protein integration host factor (IHF) and either of two cis-acting elements are required. One of these, the partitioning (par) locus, is known to promote negative DNA supercoiling; our data suggest that the effects of the other element, the inverted repeat (IR) sequences that overlap the repA promoter, are mediated through the IR's ability to bind RepA. The concentrations of RepA and DnaA, which interact with each other and with plasmid DNA in the origin region (T. T. Stenzel, T. MacAllister, and D. Bastia, Genes Dev. 5:1453-1463, 1991), also affect both replication and partitioning. Our results, which indicate that the sequence requirements for replication of pSC101 are conditional rather than absolute, compel reassessment of the definition of a core replicon. Additionally, they provide further evidence that the origin region RepA-DnaA-DNA complex initiating replication of pSC101 also mediates the partitioning of pSC101 plasmids at cell division.     

Partitioning of bacterial plasmids during cell division: a cis-acting locus that accomplishes stable plasmid inheritance

We have identified and characterized a genetic function (designated par, for partition) that is required for stable maintenance of plasmids within exponentially growing cell populations. This function, which accomplishes the active distribution of plasmid DNA molecules to daughter cells, has been localized within the pSC101 plasmid to a 270 bp segment adjacent to the replication origin. The par locus, which appears to be functionally equivalent to the centromere of eucaryotic cells, is able to rescue unstable pSC101-derived replicons or an unrelated par- P15A-derived multicopy replicon in the cis, but not the trans, configuration. It is independent of copy number control and dose not specify plasmid incompatibility. Furthermore, it is not associated directly with plasmid replication functions.     

The partition (par) locus of pSC101 is an enhancer of plasmid incompatibility

The incompatibitity that pSC101-derived plasmids express toward each other is mediated by directly repeated sequences (iterons) located near the plasmid's replication origin. We report here that the pSC101 par locus, which stabilizes plasmid inheritance in dividing cell populations and alters DNA superheliclty, can function as a cis-acting enhancer of incompatibility, which we show is determined jointly by the copy number of the plasmid and the number of iterons per copy. A single synthetic 32 bp iteron sequence carried by the pUC19 plasmid confers strong pSC101-specific incompatibility in the absence of any other pSC101 sites but requires the par locus to express strong incompatibility when carried by a lower-copy-number plasmid. We propose a model by which the par locus can enchance the apparently antagonistic processes of incompatibility and pSC101 DNA replication while concurrently facilitating plasmid distribution during cell division.     

Involvement of integration host factor (IHF) in maintenance of plasmid pSC101 in Escherichia coli: mutations in the topA gene allow pSC101 replication in the absence of IHF.

Integration host factor (IHF), encoded by the himA and himD genes, is a histonelike DNA-binding protein that participates in many cellular functions in Escherichia coli, including the maintenance of plasmid pSC101. We have isolated and characterized a chromosomal mutation that compensates for the absence of IHF and allows the maintenance of wild-type pSC101 in him mutants, but does not restore IHF production. The mutation is recessive and was found to affect the gene topA, which encodes topoisomerase I, a protein that relaxes negatively supercoiled DNA and acts in concert with DNA gyrase to regulate levels of DNA supercoiling. A previously characterized topA mutation, topA10, could also compensate for the absence of IHF to allow pSC101 replication. IHF-compensating mutations affecting topA resulted in a large reduction in topoisomerase I activity, and plasmid DNA isolated from such strains was more negatively supercoiled than DNA from wild-type strains. In addition, our experiments show that both pSC101 and pBR322 plasmid DNAs isolated from him mutants were of lower superhelical density than DNA isolated from Him+ strains. A concurrent gyrB gene mutation, which reduces supercoiling, reversed the ability of topA mutations to compensate for a lack of him gene function. Together, these findings indicate that the topological state of the pSC101 plasmid profoundly influences its ability to be maintained in populations of dividing cells and suggest a model to account for the functional interactions of the him, rep, topA, and gyr gene products in pSC101 maintenance.     

Excess intracellular concentration of the pSC101 RepA protein interferes with both plasmid DNA replication and partitioning.

RepA, a plasmid-encoded gene product required for pSC101 replication in Escherichia coli, is shown here to inhibit the replication of pSC101 in vivo when overproduced 4- to 20-fold in trans. Unlike plasmids whose replication is prevented by mutations in the repA gene, plasmids prevented from replicating by overproduction of the RepA protein were lost rapidly from the cell population instead of being partitioned evenly between daughter cells. Removal of the partition (par) locus increased the inhibitory effect of excess RepA on replication, while host and plasmid mutations that compensate for the absence of par, or overproduction of the E. coli DnaA protein, diminished it. A repA mutation (repA46) that elevates pSC101 copy number almost entirely eliminated the inhibitory effect of RepA at high concentration and stimulated replication when the protein was moderately overproduced. As the RepA protein can exist in both monomer and dimer forms, we suggest that overproduction promotes RepA dimerization, reducing the formation of replication initiation complexes that require the RepA monomer and DnaA; we propose that the repA46 mutation alters the ability of the mutant protein to dimerize. Our discovery that an elevated intracellular concentration of RepA specifically impedes plasmid partitioning implies that the RepA-containing complexes initiating pSC101 DNA replication participate also in the distribution of plasmids at cell division.     

Plasmid pSC101 replication mutants generated by insertion of the transposon Tn1000

A derivative of pSC101, pLC709, was constructed by ligation of the HincII-A fragment of pSC101 to the mini-colEI plasmid pVH51 and to a DNA fragment encoding resistance to the antibiotics streptomycin and spectinomycin. Insertions of the transposon Tn1000 (gamma-delta) into the pSC101 replication region of pLC709 were isolated following cotransfer of the plasmid with the sex factor F. The sites of insertion of the transposon were determined by restriction enzyme analysis and the replication and incompatibility properties of the insertion plasmids and DNA fragments cloned from them were analysed. The insertion mutations defined a locus, inc, of approximately 200 base-pairs that is responsible for pSC101-specific incompatibility. Two mutations adjacent to this region inactivate pSC101 replication but can be complemented in trans by a wild-type pSC101 plasmid, and thus define a trans-acting replication function, rep. The inc locus is within a larger region of some 450 base-pairs that is essential for pSC101 replication and that includes the origin of replication. This 450 base-pair segment can replicate in the presence of a helper plasmid that supplies the rep function in trans.     

Specific-purpose plasmid cloning vectors. I. Low copy number, temperature-sensitive, mobilization-defective pSC101-derived containment vectors

Two cloning vector plasmids, pHSG415 (7100 bp) and a lambda phage cos site-containing derivative (cosmid) thereof, pHSG422 (8760 bp), were constructed from a low copy number plasmid (pSC101) replicon to permit the propagation of cloned DNA segments at low gene dosage levels. Two features of the vectors, namely temperature sensitivity of replication and inability to be mobilized by conjugative plasmids, cause them to exhibit a high level of "biological containment". The essential characteristics of pHSG415 and pHSG422 may be summarized as follows: (1) their genome copy number is low (4--6 copies/chromosome); (2) their replication ceases at high temperature and they are rapidly lost from host cells grown at temperatures of 37 degrees C and above; (3) the relaxation nick site of pSC101, which is thought to be synonymous with its origin of transfer replication, is absent from the vectors; as a consequence, they are not mobilized to a significant extent by co-existing conjugative plasmids that are able to mobilize wild-type pSC101; (4) they contain unique insertion sites for DNA fragments generated by the following restriction endonucleases: EcoRI, XhoI, XmaI, HindIII and PstI; pHSG415 additionally contains single BamHI, BstEII and HincII sites and may also be used to clone PvuI-generated fragments; (5) the plasmids confer upon their host cells resistance to chloramphenicol, kanamycin and ampicillin, and every unique cloning site, except those of BamHI and BstEII, is located within one of these antibiotic-resistance genes.     

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.     

The nucleotide sequence of a DNA fragment from the replication origin of the antibiotic resistance factor R1drd19

Summary The recombinant plasmid pRK101 contains a DNA fragment which carries the complete replication origin of the antibiotic resistance factor R1drd-19 inserted into the vector plasmid pBR322. In a spontaneously arising mutant of this plasmid (pRK 103) a deletion of about 215 base pairs (bp) has been detected by heteroduplex analysis and mapping with restriction endonucleases. Essential parts of the replication origin must be located in the deleted sequence. The deletion mutant pRK103, in contrast to its parent plasmid pRK101 is not replicated under the control of the R1 replicon, even when the R1 factor or copy mutants of it are present within the same cell. These latter plasmids can complement a plasmid-specific protein not coded by pRK101 but essential for R1-directed replication. The nucleotide sequence of a 252 bp HpaII fragment covering about 170–200 bp of the deletion was determined. This piece of DNA is rich in G and C and contains a series of small palindromes, symmetrically arranged repeated sequences and short selfcomplementary structures which may be of significance for the initiation of the DNA replication. The possibility that the sequenced DNA fragment comprises a major part of the replication origin of R1drd-19 is discussed.     

Two enhancer elements for DNA replication of pSC101, par and a palindromic binding sequence of the Rep protein.

The minimal replication origin (ori) of the plasmid pSC101 has been previously defined as an approximately 220-bp region by using plasmids defective in the par region, which is a cis-acting determinant of plasmid stability. This ori region contains the DnaA binding sequence, three repeated sequences (iterons), and an inverted repeat (IR) element (IR-1), one of the binding sites of an initiator protein, Rep (or RepA). In the present study, we show that plasmids containing par can replicate at a nearly normal copy number in the absence of IR-1 but still require a region (the downstream region) between the third iteron and IR-1. Because par is dispensable in plasmids retaining IR-1, par and IR-1 can compensate each other for efficient replication. The region from the DnaA box to the downstream region can support DNA replication at a reduced frequency, and it is designated "core-ori." Addition of either IR-1 or par to core-ori increases the copy number of the plasmid up to a nearly normal level. However, the IR-1 element must be located downstream of the third iteron (or upstream of the rep gene) to enhance replication of the plasmid, while the par region, to which DNA gyrase can bind, functions optimally regardless of its location. Furthermore, the enhancer activity of IR-1 is dependent on the helical phase of the DNA double helix, suggesting that the Rep protein bound to IR-1 stimulates the activation of ori via its interaction with another factor or factors capable of binding to individual loci within ori.     

Transfer of yeast telomeres to linear plasmids by recombination

Three distinct segments (the partition-related, or PR segments) within the 370 bp par region of pSC101 have been shown by deletion analysis to be involved in partitioning of the plasmid to daughter cells. The two lateral segments are direct repeats, each of which potentially can pair with an inverted repeat located between them to form a hairpin-loop structure. Deletion of either lateral segment, together with the middle segment, results in plasmid instability (the Par- phenotype). Deletion of one PR segment yields a stable plasmid that nevertheless shows reduced ability to compete with a coexisting wild-type derivative of the same replicon (the Cmp- phenotype). Deletion of all three segments results in a rate of plasmid loss far in excess of that predicted from the observed copy number of the plasmid. Analysis of the segregation properties of these mutants and of temperature-sensitive and high copy number derivatives of the pSC101 replicon suggests a model in which the par function allows the nonreplicating plasmids of the intracellular pool to be counted as individual molecules, and to be distributed evenly to daughter cells. In the absence of par, the multicopy pool of plasmids behaves as a single segregation unit.     

Interaction of the IciA protein with AT-rich regions in plasmid replication origins.

A set of AT-rich repeats is a common motif in prokaryotic replication origins. We have screened for proteins binding to the AT-rich repeat region in plasmids F, R1 and pSC101 using an electrophoretic mobility shift assay with PCR-amplified DNA fragments from the origins. The IciA protein, which is known to bind to the AT-rich repeat region in the Escherichia coli origin of chromosome replication, oriC, was found to bind to the corresponding region from plasmids F (oriS) and R1, but not to pSC101. DNase I footprint analysis showed that IciA interacted with the AT-rich region in both F and R1. When the IciA gene was deleted, the copy number of plasmid F increased somewhat, whereas there was no major effect on the replication of pSC101 and R1, or on the E. coli chromosome.