Isolation and characterization of Z-DNA binding proteins from wheat germ

The preparation of a heterogeneous non-histone protein extract from wheat germ utilizing Br-poly(dG-dC).poly(dG-dC) (Z-DNA) affinity chromatography is described. The binding characteristics of antibodies against Z-DNA are used as a model system to define important criteria that the DNA binding behavior of a Z-DNA binding protein should display. We show that the wheat germ extract contains DNA binding proteins specific for left-handed Z-DNA by these criteria. The affinity of the proteins measured by competition experiments was approximately 10(5) greater for Br-poly(dG-dC).poly(dG-dC) (Z-DNA) than for poly(dG-dC).poly(dG-dC) (B-DNA). The affinity of the proteins for plasmid DNA increases with increasing negative superhelicity which is known to stabilize Z-DNA. The proteins are shown to compete with Z-DNA antibodies for binding to supercoiled plasmids. Finally, the affinity for two plasmids at a given superhelical density is greater for the plasmid containing an insert known to form Z-DNA than for a plasmid without the insert. The proteins exhibit a 2-3-fold greater affinity for stretches of (dC-dA)n.(dT-dG)n over stretches of (dG-dC)n.(dG-dC)n when both sequences are induced to form Z-DNA by supercoiling.     

Analysis of Z-DNA in fixed polytene chromosomes with monoclonal antibodies that show base sequence-dependent selectivity in reactions with supercoiled plasmids and polynucleotides

Five monoclonal anti-Z-DNA antibodies were characterized with respect to their binding of synthetic nucleic acid polymers and of supercoiled circular plasmid DNA. All of the antibodies reacted only with DNA in the Z-conformation; however, they fell into two classes on the basis of sequence specificity. One class, with broad specificity, reacted well with all sequences in the Z-form, including poly(dG-dC), poly(dG-dm5C), and poly (dG-dBr5C) in linear polymers and poly(dG-dC)n and poly[(dC-dA)n.(dT-dG)n] sequences in supercoiled plasmids. The other class bound only Z-DNA formed by poly(dG-dC). Binding of the monoclonal antibodies specifically to inserts of Z-DNA-forming sequences in plasmids was mapped directly by cross-linking of antibody to the DNA, digestion with restriction nuclease, and electrophoretic analysis of both the unbound fragments and the bound fragments recovered from immune complexes. The monoclonal antibodies were used for indirect immunofluorescence staining of Drosophila polytene chromosomes fixed by two procedures. One procedure yielded chromosomes with Z-specific antibody binding in many interbands, a few specific bands, and parts of some puffs. On chromosomes fixed by the second procedure, antibody staining appeared to follow the DNA concentration, staining all bands brightly. For each fixation procedure, chromosomes showed the same staining pattern with each of the broad specificity monoclonal antibodies that had been seen with polyclonal antibodies. The antibodies that reacted only with poly(dG-dC) and poly (dG-dC)n plasmid inserts did not stain chromosomes fixed by either protocol. We conclude that stretches of poly(dG-dC)n sequences do not contribute significantly to the presence of Z-DNA in fixed polytene chromosomes of Drosophila melanogaster.     

Interactions of Drosophila DNA topoisomerase II with left-handed Z-DNA in supercoiled minicircles.

The native form of Drosophila melanogaster DNA topoisomerase II was purified from Schneider's S3 tissue culture cells and studied with two supercoiled minicircle preparations, mini and mini-CG, 354 bp and 370 bp in length, respectively. Mini-CG contains a d(CG)7 insert which assumes a left-handed Z-DNA conformation in negative supercoiled topoisomers with a negative linking number difference - delta Lk greater than or equal to 2. The interactions of topoisomerase II with topoisomer families of mini and mini-CG were studied by band-shift gel electrophoresis in which the individual topoisomers and their discrete or aggregated protein complexes were resolved. A monoclonal anti-Z-DNA IgG antibody (23B6) bound and aggregated only mini-CG, thereby confirming the presence of Z-DNA. Topoisomerase II bound and relaxed mini-CG more readily than mini. In both cases, there was a preference for more highly negatively supercoiled topoisomers. The topoisomerase II inhibitor VM-26 induced the formation of stable covalent DNA-protein intermediates. In addition, the non-hydrolyzable GTP analogue GTP gamma S inhibited the binding and relaxation activities. Experiments to detect topoisomerase cleavage sites failed to elicit specific loci on either minicircle preparation. We conclude that Drosophila topoisomerase II is able to bind and process small minicircles with lengths as short as 360 bp and negative superhelix densities, - sigma, which can exceed 0.1. Furthermore, the enzyme has a preferential affinity for topoisomers containing Z-DNA segments and relaxes these molecules, presumably by cleavage external to the inserts. Thus, a potentially functional relationship between topoisomerase II, an enzyme regulating the topological state of DNA-chromatin in vivo, and left-handed Z-DNA, a conformation stabilized by negative supercoiling, has been established.     

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.     

Reduced 4,5',8-trimethylpsoralen cross-linking of left-handed Z-DNA stabilized by DNA supercoiling

Z-DNA-forming sequences, (GT)21, (GT)12ATGT, and (CG)6TA(CG)6, were cloned into plasmids. These sequences formed left-handed Z-DNA conformations under torsional tension from negative supercoiling of DNA. 4,5',8-Trimethylpsoralen, on absorption of 360-nm light, forms monoadducts and interstrand cross-links in DNA that exists in the B-helical conformation. Trimethylpsoralen cross-links were introduced into the potential Z-DNA-forming sequences in relaxed DNA when these sequences existed as B-form DNA. In supercoiled DNA when these sequences existed in the Z conformation, the rate of cross-linking was greatly reduced, and trimethylpsoralen did not form monoadducts appreciably to Z-DNA. As an internal control in these experiments, the rates of cross-linking of the Z-DNA-forming sequences were measured relative to that of an adjacent, cloned sequence that could not adopt a Z conformation. The initial relative rates of cross-linking to Z-DNA-forming sequences were dependent on the superhelical density of the DNA, and the rates were ultimately reduced by factors of 10-15 for Z-DNA in highly supercoiled plasmids. This differential rate of cross-linking provides a novel assay for Z-DNA. Initial application of this assay in vivo suggests that a substantial fraction of (CG)6TA(CG)6, which existed as Z-DNA in plasmid molecules purified from cells, existed in the B conformation in vivo.     

Cloned complementary deoxyribonucleic acid of Drosophila cells. Relationship of genome copy number to messenger ribonucleic acid abundance

Recombinant DNA plasmids containing DNA sequence complementary to poly(adenylic acid) [(poly(A)] containing RNA from the cytoplasm of Drosophila Kc tissue culture cells were constructed. The reiteration frequency in the genome of the RNA homologous to the 20 randomly selected clones was determined by two rapid methods. Of the 20, 17 were determined to be single copy, 2 were repeated several (2-4) times, and 1 was repeated approximately 10 times. The steady-state level of mRNAs homologous to the 20 cDNAs was quantitated and varied more than 160-fold. The RNAs ranged from 0.16% to less than 0.001% of the poly(A)-containing RNA.     

The inhibition of restriction endonucleases due to Z-DNA in negatively supercoiled plasmid.

Plasmid pGC20 containing the (dGC)9 insert in SmaI recognition site has been used to study the inhibition of cleavage by different restriction endonuclease due to Z-DNA formation in (dCG)10 sequence of the negatively supercoiled plasmid. Data obtained indicate the different sensitivity of restriction endonucleases to DNA conformational perturbations resulted from the Z-DNA formation. Therefore, the inhibition of DNA cleavage by a particular restriction endonuclease cannot serve as a criterion for the estimation of the length of B-Z junctions in circular supercoiled DNAs.     

Physical and functional mapping of two cointegrate plasmids derived from RP4 and TOL plasmid pDK1

Cointegrate plasmids were formed in vivo between the broad-host-range R-plasmid RP4 and two catabolic plasmids derived from Pseudomonas putida HS1. One of these was the wild-type plasmid pDK1 encoding the complete inducible toluene/xylene (TOL) catabolic pathway and one was pDKT1, a deletion derivative of pDK1 selected after growth of HS1 on benzoate and supporting growth on only toluene. The two plasmids formed, pDK2 and pDKT2 respectively, each consisted of a complete RP4 replicon in which was an insert of the parent plasmid DNA respectively 40 and 20 kbp in size. The detailed restriction maps of the two plasmids were determined and many of the catabolic genes were located by subcloning and enzyme assay of recombinant plasmids in Escherichia coli and Pseudomonas hosts. The insert in pDK2 contained both operons of the catabolic pathway, the 'upper pathway' operon (xylCAB) and the meta pathway operon (xylDLEGF(I,J,K)H), and a region identified as having the function of the regulator gene xylS. The insert in pDKT2 contained only the upper pathway operon and the regulatory region. Within each of the three coding regions there was great similarity with the same regions on TOL plasmids pWW0 and pWW53-4 apparent (a) by the same order of the genes, (b) by a similar pattern of restriction sites and (c) by hybridization studies. However, the order and orientations of the three coding regions differed from those previously described for both pWW0 and pWW53-4. The significance of these findings to the evolution of TOL plasmids is discussed.     

The 5S genes of Drosophila melanogaster.

We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster.     

Immunofluorescence localization of Z-DNA in chromosomes: quantitation by scanning microphotometry and computer-assisted image analysis

Anti-Z-DNA polyclonal and monoclonal immunoglobulins raised against left-handed polynucleotides show various degrees of specificity for base sequence and substitution. Class 1 IgGs recognize all Z-DNA with equal affinity; class 2 IgGs show a preference for d(G-C)n sequences and class 3 IgGs for d(G-C)n sequences with substitutions at the C5 position of the pyrimidine. These antibodies served as probes for the localization of Z-DNA in polytene and metaphase chromosomes and in interphase chromatin by indirect immunofluorescence. A quantitative assessment of the binding of anti-Z-DNA IgGs to polytene chromosomes of Chironomus and Drosophila was made by scanning microphotometry and by computer-assisted image analysis of double immunofluorescence and DNA-specific dye fluorescence images. The three classes of antibodies bind to most of the bands in acid fixed polytene chromosomes of C. thummi; however, preferential binding of one class of antibody over another can be observed in certain regions. These differences can be quantitated by arithmetic division or subtraction of the normalized digital images. If a class 2 antibody is first bound at saturating concentrations the binding of class 1 antibody is reduced throughout most bands by 40-50%. However, the telomeres of the three large chromosomes bind greater than 10 times as much class 1 antibody as class 2 antibody, indicating that the Z-DNA tracts in these regions are comprised largely of alternating sequences containing the A X T basepair, e.g., A-C. High-resolution image analysis of class 1 and class 2 immunofluorescence patterns and the total DNA distribution from polytene chromosomes of D. melanogaster show that the two antibody distributions are very similar in a large majority of the bands, but they often deviate from the mean DNA distribution profile. Z-DNA sequences of both G-C and A-C type are detectable at all levels of ploidy from 2n to 2(13)n and in species as diverse as insects and man. We conclude that the vast majority of polytene chromosome bands (genes) contain one or a few DNA sequences with potential for undergoing the B----Z transition and contain both alternating purine-pyrimidine G-C and A-C tracts or mixed sequences. Highly heterochromatic bands and telomeres have more Z potential sequences than do other bands.     

Tetracycline promoter mutations decrease non-B DNA structural transitions, negative linking differences and deletions in recombinant plasmids in Escherichia coli

The ability to clone a variety of sequences with varying capabilities of adopting non-B structures (left-handed Z-DNA, cruciforms or triplexes) into three loci of pBR322 was investigated. In general, the inserts were stable (non-deleted) in the EcoRI site (an untranslated region) of pBR322. However, sequences most likely to adopt left-handed Z-DNA or triplexes in vivo suffered deletions when cloned into the BamHI site, which is located in the tetracycline resistance structural gene (tet). Conversely, when the promoter for the tet gene was altered by filling-in the unique HindIII or ClaI sites, the inserts in the BamHI site were not deleted. Concomitantly, the negative linking differences of the plasmids were reduced. Also, inserts with a high potential to adopt Z-DNA conformations were substantially deleted in the PvuII site of pBR322 (near the replication origin and the copy number control region), but were less deleted if the tet promoter was insertion-mutated. The deletion phenomena are due to the capacity of these sequences to adopt left-handed Z-DNA or triplexes in vivo since shorter inserts, less prone to form non-B DNA structures, or random sequences, did not exhibit this behavior. Sequences with the potential to adopt cruciforms were stable in all sites under all conditions. These results reveal a complex interrelationship between insert deletions (apparently the result of genetic recombination), negative supercoiling, and the formation of non-B DNA structures in living Escherichia coli cells.     

The sequence arrangement of Drosophila melanogaster 5s DNA cloned in recombinant plasmids.

Segments of Drosophila melanogaster DNA containing 5S rRNA genes have been propagated in recombinant plasmids using E. coli as a host and Col E1 as a vector. Electron microscope partial denaturation mapping, mapping by ferritin labeling and restriction enzyme-gel electrophoresis analysis all indicate that the Drosophila DNA inserts of these plasmids consist of tandem repeats of 5S genes and spacer regions. The repeat length is approximately 380 nucleotide pairs (ntp), corresponding to a gene of length 120 ntp and a spacer of length 260 ntp. The insert in one plasmid (pCIT9) consists of 32 contiguous repeats. Restriction enzyme-gel electrophoresis analysis shows that all these repeats have the same length within ± 5 nucleotides. This repeat length is estimated as 370 ± 20 ntp by gel electrophoresis and 390 ± 40 ntp by partial denaturation mapping. A second plasmid (pCIT19) contains three complete genes, two complete spacers and incomplete flanking spacer sequences. The two complete repeat units released by suitable restriction endonuclease digestions differ in length by 20 ± 5 ntp, with estimated lengths of 370 and 390 ntp. The positions and spacings of the genes on this plasmid have been observed directly by ferritin labeling and by partial denaturation mapping. The A+T content of the 5S DNA spacer region is calculated to be 68%. By in situ hybridization, cRNA transcribed from one plasmid hybridizes to polytene chromosomes only at band 56F, the known locus of the 5S rRNA genes. Spontaneous excision of some of the tandem repeat units from the recombinant plasmids occurs during growth in E. coli; the frequency of excision does not depend upon the recA character of the host, but is greatly increased by chloramphenicol treatment.     

Left-handed Z-DNA binding by the recA protein of Escherichia coli

recA binding to left-handed Z-DNA was measured using nitrocellulose filter binding assays with four DNA polymers with defined nucleotide sequences and four recombinant plasmids. Two to 7-fold preferential binding of recA to Z-DNA polymers was observed. Left-handed Z-DNA polymer binding by recA required ATP or its nonhydrolyzable analog, ATP(gamma S), while ADP inhibited binding. Complex formation with both B- and Z-forms was influenced by polymer length; recA bound longer DNAs better. recA binding to recombinant plasmids containing supercoil-stabilized Z-DNA was essentially similar to that found for the control vector; thus, no preferential binding of recA to the Z-form was observed. Comparative experiments with the rec1 protein of Ustilago maydis and the Escherichia coli recA protein were performed. In our hands, recA and rec1 have a similar capacity for binding left-handed Z-DNA polymers and for binding recombinant plasmids containing B- and/or Z-regions. recA contains a left-handed Z-DNA-stimulated ATPase activity. This activity differs from the right-handed B-DNA-stimulated activity since it is less sensitive to increasing pH. The kinetics of ATP hydrolysis in B-DNA/Z-DNA mixing experiments showed that the turnover of the Z-DNA recA complex was slower than for B-DNA suggesting that left-handed Z-DNA is more stably bound by recA. Our results are consistent with the postulate that left-handed Z-DNA is involved in genetic recombination.     

Cytosine methylation as an effector of right-handed to left-handed DNA structural transitions

Cytosine methylation has energetic and structural influences on left-handed Z-DNA formation in supercoiled plasmids. The restriction and modification enzymes from Haemophilus haemolyticus (HhaI and M.HhaI) provide a system to locate and analyze small segments of Z-DNA in large supercoiled plasmids. An approach is outlined that uses M.HhaI as an in vivo conformational probe for the detection of unusual DNA structures in a living cell. Also, characteristic features of the M.HhaI gene and protein are discussed.     

OspA, a lipoprotein antigen of the obligate intracellular bacterial pathogen Piscirickettsia salmonis

No effective recombinant vaccines are currently available for any rickettsial diseases. In this regard the first non-ribosomal DNA sequences from the obligate intracellular pathogen Piscirickettsia salmonis are presented. Genomic DNA isolated from Percoll density gradient purified P. salmonis, was used to construct an expression library in lambda ZAP II. In the absence of preexisting DNA sequence, rabbit polyclonal antiserum raised against P. salmonis, with a bias toward P. salmonis surface antigens, was used to identify immunoreactive clones. Catabolite repression of the lac promoter was required to obtain a stable clone of a 4,983 bp insert in Escherichia coli due to insert toxicity exerted by the accompanying radA open reading frame (ORF). DNA sequence analysis of the insert revealed 1 partial and 4 intact predicted ORF's. A 486 bp ORF, ospA, encoded a 17 kDa antigenic outer surface protein (OspA) with 62% amino acid sequence homology to the genus common 17 kDa outer membrane lipoprotein of Rickettsia prowazekii, previously thought confined to members of the genus Rickettsia. Palmitate incorporation demonstrated that OspA is posttranslationally lipidated in E. coli, albeit poorly expressed as a lipoprotein even after replacement of the signal sequence with the signal sequence from lpp (Braun lipoprotein) or the rickettsial 17 kDa homologue. To enhance expression, ospA was optimized for codon usage in E. coli by PCR synthesis. Expression of ospA was ultimately improved (approximately 13% of total protein) with a truncated variant lacking a signal sequence. High level expression (approximately 42% tot. prot.) was attained as an N-terminal fusion protein with the fusion product recovered as inclusion bodies in E. coli BL21. Expression of OspA in P. salmonis was confirmed by immunoblot analysis using polyclonal antibodies generated against a synthetic peptide of OspA (110-129) and a strong antibody response against OspA was detected in convalescent sera from coho salmon (Oncorhynchus kisutch).