Effects of 5-azacytidine on nucleolar RNA and the preribosomal particles in Novikoff hepatoma cells.

Examination of nucleolar RNA from cultured Novikoff hepatoma cells treated for 3 hr with 5 x 10-4 M 5-azacytidine shows that significant amounts of analog-substituted 45S RNA are processed to the 32S RNA species, but 28S RNA formation is completely inhibited. Under these conditions of analog treatment 37% of the cytidine residues in the 45S RNA is replaced by 5-azacytidine. During coelectrophoresis of nucleolar RNA from 5-azacytidine-treated and control cells, the analog-substituted 45S RNA and 32S RNA display reduced mobilities compared to the control 45S RNA and 32S RNA. Coelectrophoresis of analog-substituted and control RNA after formaldehyde denaturation shows no differences in electrophoretic mobility between the two RNA samples, suggesting that 5-azacytidine incorporation may alter the secondary structure of the 45S RNA and the 32S RNA. 5-Azacytidine at 5 x 10-4 M severely inhibits protein synthesis in Novikoff cells by 3 hr. After this length of treatment, however, CsCl buoyant density analysis reveals no difference in density of either the 80S or 55S preribosomal ribonucleoprotein particles when compared to normal particles. Also 5-azacytidine treatment does not appear to cause major changes in the polyacrylamide gel electrophoresis patterns of the proteins in the 80S and 55S preribosomal particles. These results together with previous findings suggest that 5-azacytidine's inhibition of rRNA processing is possibly related to its alteration of the structure of the ribosomal precursor RNAs and is not a consequence of a general inhibition of ribosomal protein formation.     

The sequence of the 5' end of the U8 small nucleolar RNA is critical for 5.8S and 28S rRNA maturation.

Ribosome biogenesis in eucaryotes involves many small nucleolar ribonucleoprotein particles (snoRNP), a few of which are essential for processing pre-rRNA. Previously, U8 snoRNA was shown to play a critical role in pre-rRNA processing, being essential for accumulation of mature 28S and 5.8S rRNAs. Here, evidence which identifies a functional site of interaction on the U8 RNA is presented. RNAs with mutations, insertions, or deletions within the 5'-most 15 nucleotides of U8 do not function in pre-rRNA processing. In vivo competitions in Xenopus oocytes with 2'O-methyl oligoribonucleotides have confirmed this region as a functional site of a base-pairing interaction. Cross-species hybrid molecules of U8 RNA show that this region of the U8 snoRNP is necessary for processing of pre-rRNA but not sufficient to direct efficient cleavage of the pre-rRNA substrate; the structure or proteins comprising, or recruited by, the U8 snoRNP modulate the efficiency of cleavage. Intriguingly, these 15 nucleotides have the potential to base pair with the 5' end of 28S rRNA in a region where, in the mature ribosome, the 5' end of 28S interacts with the 3' end of 5.8S. The 28S-5.8S interaction is evolutionarily conserved and critical for pre-rRNA processing in Xenopus laevis. Taken together these data strongly suggest that the 5' end of U8 RNA has the potential to bind pre-rRNA and in so doing, may regulate or alter the pre-rRNA folding pathway. The rest of the U8 particle may then facilitate cleavage or recruitment of other factors which are essential for pre-rRNA processing.     

Nucleotide sequence and structure of cytoplasmic 5S RNA and 5.8S RNA of Chlamydomonas reinhardii.

Three small RNAs of the cytoplasmic 8OS ribosomes of the green unicellular alga Chlamydomonas reinhardii have been sequenced. They include two species of ribosomal 5S RNA, a major and a minor one of 122 and 121 nucleotides respectively, which differ from each other by 17 bases, and also the ribosomal 5.8S RNA of 156 nucleotides. Novel structural features can be recognized in the 5S RNAs of C. reinhardii by a comparison with published 5S RNA sequences. In addition the secondary structure of these small RNA molecules has been examined using a newly developed method based on differential nuclease susceptibility.     

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.     

Structural organization of ribosomal RNAs from Novikoff hepatoma. II. Characterization of possible binding sites of 5 S rRNA and 5.8 S rRNA to 28 S rRNA

Interrelationships among 5 S, 5.8 S, and 28 S rRNA were probed by methods employed in the accompanying report (Choi, Y. C. (1985) J. Biol. Chem. 260, 12769-12772). Two complexes were isolated from 20 S ribonucleoprotein (RNP) fraction and 60 S subunit. The 20 S RNP fraction was found to contain the 3'-340 nucleotide fragment (domain VII) in association with 5 S rRNA. The 60 S subunit contained a stable complex consisting of the 5'-upstream portion (4220-4462, domain VI and VII), the 3'-downstream portion (4463-4802, domain VII) of 3'-583 nucleotides fragment, and 5.8 S rRNA. By computer analysis and hybridization, the 5'-upstream portion was found to contain the 5.8 S rRNA contact site. By affinity chromatography, the 3'-downstream portion was found to contain the 5 S rRNA association site. Furthermore, by comparison with the secondary structure of 28 S rRNA proposed by Hadjiolov et al. (Hadjiolov, A. A., Georgiev, O. I., Nosikov, V. V., and Yavachev, L. P. (1984) Nucleic Acids Res. 12, 3677-3693), it was found that domain VII is capable of binding 5.8 S rRNA and 5 S rRNA juxtaposed to each other. Accordingly, a model was proposed to indicate that a possible contact site for 5.8 S rRNA is within the region surrounding the alpha-sarcin site (4333-4350) and is a possible association site of 5 S rRNA within the 3'-downstream portion (4463-4802) of the 3'-583 nucleotide fragment (4220-4802).     

The nucleotide sequence of the 5S RNA of chicken embryo fibroblasts.

The nucleotide sequence of uniformly 32P-labelled chicken 5S RNA has been determined by analysing the end-products of T1 and pancreatic ribonuclease digestion. These oligonucleotides can be aligned by homology with the human sequence to give a sequence differing in only seven positions from that of Man. The sequence deduced here differs in two position from that previously published for chicken 5S RNA.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

The nucleotide sequence of 5S ribosomal RNA from Schizosaccharomyces pombe

The nucleotide sequence of 5S rRNA from the fission yeast, S. pombe, has been established by post labeling procedures combined with cataloging RNase T1- and A-oligonucleotides derived from unlabeled 5S rRNA. The sequence consists of 119 nucleotides without a modified base and shows more dissimilarities (at 38 positions) from that of S. cerevisiae than from that of humans (at 33 positions).     

Nucleotide sequence study of mouse 5.8S ribosomal RNA.

The primary structure of 5.8S mouse ribosomal RNA has been studied and compared to the structures previously established for other animal species. The results obtained show that mouse 5.8S ribosomal RNA yields pancreatic oligonucleotides with the same nucleotide sequence as the homologous oligonucleotides from rat cells. Furthermore T1 oligonucleotides of 5.8S ribosomal RNA from rat, mouse and human cells behave identically on fingerprinting fractionation and have the same composition as judged by pancreatic digestion. These results strongly suggest that the primary structures of 5.8S ribosomal RNA from rat, mouse and human cells are identical. This identity of structure is also found when the presence of several modified bases (psi and methylated bases) is considered. The findings emphasize the remarkable evolutionary stability of ribosomal gene structure. Comparison of the terminal regional of 5.8S RNA with those of 18S RNA reveals differences which imply a more complex mechanism underlying the maturation of 45S precursor RNA than the finding of identical structure would have suggested.     

The nucleotide sequence of the 5S ribosomal RNA from a photobacterium

Comparative sequencing studies provide powerful insights into molecular function and evolution. The sequence for 5S ribosomal RNA from Photobacter strain 8265 is eighteen base replacements removed from that of Escherichia coli. Of these, the vast majority involve a G or C becoming an A or U. These variations also define unequivocally a hexanucleotide base paired region, which appears to be a universal feature of the 5S RNA molecule. The base composition of this helix seems to be under rather stringent, and so unusual, energetic constraints. The possible implications of this are discussed - in particular the prospect of a 5S RNA molecule that undergoes conformational transitions as a part of the overall state changes that constitute the function of the ribosome.