High-performance liquid chromatographic analysis of physiological amino acids in human brain tumors by pre-column derivatization with phenylisothiocyanate

A reversed-phase high-performance liquid chromatographic technique for the determination of free amino acids in five biopsies of human brain tumors (two meningiomas, one glioblastoma and two oligodendrogliomas) is described. The frozen tissues were homogenized, deproteinized with perchloric acid and neutralized with potassium hydroxide. Aliquots of the supernatant containing the physiological amino acids are used for pre-column derivatization with phenylisothiocyanate. The derivatized PTC-amino acids (phenylthiocarbamyl derivatives) are stable for a five day period if stored as a powder at −20°C in an inert atmosphere and they can be analyzed on a reversed-phase column (PicoTag) using a gradient of two eluents with absorption detection at a wavelength of 254 nm. Good resolution of several amino acids (>30) is achieved within ca. 60 min. For most amino acids this method is suitable for an accurate measurement over a wide range of physiological concentrations (50–400 pmol) starting from a very small amount of sample.     

Presence of the epsilon-(gamma-glutamic)lysine crosslink in cellular proteins.

The epsilon-(gamma-glutamic)lysine bond is a covalent interaction which has been found to crosslink polypeptide chains of a number of extracellular proteins. Among known covalent bonds crosslinking protein chains, it is unique in that it is formed directly by enzymatic catalysis, a property which may also endow Glu-Lys crosslink formation with important intracellular functions. We found glutamic-lysine bonds to be present in the procaryote, Escherichia coli, in primitive eucaryotes such as the slime mold, Physarum polycephalum, and the ciliate, Paramecium aurelia, and in muscle cells of a bird and a mammal. Our data show that, although Glu-Lys bonds occur in low concentrations in cellular proteins, they are nevertheless widely distributed. Evidence is also presented indicating that the low levels of the Glu-Lys bonds we measure in the proteins of various cells types are not artifacts of our analytical procedures.     

High-performance liquid chromatographic determination of N-epsilon-(2-propenal)lysine in biological samples after derivatization with diethylethoxymethylenemalonate.

A recently reported methodology for amino acid analysis by HPLC has been adapted for quantification of N-epsilon-(2-propenal)lysine (a modified lysine by reaction with malondialdehyde that has been found in enzymatic digests of foods and in urine) in biological samples. We describe its use for investigating the in vitro degradation of N-epsilon-(2-propenal)lysine using rat tissue homogenates. Lysine dipeptide, used as a control in the incubation mixtures, and the lysine released by the hydrolytic action of the homogenates in the in vitro incubations are quantified in the same way. The samples are subjected to a cleanup prederivatization step using PD-10 disposable columns (Pharmacia). This allows precolumn derivatization with diethylethoxymethylenemalonate (50 min, 50 degrees C) and resolution of the derivatives of the compounds of interest by reversed-phase HPLC (binary gradient, 45 min) with quantification based on the uv absorption of the derivatives at 280 nm (detection limits below 1 pmol). The entire analysis takes 110 min. This method can be of general use for the determination of N-epsilon-(2-propenal)lysine in the context of research dealing with protein deterioration by reaction with malondialdehyde in biological systems and in foods. A method for the synthesis of N-epsilon-(2-propenal)lysine, used as external standard for the HPLC analysis, is described.     

Calcium induction of transglutaminase and the formation of epsilon(gamma-glutamyl) lysine cross-links in cultured mouse epidermal cells

A lysine tRNA (anticodon U¹UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm¹Am²GCUUAGAGCm²GUUAACCU$\text{U}{}^1\text{UU}$-t⁶AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCA_OH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U¹27 (probably 5-methoxycarbonylmethyluridine) and t⁶A30 (N-[N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U¹ in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t⁶A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon.     

High-performance liquid chromatographic separation of acylcarnitines following derivatization with 4'-bromophenacyl trifluoromethanesulfonate

A high-performance liquid chromatographic method for the separation of acylcarnitines after derivatization with 4'-bromophenacyl trifluoromethanesulfonate is presented. Derivatization of acylcarnitines was achieved at room temperature within 10 min. Separation of the acylcarnitine 4'-bromophenacyl esters was accomplished by high-performance liquid chromatography using as the analytical column a Resolve-PAK 5-microns C18 radially compressed cartridge eluted with a tertiary gradient containing varying proportions of water, acetonitrile, tetrahydrofuran, triethylamine, potassium phosphate, and phosphoric acid. Acylcarnitine 4'-bromophenacyl esters were detected spectrophotometrically at 254 nm. Baseline separation was obtained for a standard mixture (5 nmol of each injected) containing carnitine, acetyl-, propionyl-, butyryl-, valeryl-, hexanoyl-, heptanoyl-, octanoyl-, nonanoyl-, decanoyl-, lauroyl-, myristroyl-, palmitoyl-, and stearoylcarnitine. Nearly complete separation was obtained for a standard mixture containing butyryl-, isobutyryl-, isovaleryl-, and 2-methylbutyrylcarnitine. The method was applied to a normal human urine and then to this same urine spiked with the acylcarnitine standards. Urinary acylcarnitine profiles from patients having propionic acidemia, isovaleric acidemia, and medium-chain acyl-CoA dehydrogenase deficiency were performed. Urinary isovalerylcarnitine was quantified in the patient with isovaleric acidemia using heptanoylcarnitine as an internal standard.     

N epsilon(gamma-glutamyl)lysine crosslinks in the blood clot of the horseshoe crab, Limulus polyphemus.

Clots were allowed to form in samples of whole blood taken from the American horseshoe crab, Limulus polyphemus, in the absence and presence of dansylcadaverine (16), and were analyzed for their contents of N epsilon(gamma-glutamyl)lysine and gamma-glutamyl-dansylcadaverine. Clots obtained without dansylcadaverine yielded significant amounts of N epsilon(gamma-glutamyl)lysine product. Clots formed in the presence of dansylcadaverine yielded only gamma-glutamyl-dansylcadaverine. Formation of these products reflects on the activity of transglutaminase released from the blood cells during coagulation.     

Semi-automatic liquid chromatographic analysis of olpadronate in urine and serum using derivatization with (9-fluorenylmethyl)chloroformate

The semi-automatic bioanalytical assays for olpadronate [(3-dimethylamino-1-hydroxypropylidene)bisphosphonate] involves a protein precipitation with trichloroacetic acid and a double co-precipitation with calcium phosphate for serum samples and a triple calcium co-precipitation for urine samples. These manual procedures are followed by an automated solid-phase extraction on a cation-exchange phase. The procedure is continued either directly, at high olpadronate levels in urine, or after off-line evaporation under nitrogen and reconstitution in water on the same robotic workstation. The continued automatic procedure comprehends derivatization with (9-fluorenylmethyl)chloroformate, ion-pair liquid–liquid extraction and ion-pair HPLC with fluorescence detection at 274/307 nm. The intra- and inter-day precisions for urine and serum samples are typically in the 5–8% range for different olpadronate concentrations [levels near the lower limit of quantification (LLQ) excluded]. The LLQ is 5 ng/ml olpadronate for a 2.5-ml urine sample and 10 ng/ml for a 1-ml serum sample, respectively.     

Reverse phase high-pressure liquid chromatographic separation of retinoids,including retinylphosphate and mannosylretinylphosphate

Reverse phase hplc was used to separate retinylphosphate mannosylretinylphosphate from other retinoids. These phosphorylated retinoids constituted 12 and 42% of the extracted radioactivity in OEL mouse intestine at 3 and 24 h respectively after the intubation of [1-³H]retinol. A detailed procedure for the chemical synthesis of retinylphosphate is described.     

Aging Increases N epsilon -(Carboxymethyl)lysine and Caloric Restriction Decreases N epsilon -(Carboxyethyl)lysine and N epsilon -(Malondialdehyde)lysine in Rat Heart Mitochondrial Proteins

The present investigation studies the effect of aging, short-term and long-term caloric restriction on four different markers of oxidative, glycoxidative or lipoxidative damage to heart mitochondrial proteins: protein carbonyls (measured by ELISA); N epsilon -(carboxyethyl)lysine (CEL), N epsilon -(carboxymethyl)lysine (CML), and N epsilon -(malondialdehyde)lysine (MDA-lys) measured by gas chromatography/mass spectrometry. Aging increased the steady state level of CML in rat heart mitochondria without changing the levels of the other three markers of protein damage. Short-term caloric restriction (six weeks) did not change any of the parameters measured. However, long-term (one year) caloric restriction decreased CEL and MDA-lys in heart mitochondria and did not change protein carbonyls and CML levels. The decrease in MDA-lys was not due to changes in the sensitivity of mitochondrial lipids to peroxidation since the measurements of the fatty acid composition showed that the total number of fatty acid double bonds was not changed by caloric restriction. The decrease in CEL and MDA-lys in caloric restriction agrees with the previously and consistently described finding that caloric restriction agrees with the previously and consistently described finding that caloric restriction lowers the rate of generation of reactive oxygen species (ROS) in rodent heart mitochondria, although in the case of CEL a caloric restriction-induced lowering of glycaemia can also be involved. The CEL and MDA-lys results support the notion that caloric restriction decreases oxidative stress-derived damage to heart mitochondrial proteins.     

Conversion of lysine to N(epsilon)-(carboxymethyl)lysine increases susceptibility of proteins to metal-catalyzed oxidation.

Metal-catalyzed oxidation (MCO) of proteins leads to the conversion of some amino acid residues to carbonyl derivatives, and may result in loss of protein function. It is well documented that reactions with oxidation products of sugars, lipids, and amino acids can lead to the conversion of some lysine residues of proteins to N(epsilon)-(carboxymethyl)lysine (CML) derivatives, and that this increases their metal binding capacity. Because post-translational modifications that enhance their metal binding capacity should also increase their susceptibility to MCO, we have investigated the effect of lysine carboxymethylation on the oxidation of bovine serum albumin (BSA) by the Fe(3+)/ascorbate system. Introduction of approximately 10 or more mol CML/mol BSA led to increased formation of carbonyls and of the specific oxidation products glutamic and adipic semialdehydes. These results support the view that the generation of CML derivatives on proteins may contribute to the oxidative damage that is associated with aging and a number of age-related diseases.     

Degradation of cells dying by apoptosis leads to accumulation of epsilon(gamma-glutamyl)lysine isodipeptide in culture fluid and blood.

epsilon(gamma-Glutamyl)lysine isodipeptide, the end-product of proteolytic digestion of proteins cross-linked by transglutaminase, was detected in culture fluid of neonatal rat hepatocytes and plasma of adult rats. The concentration of the isodipeptide was significantly increased in both when high rate of apoptosis with phagocytosis of dying hepatocytes was produced either by epidermal growth factor in the culture or by lead nitrate-induced hyperplasia with subsequent involution in rats. Specific induction of tissue transglutaminase and the consequent formation of highly cross-linked protein envelopes in apoptotic cells have been previously demonstrated by us in both systems.     

High-performance liquid chromatographic determination of vertilmicin in rat plasma using sensitive fluorometric derivatization

A sensitive and reliable high-performance liquid chromatographic method was developed for the determination of vertilmicin in rat plasma. Derivatization with 9-fluorenylmethyl chloroformate (FMOC-Cl) followed by C(18) reversed-phase chromatography allowed the fluorimetric detection of vertilmicin. Optimal conditions for the derivatization of vertilmicin are described. The limit of quantification was 0.02 mg/L. The pharmacokinetics of vertilmicin was studied in 24 rats following intramuscular injection (i.m.) of different doses (4, 8, 16, 32 mg/kg of body weight). The pharmacokinetic parameter values were estimated by use of 3P97 program. In this study, we assessed the dose proportionality of vertilmicin after single intramuscular injection doses and obtained new information on the pharmacokinetics of the compound.     

Preparative high-performance liquid chromatographic separation of proteins with HyperD ion-exchange supports

HyperD ion-exchange media combine the mechanical strength of a rigid polystyrene-mineral composite skeleton with the high protein-binding capacity of a three-dimensional soft gel located inside the skeleton. The skeleton solid matrix is completely filled with functionalized, highly hydrophilic, chemically stable ion-exchange hydrogels. These materials gave very efficient columns for protein separation with superior dynamic capacity, high resolving power and excellent protein recovery. Various protein mixtures were used to study the chromatographic performance of these new stationary phases. Comparisons between different particle size packing materials demonstrated the potential of this ion-exchange material for use on a large scale.     

Increased epsilon(gamma-glutamyl)lysine crosslinking associated with increased protein synthesis in the inner layers of healing rat skin wounds.

Three days after biopsy wounds were made in the dorsal skin of rats the animals were killed and explants of wounded and unwounded skin were incubated for 7 h with either [3H]glutamine or [3H]lysine. Both incubated and fresh control explants were then dissected into three layers which were homogenized, extracted, digested and then assayed for epsilon (gamma-glutamyl)lysine. The concentration of epsilon(gamma-glutamyl)lysine was greater in all three wounded layers than in the corresponding unwounded layers. The concentration in the wounded middle (dermal) layer and in the unwounded middle layer of younger rats was greater than in the unwounded outer (keratinized) layer, which has previously been shown to contain epsilon(gamma-glutamyl)lysine crosslinks. The incorporation of label from both [3H]glutamine and [3H]lysine into buffer-insoluble protein of the middle and inner (muscle) layers was much greater in the wounded explants than in the unwounded. Except for [3H]lysine in the inner layer there was also an increase in the fraction of incorporated label which was converted to epsilon(gamma-glutamyl)lysine. These results show that increased protein biosynthesis during repair in the wounded explants is associated with increased formation of epsilon(gamma-glutamyl)lysine. In addition, they indicate that the crosslink is involved in some process in the middle and inner layers which is distinct from its known function in keratinization of the epidermis.     

Determination of adenosine deaminase activity using high-pressure liquid chromatography

A method of assaying adenosine deaminase, using high-pressure liquid chromatography to isolate products, has been developed, which has several advantages over available procedures. The method has inherently low background values, affording high sensitivity. Ten picomoles of product can be reliably detected, so that as little as 0.008 unit of enzyme can be determined. Up to six samples per hour can be assayed. The procedure has been applied to erythrocytes and lymphocytes.     

Identification and quantification of N(epsilon)-(Hexanoyl)lysine in human urine by liquid chromatography/tandem mass spectrometry

The identification and quantification of N(epsilon)-(hexanoyl)lysine (N(epsilon)-HEL), which was found from the reactions between lipid hydroperoxide and lysine, from human urine was examined using liquid chromatography/tandem mass spectrometry (LC/MS/MS). The N(epsilon)-HEL in the partially purified urine fraction was identified using LC/MS/MS by several approaches including precursor/product ion scans. The peak found by the multiple-reaction monitoring (MRM) of the collision-induced fragmentation of N(epsilon)-HEL was clearly observed in urine, and the elution position coincided with the synthetic standard N(epsilon)-HEL. The product, estimated N(epsilon)-HEL, was absorbed by a specific antibody to N(epsilon)-HEL. Moreover, N(alpha)-HEL, one of the plausible hexanoyl adducts from the reaction between the N(alpha) moiety of L-lysine and the peroxidized lipid, was hardly detected in urine samples, suggesting that the origin of the N(epsilon)-HEL is the peroxidized lipid-modified proteins but not artificial hexanoylated L-lysine. Using the MRM technique, the amount of urinary N(epsilon)-HEL from the control subjects (observed healthy) was estimated to be 1.58 +/- 0.23 mumol/mol of creatinine. A comparative study of the urinary N(epsilon)-HEL with an oxidative stress marker, 8-oxo-7,8-dihydro-2'-deoxyguanosine, showed a high correlation (r = 0.844) between the two biomarkers. Furthermore, the quantification of N(epsilon)-HEL in the control and diabetic urines revealed that the urinary N(epsilon)-HEL from diabetic subjects (3.21 +/- 0.65 mumol/mol of creatinine) was significantly higher than that from the control subjects.     

High-performance liquid chromatographic determination of spectinomycin in swine,calf and chicken plasma using post-column derivatization

An HPLC method for the determination of spectinomycin in swine, calf and chicken plasma at 0.1 μg/ml or higher is described. The clean-up is based upon ion-pair solid-phase extraction on a High Hydrophobic C₁₈ column treated with sodium dioctyl suflosuccinate. After elution with methanol, spectinomycin is chromatographed on a Spherisorb SCX column using 0.1 M sodium sulphate solution (pH 2.6)-acetonitrile (80:20, v/v) as mobile phase. Fluorescence detection is at an excitation wavelength of 340 nm and an emission wavelength of 460 nm after post-column oxidation with sodium hypochlorite followed by derivatization with o-phthaldialdehyde. Mean recoveries were 99 ± 2% (n = 6), 99 ± 2% (n = 7) and 104 ± 2% (n = 6) for swine, calf and chicken plasma, respectively, at the 0.1 μg/ml level.     

Molecular weight separation of proteins and peptides with a new high-pressure liquid chromatography column.

A new high-pressure liquid molecular weight chromatography column was evaluated for its ability to separate proteins and peptides. The column was able to give a linear separation of compounds between 5,000–700,000 M_r. Chromatography of posterior pituitary extracts, tumor-associated fetal antigens, and estrogen receptors demonstrated the ability of the column to separate biological samples.     

Determination of cisplatin and cis-diammineaquachloroplatinum(II) ion by liquid chromatography using post-column derivatization with diethyldithiocarbamate

A post-column derivatization method has been developed for the determination of cisplatin and its monohydrated form. Cisplatin was isolated on a strong anion-exchange column, while a strong cation-exchange column was used for the monohydrated complex. Diethyldithiocarbamate was used as reagent and the influence of temperature, pH and methanol content on the yield of derivative was investigated. The reaction was quantitative using a packed-bed reactor with a surrounding temperature of 115°C and a mobile phase consisting of 0.125 M succinic acid—sodium hydroxide buffer pH 5.2 and methanol (2:3, v/v). The resulting complex, Pt(DDTC)₂, was monitored photometrically at 344 nm. The precision of the determination was 11.5% (C.V.) at an injected amount of 20 ng (n = 12) for monoaqua and 8.0% (C.V.) at 9 ng (n = 10) for cisplatin. The method was used to evaluate the plasma concentration of cisplatin and its monohydrated form in a patient.     

Determination of thiol proteins using monobromobimane labeling and high-performance liquid chromatographic analysis: application to Escherichia coli thioredoxin

A highly sensitive and specific assay for Escherichia coli thioredoxin was developed using the thiol-specific reagent monobromobimane. Treatment of dithiothreitol-reduced thioredoxin with an excess of monobromobimane in Tris buffer (pH 8.0, 23 degrees C) for 30 min resulted in the formation of a stable derivative which was quantitated by reverse-phase high-performance liquid chromatography with fluorescence detection providing sensitivity in the low picomole range. This method was applied to the determination of intracellular levels of thioredoxin in E. coli. Cell extracts were heated, treated with dithiothreitol, reacted with monobromobimane, and desalted to give a solution which was analyzable for thioredoxin using the chromatographic procedure.