The MER3 helicase involved in meiotic crossing over is stimulated by single-stranded DNA-binding proteins and unwinds DNA in the 3' to 5' direction

The meiosis-specific MER3 protein of Saccharomyces cerevisiae is required for crossing over, which ensures faithful segregation of homologous chromosomes at the first meiotic division. The predicted sequence of the MER3 protein contains the seven motifs characteristic of the DExH-box type of DNA/RNA helicases. The purified MER3 protein is a DNA helicase, which can displace a 50-nucleotide fragment annealed to a single-stranded circular DNA. MER3 was found to have ATPase activity, which was stimulated either by single- or double-stranded DNA. The turnover rate, k(cat), of ATP hydrolysis was approximately 500/min in the presence of either DNA. MER3 was able to efficiently displace relatively long 631-nucleotide fragments from single-stranded circular DNA only in the presence of the S. cerevisiae single-stranded DNA-binding protein, RPA (replication protein A). It appears that RPA inhibits re-annealing of the single-stranded products of the MER3 helicase. The MER3 helicase was found to unwind DNA in the 3' to 5' direction relative to single-stranded regions in the DNA substrates. Possible roles for the MER3 helicase in meiotic crossing over are discussed.     

Human mitochondrial DNA helicase TWINKLE is both an unwinding and annealing helicase

TWINKLE is a nucleus-encoded human mitochondrial (mt)DNA helicase. Point mutations in TWINKLE are associated with heritable neuromuscular diseases characterized by deletions in the mtDNA. To understand the biochemical basis of these diseases, it is important to define the roles of TWINKLE in mtDNA metabolism by studying its enzymatic activities. To this end, we purified native TWINKLE from Escherichia coli. The recombinant TWINKLE assembles into hexamers and higher oligomers, and addition of MgUTP stabilizes hexamers over higher oligomers. Probing into the DNA unwinding activity, we discovered that the efficiency of unwinding is greatly enhanced in the presence of a heterologous single strand-binding protein or a single-stranded (ss) DNA that is complementary to the unwound strand. We show that TWINKLE, although a helicase, has an antagonistic activity of annealing two complementary ssDNAs that interferes with unwinding in the absence of gp2.5 or ssDNA trap. Furthermore, only ssDNA and not double-stranded (ds)DNA competitively inhibits the annealing activity, although both DNAs bind with high affinities. This implies that dsDNA binds to a site that is distinct from the ssDNA-binding site that promotes annealing. Fluorescence anisotropy competition binding experiments suggest that TWINKLE has more than one ssDNA-binding sites, and we speculate that a surface-exposed ssDNA-specific site is involved in catalyzing DNA annealing. We propose that the strand annealing activity of TWINKLE may play a role in recombination-mediated replication initiation found in the mitochondria of mammalian brain and heart or in replication fork regression during repair of damaged DNA replication forks.     

The N-terminal domain of TWINKLE contributes to single-stranded DNA binding and DNA helicase activities

The TWINKLE protein is a hexameric DNA helicase required for replication of mitochondrial DNA. TWINKLE displays striking sequence similarity to the bacteriophage T7 gene 4 protein (gp4), which is a bi-functional primase-helicase required at the phage DNA replication fork. The N-terminal domain of human TWINKLE contains some of the characteristic sequence motifs found in the N-terminal primase domain of the T7 gp4, but other important motifs are missing. TWINKLE is not an active primase in vitro and the functional role of the N-terminal region has remained elusive. In this report, we demonstrate that the N-terminal part of TWINKLE is required for efficient binding to single-stranded DNA. Truncations of this region reduce DNA helicase activity and mitochondrial DNA replisome processivity. We also find that the gp4 and TWINKLE are functionally distinct. In contrast to the phage protein, TWINKLE binds to double-stranded DNA. Moreover, TWINKLE forms stable hexamers even in the absence of Mg²⁺ or NTPs, which suggests that an accessory protein, a helicase loader, is needed for loading of TWINKLE onto the circular mtDNA genome.     

ABC excinuclease incises both 5' and 3' to the CC-1065-DNA adduct and its incision activity is stimulated by DNA helicase II and DNA polymerase I

CC-1065 is a large molecule that binds covalently to adenine residues of DNA in a sequence-specific manner and lies in the minor groove about four bases to the 5' side of the adducted residue. Using a reconstituted Escherichia coli nucleotide excision repair system, we have obtained data showing that the ABC excinuclease makes incisions both 5' and 3' to the CC-1065 adduct and that the incision activity is stimulated by the addition of helicase II and DNA polymerase I (and dNTPs). Our results with the CC-1065 adduct are consistent with the reported in vitro processing of other adducts (e.g., cisplatin, UV photoproducts) but do not agree with a recent study that reported anomalous processing of the CC-1065 adduct by ABC excinuclease and helicase II. Our results also imply that, in binding to damaged DNA, ABC excinuclease does not make important contacts in the minor groove four bases to the 5' side of the damaged residue.     

Mitochondrial single-stranded DNA-binding protein is required for mitochondrial DNA replication and development in Drosophila melanogaster

The discovery that several inherited human diseases are caused by mtDNA depletion has led to an increased interest in the replication and maintenance of mtDNA. We have isolated a new mutant in the lopo (low power) gene from Drosophila melanogaster affecting the mitochondrial single-stranded DNA-binding protein (mtSSB), which is one of the key components in mtDNA replication and maintenance. lopo(1) mutants die late in the third instar before completion of metamorphosis because of a failure in cell proliferation. Molecular, histochemical, and physiological experiments show a drastic decrease in mtDNA content that is coupled with the loss of respiration in these mutants. However, the number and morphology of mitochondria are not greatly affected. Immunocytochemical analysis shows that mtSSB is expressed in all tissues but is highly enriched in proliferating tissues and in the developing oocyte. lopo(1) is the first mtSSB mutant in higher eukaryotes, and its analysis demonstrates the essential function of this gene in development, providing an excellent model to study mitochondrial biogenesis in animals.     

APOBEC3G DNA deaminase acts processively 3' --> 5' on single-stranded DNA

Akin to a 'Trojan horse,' APOBEC3G DNA deaminase is encapsulated by the HIV virion. APOBEC3G facilitates restriction of HIV-1 infection in T cells by deaminating cytosines in nascent minus-strand complementary DNA. Here, we investigate the biochemical basis for C --> U targeting. We observe that APOBEC3G binds randomly to single-stranded DNA, then jumps and slides processively to deaminate target motifs. When confronting partially double-stranded DNA, to which APOBEC3G cannot bind, sliding is lost but jumping is retained. APOBEC3G shows catalytic orientational specificity such that deamination occurs predominantly 3' --> 5' without requiring hydrolysis of a nucleotide cofactor. Our data suggest that the G --> A mutational gradient generated in viral genomic DNA in vivo could result from an intrinsic processive directional attack by APOBEC3G on single-stranded cDNA.     

Conserved region 3 of the adenovirus type 5 DNA-binding protein is important for interaction with single-stranded DNA

The adenovirus-encoded single-stranded DNA-binding protein (DBP) functions in viral DNA replication and several aspects of RNA metabolism. Previous studies (G. A. M. Neale and G. R. Kitchingman, J. Biol. Chem. 264:3153-3159, 1989) have defined three highly conserved regions in the carboxy-terminal domain of the protein (amino acids 178 to 186, 322 to 330, and 464 to 475) that may be involved in the binding of the protein to single-stranded DNA. We examined the role of conserved region 3 (464 to 475) by constructing nine classes of point mutants with from one to four amino acid changes. The point mutants were tested for their ability to assist adeno-associated virus DNA replication. All nine differed from wild-type DBP; seven were essentially nonfunctional, whereas two had 55 and 145%, respectively, of the wild-type DBP helper activity. Three of the mutants were found to be temperature sensitive, with significantly greater helper activity at 33 degrees C than at 37 degrees C. All nine mutants produced essentially wild-type levels of protein. One monoclonal antibody against the DBP, termed 2/4, did not immunoprecipitate the mutant DBPs as well as wild-type DBP, indicating either that the antibody recognized sequences around CR3 or that the conformation of the protein around the epitope recognized by 2/4 had changed. Two of the three temperature-sensitive DBP mutants bound to single-stranded DNA-cellulose with the same affinity as wild-type DBP at 4 degrees C; the remaining mutants all showed reduced affinity. These results demonstrated that many of the residues within conserved region 3 of the DBP are important for interaction of the protein with nucleic acid.     

Isolation of a DNA helicase from HeLa cells requiring the multisubunit human single-stranded DNA-binding protein for activity.

A DNA helicase, dependent on the multisubunit human single-stranded DNA binding protein (HSSB), was isolated from HeLa cells. At low levels of helicase, only the multisubunit SSBs, HSSB and yeast SSB, stimulated DNA helicase activity. At high levels of the helicase Escherichia coli SSB partially substituted for HSSB whereas other SSBs such as T4 gene 32 and adenovirus DNA binding protein did not stimulate the enzyme activity. Maximal activation of helicase activity occurred in the presence of one molecule of HSSB for every 20 nucleotides of single-stranded DNA. The addition of E. coli SSB significantly lowered the amount of HSSB required for strand displacement, suggesting that the HSSB plays at least two roles in the activation of the helicase. One is to bind single-stranded DNA, thereby preventing sequestration of the helicase, the other involves the interaction of the HSSB with the helicase. Monoclonal antibodies that interact with the 70- and 34-kDa subunits of HSSB inhibited its stimulation of the helicase activity. The DNA helicase acted catalytically in displacing duplex DNA and translocated in the 3' to 5' direction. The helicase displaced fragments from both ends of a DNA substrate that contained duplex region at both termini, but the 3' to 5' fragment was displaced 20 times faster than the 5' to 3' fragment. Since this helicase also displaced fully duplex DNA, the release of the 5' to 3' fragment may have occurred by entry of the helicase through the duplex end in a 3' to 5' direction.     

Effects of the Xenopus laevis mitochondrial single-stranded DNA-binding protein on the activity of DNA polymerase gamma

The single-stranded DNA-binding protein from Xenopus laevis oocyte mitochondria, which has been found associated with the D loop, binds to ssDNA in stoichiometric amounts and can under certain conditions stimulate the activity of the DNA polymerase gamma. Its properties suggest that it is involved in strand displacement during the replication of the mitochondrial genome.     

Escherichia coli DbpA is a 3' --> 5' RNA helicase

Previous work has demonstrated that Escherichia coli DbpA is a nonprocessive RNA helicase that can disrupt short RNA helices on either the 5' side or 3' side of hairpin 92 of 23S rRNA. Here the directionality of the helicase activity of DbpA was determined by using substrates containing a short reporter helix in the presence of a second adjacent helix of varying stability placed either 5' or 3' of the reporter helix. When the second helix was on the 5' side of the reporter helix, it had no effect on the dissociation rate of the reporter helix. However, when the second helix was on the 3' side of the reporter helix, its dissociation rate determined the dissociation rate of the reporter helix. This defines DbpA as a 3' --> 5' helicase. Like other helicases, DbpA requires a single-stranded RNA loading site on the 3' side of the duplex for disruption to be observed. Since the loading site could be on either strand of the helix that was disrupted, hairpin 92 does not influence the directionality of the helicase but only aids in targeting RNA substrates.     

RecA protein filaments disassemble in the 5' to 3' direction on single-stranded DNA

RecA protein forms filaments on both single- and double-stranded DNA. Several studies confirm that filament extension occurs in the 5' to 3' direction on single-stranded DNA. These filaments also disassemble in an end-dependent fashion, and several indirect observations suggest that the disassembly occurs on the end opposite to that at which assembly occurs. By labeling the 5' end of single-stranded DNA with a segment of duplex DNA, we demonstrate unambiguously that RecA filaments disassemble uniquely in the 5' to 3' direction.     

Physical and functional interaction between archaeal single-stranded DNA-binding protein and the 5'-3' nuclease NurA

NurA is a novel 5′-3′ exonuclease that is closely linked to Mre11 and Rad50 homologues in most thermophilic archaea. We report a physical and functional interaction between NurA (StoNurA) and single-stranded DNA-binding protein (StoSSB) from the hyperthermophilic archaeon Sulfolobus tokodaii. StoSSB was identified as a novel StoNurA-interacting protein by pull-down assay using Ni-NTA agarose beads and MALDI-TOF mass spectrometry. The direct interaction between StoNurA and StoSSB was further confirmed by yeast two-hybrid and co-immunoprecipitation analysis. The interaction was supposed to have functional significance because it was found that StoSSB inhibited the 5′-3′ ssDNA and dsDNA exonuclease and ssDNA endonuclease activities of StoNurA. Our results suggest that NurA may function closely together with SSB in DNA transactions in archaea.     

DNA damage detection by an archaeal single-stranded DNA-binding protein

Archaeal DNA repair pathways are not well defined; in particular, there are no convincing candidate proteins for detection of DNA mismatches or the bulky lesions removed by excision repair pathways. Single-stranded DNA-binding proteins (SSBs) play a central role in DNA replication, recombination and repair. The crenarchaeal SSB is a monomer with a single oligonucleotide-binding fold for single-stranded DNA binding coupled to a flexible C-terminal tail reminiscent of bacterial SSB that mediates interactions with other proteins. We demonstrate that Sulfolobus solfataricus SSB can melt DNA containing a mismatch or DNA lesion specifically in vitro. We suggest that a potential role for SSB in archaea is the detection of DNA damage due to local destabilisation of the DNA double helix, followed by recruitment of specific repair proteins. Proteins interacting specifically with a single-stranded DNA:SSB complex include several known or putative DNA repair proteins and DNA helicases.     

Physiological and biochemical defects in functional interactions of mitochondrial DNA polymerase and DNA-binding mutants of single-stranded DNA-binding protein

Functional interactions between mitochondrial DNA polymerase (pol gamma) and mitochondrial single-stranded DNA-binding protein (mtSSB) from Drosophila embryos greatly enhance the overall activity of pol gamma by increasing primer recognition and binding and stimulating the rate of initiation of DNA strands (Farr, C. L., Wang, Y., and Kaguni, L. S. (1999) J. Biol. Chem. 274, 14779-14785). We show here that DNA-binding mutants of mtSSB are defective in stimulation of DNA synthesis by pol gamma. RNAi knock-down of mtSSB reduces expression to <5% of its normal level in Schneider cells, resulting in growth defects and in the depletion of mitochondrial DNA (mtDNA). Overexpression of mtSSB restores cell growth rate and the copy number of mtDNA, whereas overexpression of a DNA-binding and functionally impaired form of mtSSB neither rescues the cell growth defect nor the mtDNA depletion phenotype. Further development of Drosophila animal models, in which induced mtDNA depletion is manipulated by controlling exogenous expression of wild-type or mutant forms, will offer new insight into the mechanism and progression of human mtDNA depletion syndromes and possible intervention schemes.     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

The mitochondrial DNA helicase TWINKLE can assemble on a closed circular template and support initiation of DNA synthesis

Mitochondrial DNA replication is performed by a simple machinery, containing the TWINKLE DNA helicase, a single-stranded DNA-binding protein, and the mitochondrial DNA polymerase γ. In addition, mitochondrial RNA polymerase is required for primer formation at the origins of DNA replication. TWINKLE adopts a hexameric ring-shaped structure that must load on the closed circular mtDNA genome. In other systems, a specialized helicase loader often facilitates helicase loading. We here demonstrate that TWINKLE can function without a specialized loader. We also show that the mitochondrial replication machinery can assemble on a closed circular DNA template and efficiently elongate a DNA primer in a manner that closely resembles initiation of mtDNA synthesis in vivo.     

A DNA-binding activity in BPV initiator protein E1 required for melting duplex ori DNA but not processive helicase activity initiated on partially single-stranded DNA

The papillomavirus replication protein E1 assembles on the viral origin of replication (ori) as a series of complexes. It has been proposed that the ori DNA is first melted by a head-to-tail double trimer of E1 that evolves into two hexamers that encircle and unwind DNA bi-directionally. Here the role of a conserved lysine residue in the smaller tier or collar of the E1 helicase domain in ori processing is described. Unlike the residues of the AAA+ domain DNA-binding segments (β-hairpin and hydrophobic loop; larger tier), this residue functions in the initial melting of duplex ori DNA but not in the processive DNA unwinding of partially single-stranded test substrates. These data therefore define a new DNA-binding related activity in the E1 protein and demonstrate that separate functional elements for DNA melting and helicase activity can be distinguished. New insights into the mechanism of ori melting are elaborated, suggesting the coordinated involvement of rigid and flexible DNA-binding components in E1.