Increased efficiency of transformation ofBacillus stearothermophilus by a plasmid carrying a thermostable kanamycin resistance marker

Recombinant plasmids carrying either the wildtype kanamycin nucleotidyltransferase gene encoded originally by the mesophilic plasmid pUB110 or the gene encoding the thermostable TK101 mutant were constructed and introduced intoBacillus stearothermophilus by a protoplast transformation procedure. When kanamycin-resistant transformants were selected at 47°C, the transformation efficiency of the plasmid bearing the TK101 gene was nine times higher than that of the plasmid encoding the wildtype enzyme. The difference in transformation efficiencies between the two plasmids was increased when transformants were selected at higher temperatures, reflecting the difference in thermostabilities of the respective kanamycin nucleotidyltransferases. We conclude that, even though the pUB110 enzyme is sufficiently active at 47°C to confer kanamycin resistance toB. stearothermophilus, the additional stability of the TK101 mutant is advantageous in transformation ofB. stearothermophilus. The TK101 gene may also have broad utility as a marker for cloning vectors in other thermophiles.     

The large Bacillus plasmid pTB19 contains two integrated rolling-circle plasmids carrying mobilization functions

Plasmid pTB19 is a 27-kb plasmid originating from a thermophilic Bacillus species. It was shown previously that pTB19 contains an integrated copy of the rolling-circle type plasmid pTB913. Here we describe the analysis of a 4324-bp region of pTB19 conferring resistance to tetracycline. The nucleotide sequence of this region revealed all the characteristics of a second plasmid replicating via the rolling-circle mechanism. This sequence contained (i) the tetracycline resistance marker of pTB19, which is highly similar to other tetL-genes of gram-positive bacteria; (ii) a hybrid mob gene, which bears relatedness to both the mob-genes of pUB110 and pTB913; (iii) a palU type minus origin identical to those of pUB110 and pTB913; and (iv) a plus origin of replication similar to that of pTB913. A repB-type replication initiation gene sequence identical to that of pTB913 was present, which lacked the middle part (492 bp), thus preventing autonomous replication of this region. The hybrid mob gene was functional in conjugative mobilization of plasmids between strains of Bacillus subtilis.     

Conjugative Mobilization of the Rolling-Circle Plasmid pIP823 from Listeria monocytogenes BM4293 among Gram-Positive and Gram-Negative Bacteria

We determined the sequence and genetic organization of plasmid pIP823, which contains the dfrD gene; dfrD confers high-level trimethoprim resistance to Listeria monocytogenes BM4293 by synthesis of dihydrofolate reductase type S2. pIP823 possessed all the features of the pUB110/pC194 plasmid family, whose members replicate by the rolling-circle mechanism. The rep gene encoded a protein identical to RepU, the protein required for initiation of the replication of plasmids pTB913 from a thermophilic Bacillus sp. and pUB110 from Staphylococcus aureus. The mob gene encoded a protein with a high degree of amino acid identity with the Mob proteins involved in conjugative mobilization and interplasmidic recombination of pTB913 and pUB110. The host range of pIP823 was broad and included L. monocytogenes, Enterococcus faecalis, S. aureus, Bacillus subtilis, and Escherichia coli. In all these species, pIP823 replicated by generating single-stranded DNA and was stable. Conjugative mobilization of pIP823 was obtained by self-transferable plasmids between L. monocytogenes and E. faecalis, between L. monocytogenes and E. coli, and between strains of E. coli, and by the streptococcal conjugative transposon Tn1545 from L. monocytogenes to E. faecalis, and from L. monocytogenes and E. faecalis to E. coli. These data indicate that the gene flux observed in nature from gram-positive to gram-negative bacteria can occur by conjugative mobilization. Our results suggest that dissemination of trimethoprim resistance in Listeria spp. and acquisition of other antibiotic resistance determinants in this species can be anticipated.     

Screening for thermostable mutant of kanamycin nucleotidyltransferase by the use of a transformation system for a thermophile, Bacillus stearothermophilus

A structural gene of kanamycin nucleotidyltransferase cloned into a single-stranded bacteriophage M13 was subjected to mutagenesis with hydroxylamine. Having recloned the mutagenized gene of the enzyme in a vector plasmid pTB922, the recombinant plasmid was used to transform Bacillus stearothermophilus with a purpose of screening for the more thermostable enzyme than the wild type. Out of greater than 8 X 10(3) transformants, 12 clones that were suspected to harbor the mutant gene encoding the more thermostable enzyme were isolated by shifting from a permissive (55 degrees C) to a nonpermissive (61 degrees C) temperature that inactivates the wild-type enzyme. DNA sequence analysis of the mutant genes revealed two types of mutation of single base substitution and hence a single amino acid replacement. The first type was the replacement of an aspartate by a tyrosine at position 80 of the wild-type enzyme, while the second was that of a threonine by a lysine at position 130. Purified enzymes from the two mutant genes were confirmed to be substantially more thermostable than the wild type in vitro. The method of screening for a thermostable kanamycin nucleotidyltransferase presented here could be applied to any other enzyme, if a transformation system of a thermophile were available. Indeed, thermostable mutants with a subtle amino acid change would be of value for better understanding of forces and interactions that contribute to the stability of a protein.     

Purification and characterization of a kanamycin nucleotidyltransferase from plasmid pUB110-carrying cells of Bacillus subtilis.

The nucleotidyltransferase encoded by plasmid pUB110 was purified to greater than 95% purity with a 33% yield. The enzyme is a monomeric protein with a molecular weight of 34,000. The optimum pH for activity is 5, and the optimum MgCl2 concentration for activity is 18 mM. The enzyme, which is synthesized constitutively, is stable for several weeks at 4 degrees C. This enzyme would appear to be a good model gene product for the development of a pUB110 deoxyribonucleic acid-dependent in vitro protein-synthesizing system from Bacillus subtilis.     

Transformation of Bacillus stearothermophilus with plasmid DNA and characterization of shuttle vector plasmids between Bacillus stearothermophilus and Bacillus subtilis.

A thermophilic bacterium Bacillus stearothermophilus IFO 12550 (ATCC 12980) was transformed with each of the following plasmids, pUB110 (kanamycin resistance, Kmr), pTB19 (Kmr and tetracycline resistance [Tcr]), and its derivative pTB90 (Kmr Tcr), by the protoplast procedure in the presence of polyethylene glycol at 48 degrees C. The transformation frequencies per regenerant for pUB110, pTB19, and pTB90 were 5.9 x 10(-3), 5.5 x 10(-3), and 2.0 x 10(-1), respectively. Among these plasmids, pTB90 was newly derived, and the restriction endonuclease cleavage map was constructed. When tetracycline (5 micrograms/ml) was added into the culture medium, the copy number of pTB90 in B. stearothermophilus was about fourfold higher than that when kanamycin (5 micrograms/ml) was added instead of tetracycline. Bacillus subtilis could also be transformed with the plasmids extracted from B. stearothermophilus and vice versa. Accordingly, pUB110, pTB19, and pTB90 served as shuttle vectors between B. stearothermophilus and B. subtilis. The requirements for replication of pTB19 in B. subtilis and B. stearothermophilus appear to be different, because some deletion plasmids (pTB51, pTB52, and pTB53) derived from pTB19 could replicate only in B. subtilis, whereas another deletion plasmid pTB92 could replicate solely in B. stearothermophilus. Plasmids pTB19 and pTB90 could be maintained and expressed in B. stearothermophilus up to 65 degrees C, whereas the expression of pUB110 in the same strain was up to 55 degrees C.     

Similarity of minus origins of replication and flanking open reading frames of plasmids pUB110, pTB913 and pMV158.

Plasmids pMV158 and pTB913, originating from Streptococcus agalactiae and a thermophilic Bacillus respectively, were sequenced to completion. Both contained a BA3-type minus origin of replication and an RSA-site, believed to constitute a site-specific recombination site. These two regions were more than 99% homologous to the corresponding regions of the Staphylococcus aureus plasmid pUB110. Deleting the BA3-type minus origin resulted in the accumulation of a considerable amount of single-stranded DNA, both in L. lactis subsp. lactis and B. subtilis, indicating that this minus origin was functional in both bacterial species. Like pUB110, both plasmids contained an open reading frame encoding a putative plasmid recombination enzyme (Pre protein), which was located downstream of the RSA-site. On the basis of sequence comparisons between pUB110, pMV158, pTB913, pT181, pE194, pNE131 and pT48 two distinct families of RSA-sites and Pre proteins could be distinguished.     

Molecular cloning, DNA nucleotide sequencing, and expression in Bacillus subtilis cells of the Bacillus macerans cyclodextrin glucanotransferase gene.

The gene for cyclodextrin glucanotransferase from Bacillus macerans was cloned in an Escherichia coli bacteriophage, lambda D69, and was recloned in a Bacillus subtilis plasmid, pUB110. Starting from an ATG initiation codon, a unique reading frame was shown to extend for 2,142 base pairs (714 amino acids). The nucleotide sequence revealed that the enzyme is composed of two identical subunits.     

Nucleotide sequence and physical map of kanamycin-resistant plasmid pUB110 from Staphylococcus aureus

The complete nucleotide sequence of Staphylococcus aureus plasmid pUB10 was determined. The sequence consists of 4545 b.p. and contains 64% A-T and 36% G-C pairs. pUB110 was found to contain four open reading frames, capable of coding for polypeptides having more than 80 amino acids. All the putative polypeptides are coded for by one DNA strand. The molecular weights of four putative polypeptides are (in kilodaltons): A-49.5; B-38.8; C-28.8 and D-9.5. Polypeptide C is involved in kanamycin resistance. Polypeptide B is, possibly, involved in pUB110 replication. No role has yet been established for polypeptides A and D, since deletions in their coding sequences have no detectable effect on any properties of pUB110 plasmid.     

Complete nucleotide sequences of Bacillus plasmids pUB110dB, pRBH1 and its copy mutants

Summary The deletion plasmids, pRBH1 (1.5 MDa, kanamycin resistance, Km^r) and pUB110dB (1.5 MDa, Km^r), were obtained from pTB913 (2.9 MDa, Km^r, isolated from a thermophilic bacillus) and pUB110 (3.0 MDa, Km^r, from Staphylococcus aureus), respectively. All the nucleotide sequences of these deletion plasmids were determined. Replication origin regions of pRBH1 and pUB110dB contained, respectively, 63 base-pair inverted repeat and a large open reading frame, encoding RepB protein (235 amino acid residues). The nucleotide sequences were identical to each other except for one base in the center of the inverted repeat. Two copy number mutant plasmids, pRBHC3 and pRBHC7, were obtained from pRBH1. The mutation points were located at different positions in the RepB protein coding region (Gly to Asp for pRBHC3 and Gly to Glu for pRBHC7). RepB protein was shown to be involved in the copy number control of these plasmids.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

Characterization,sequence and mode of replication of plasmid pNB2 from the thermophilic bacterium Clostridium thermosaccharolyticum

The 1882-bp nucleotide sequence of the cryptic plasmid pNB2 isolated from the thermophilic bacterium Clostridium thermosaccharolyticum was determined. pNB2 DNA has very low GC content (27%) and may serve as a model for studying the modes of maintenance and replication of AT-rich DNA under conditions of thermophilic growth. The plasmid sequence revealed three open reading frames (ORFs) which would encode polypeptides of 289, 68 and 59 amino acids, respectively, and these proteins were synthesized in E. coli extracts primed with the plasmid. We found that the product of ORF289 may be initiated at the non-ATG start codon, TTG, and has similarities with the conserved motifs of Rep proteins encoded by rolling circle (RC) plasmids of the pC194/pUB110 family. Southern hybridization analysis of lysates of C. thermosaccharolyticum cells harboring pNB2 revealed single-stranded intermediates, suggesting that this plasmid is able to replicate in clostridial cells via the RC mechanism. The most significant similarities are found between pNB2 Rep protein and the Rep proteins of three RC plasmids of the pC194 family (pTB913, pBC1 and pST1) isolated from thermophilic bacteria. Comparative analysis of these Rep proteins showed that despite the significant level of divergence, these Rep proteins share a high degree of similarity in the regions of five well-known conserved domains of RC Rep proteins and fall into two groups in accordance with the similarities found in their active sites.     

Characterization, sequence and mode of replication of plasmid pNB2 from the thermophilic bacterium Clostridium thermosaccharolyticum

 The 1882-bp nucleotide sequence of the cryptic plasmid pNB2 isolated from the thermophilic bacterium Clostridium thermosaccharolyticum was determined. pNB2 DNA has very low GC content (27%) and may serve as a model for studying the modes of maintenance and replication of AT-rich DNA under conditions of thermophilic growth. The plasmid sequence revealed three open reading frames (ORFs) which would encode polypeptides of 289, 68 and 59 amino acids, respectively, and these proteins were synthesized in E. coli extracts primed with the plasmid. We found that the product of ORF289 may be initiated at the non-ATG start codon, TTG, and has similarities with the conserved motifs of Rep proteins encoded by rolling circle (RC) plasmids of the pC194/pUB110 family. Southern hybridization analysis of lysates of C. thermosaccharolyticum cells harboring pNB2 revealed single-stranded intermediates, suggesting that this plasmid is able to replicate in clostridial cells via the RC mechanism. The most significant similarities are found between pNB2 Rep protein and the Rep proteins of three RC plasmids of the pC194 family (pTB913, pBC1 and pST1) isolated from thermophilic bacteria. Comparative analysis of these Rep proteins showed that despite the significant level of divergence, these Rep proteins share a high degree of similarity in the regions of five well-known conserved domains of RC Rep proteins and fall into two groups in accordance with the similarities found in their active sites. Received: 25 April 1996 / Accepted: 20 June 1996     

The integrated state of the rolling-circle plasmid pTB913 in the composite Bacillus plasmid pTB19.

Summary pTB19, a 27 kb plasmid originating from a thermophilic Bacillus species, contains integrated copies of two rolling-circle type plasmids on a 10.6 kb DNA fragment. In the present study we analysed the part of pTB19 that contains the rolling-circle plasmid pTB913 and the region in between the two rolling-circle plasmids. We show that, in the integrated state, pTB913 was flanked by a 55 by direct repeat that duplicated part of the replication initiation gene repB. Since repB was interrupted, the integrated pTB913 could not initiate rolling-circle replication. Autonomously replicating pTB913 was produced from pTB19, probably through recombination between the 55 by direct repeats; this was a rare event. Since the second integrated rolling-circle type plasmid also contained a non-functional replication initiation gene, replication of pT1319 must be controlled by the RepA determinant. Theta-type replication, controlled by RepA is likely to account for the high stability of pTB19. In between the two integrated rolling-circle plasmids was present an open reading frame (447 codons) which could encode a protein of unknown function.     

A small plasmid, pCA2.4, from the cyanobacterium Synechocystis sp. strain PCC 6803 encodes a rep protein and replicates by a rolling circle mechanism.

Different cryptic plasmids are widely distributed in many strains of cyanobacteria. A small cryptic plasmid, pCA2.4, from Synechocystis strain PCC 6803 was completely sequenced, and its replication mode was determined. pCA2.4 contained 2,378 bp and encoded a replication (Rep) protein, designated RepA. An analysis of the deduced amino acid sequence revealed that RepA of pCA2.4 has significant homology with Rep proteins of pKYM from Shigella sonnei, a pUB110 plasmid family from gram-positive bacteria, and with a protein corresponding to an open reading frame in a Nostoc plasmid and open reading frame C of Plectonema plasmid pRF1. pKYM and pUB110 family plasmids replicate by a rolling circle mechanism in which a Rep protein nicks the origin of replication to allow the generation of a single-stranded plasmid as a replication intermediate. RepA encoded by pC2.4 was expressed in Escherichia coli cells harboring a vector, pCRP336, containing the entire repA gene. The observed molecular weight of RepA was consistent with the value of 39,200 calculated from its deduced amino acid sequence, as was the N-terminal sequence analysis done through the 12th residue. Single-stranded plasmid DNA of pCA2.4 that was specifically degraded by S1 nuclease was detected in Synechocystis cells by Southern hybridization. These observations suggest that pCA2.4 replicates by a rolling circle mechanism in Synechocystis cells.     

Plasmid transfer in bacilli by a self-transmissible plasmid p19 from a Bacillus subtilis soil strain

The cryptic 95-kb plasmid p19 of the Bacillus subtilis 19 soil strain promotes the transfer of a small kanamycin resistance plasmid pUB110. To facilitate direct selection for p19 transfer, a plasmid derivative carrying the chloramphenicol resistance gene was constructed. The frequency of transfer of the large plasmid between cells of B. subtilis 19 approached 100% but was more than two orders of magnitude lower when the strain B. subtilis 168 was a recipient. However, when the restriction-deficient strain B. subtilis 168 was a recipient, the transfer efficiency was almost completely recovered. The effectiveness of pUB110 mobilization was virtually not altered in all these cases. pC194 was not mobilized by p19. The kinetics of p19 conjugative transfer is also presented.     

Crystallization and preliminary crystallographic analysis of a thermostable mutant of kanamycin nucleotidyltransferase.

A thermostable mutant of kanamycin nucleotidyltransferase isolated by cloning and selection for kanamycin resistance in Bacillus stearothermophilus at 70 degrees C has been crystallized in a form suitable for high-resolution diffraction analysis. This enzyme catalyzes nucleotidyl group transfer from nucleoside triphosphates such as ATP to hydroxyl groups of various aminoglycosides, thus inactivating the antibiotic. The kanamycin nucleotidyltransferase gene, originally encoded on plasmid pUB110 from the mesophile Staphylococcus aureus, was transferred to the thermophile B. stearothermophilus via shuttle plasmids and the mutant carrying the substitutions D80Y and T130K was isolated from kanamycin-resistant colonies grown at 70 degrees C. The thermostable enzyme was crystallized in two forms from solutions of polyethylene glycol 8000 (PEG8000) using batch and vapor diffusion methods. Type I crystals grown from 19% (w/v) PEG8000 and 200 mM NaCl belong to the orthorhombic space group C222(1), have unit cell dimensions of a = 128.4, b = 156.8, c = 155.8 A, and diffract to at least 2.4-A resolution. The type II form of the crystals were grown from 10% PEG8000, 200 mM KCl, and 3 mM CoCl2, and belong to the tetragonal space group P4(1)2(1)2 or P4(3)2(1)2 with unit cell dimensions of a = b = 78.9, and c = 220.4 A; these crystals diffract to at least 2.5-A resolution.     

Complete nucleotide sequence of the metapyrocatechase gene on the TOI plasmid of Pseudomonas putida mt-2

Metapyrocatechase which catalyzes the oxygenative ring cleavage of catechol to form alpha-hydroxymuconic epsilon-semialdehyde is encoded by the xylE gene on the TOL plasmid of Pseudomonas putida mt-2. We have cloned the xylE region in Escherichia coli and determined the nucleotide sequence of the DNA fragment of 985 base pairs around the gene. The fragment included only one open translational frame of sufficient length to accommodate the enzyme. The predicted amino acid sequence consisted of 307 residues, and its NH2- and COOH-terminal sequences were in perfect agreement with those of the enzyme recently determined (Nakai, C., Hori, K., Kagamiyama, H., Nakazawa, T., and Nozaki, M. (1983) J. Biol. Chem. 258, 2916-2922). A mutant plasmid was isolated which did not direct the synthesis of the active enzyme. This plasmid had a DNA region corresponding to the NH2-terminal two-thirds of the polypeptide. From the deduced amino acid sequence, the secondary structure was predicted. Around 10 base pairs upstream from the initiator codon for metapyrocatechase, there was a base sequence which was complementary to the 3'-end of 16 S rRNAs from both E.coli and Pseudomonas aeruginosa. A preferential usage of C- and G-terminated codons was found in the coding region xylE, which contributed to the relatively high G + C content (57%) of this gene.     

Nucleotide sequence of a Bacillus pumilus gene specifying chloramphenicol acetyltransferase

Gene cat-86 of Bacillus pumilus, specifying chloramphenicol-inducible chloramphenicol acetyltransferase, was previously cloned in Bacillus subtilis on plasmid pUB110. The nucleotide sequence of cat-86 indicates that the gene encodes a protein of 220 amino acids and contains TTG as the translations-initiation codon. The proteins specified by cat-86 and the cat genes present on pC194, pC221 and Tn9 appear to share regions of amino acid sequence similarity. cat-86 is a structural gene on the B. subtilis expression plasmid pPL608. Restriction sites exist within the gene that should permit the product of inserted heterologous coding sequences to be synthesized in B. subtilis as fusion proteins.