共查询到20条相似文献,搜索用时 281 毫秒
1.
Barry D. Shur 《Developmental biology》1982,91(1):149-162
Migrating cells possess surface glycosyltransferase activity toward extracellular substrates, and the appearance of enzyme activity coincides with the onset of cellular migration (Shur, 1977a, Shur, 1977b, Develop. Biol.58, 23–39, 40–55; E. A. Turley and S. Roth, 1979, Cell17, 109–115). In this paper, surface glycosyltransferases were examined during normal and mutant mesenchyme migration. Of six glycosyltransferases that were assayed, only galactosyltransferase was present at significant levels on the cell surface, despite the presence of a variety of intracellular glycosyltransferases. All controls have been performed to show clearly the enzyme activity was cell surface localized. In both normal and embryos, surface galactosyltransferase activity was localized, by autoradiography, primarily to migrating mesenchymal cells, and to a lesser degree, to presumptive neural epithelium. During primitive streak formation, putative embryos were devoid of surface galactosyltransferase activity. However, as development progressed, the level of activity eventually exceeded wild-type levels by two- to sixfold and was evident in tissues prior to the onset of microscopic pathology. Other surface enzymes assayed did not show any increase in activity. The extracellular galactosyl acceptors were not chloroform:methanol soluble, and glycopeptides prepared by exhaustive Pronase digestion were excluded from Sephadex G-50. This large galactosylated glycoconjugate was readily digestable with endo-β-galactosidase, and, therefore, is similar to the poly-N-acetyllactosamine chains previously identified on early embryonic tissues (A. Kapadia, T. Feizi, and M. J. Evans, 1981, Exp. Cell. Res.131, 185–195; T. Muramatsu, G. Gachelin, M. Damonneville, C. Delarbre, and F. Jacob, 1979, Cell18, 183–191; A. Heifetz, W. J. Lennarz, B. Libbus, and Y. -C. Hsu, 1980, Develop. Biol.80, 398–408). These results support an involvement of surface galactosyltransferases in mesenchyme formation and during migration on poly-N-acetyllactosamine substrates. 相似文献
2.
Price's (1970) covariance theorem can be used to derive an expression for gene frequency change in kin selection models in which the fitness effect of an act is independent of the genotype of the recipient. This expression defines a coefficient of relatedness which subsumes r(Wright, 1922), b(Hamilton, 1972), ρ (Orlove &; Wood, 1978), and R(Michod &; Hamilton, 1980). The new coefficient extends the domain of Hamilton's rule to models in which the average gene frequency of actors differs from that of recipients. 相似文献
3.
The dual wavelength assay technique (H. R. Levy, and G. H. Daouk, 1979, J. Biol. Chem.254, 4843–4847) is used to examine the rates of the NADP- and NAD-linked reactions of Leuconostoc mesenteroides glucose 6-phosphate dehydrogenase simultaneously under various conditions. Inhibition by ATP, MgATP2?, acetyl-CoA, and palmitoyl-CoA is greatly diminished at high glucose 6-P concentration which favors the NAD-linked reaction. Increasing concentration ratios inhibit the NADP-linked, but stimulate the NAD-linked reaction. The selective effects of glucose 6-P and the concentration ratio, which cannot be detected by conventional assays, are explained in terms of the differing kinetic mechanisms for the NADP-linked and NAD-linked reactions previously described (C. Olive, M. E. Geroch, and H. R. Levy, 1971, J. Biol. Chem.246, 2047–2057). It is proposed that these effects constitute the mechanism whereby the nucleotide specificity of the amphibolic glucose 6-phosphate dehydrogenase from Leuconostoc mesenteroides is regulated. 相似文献
4.
Acridine orange and proflavine form complexes with the dinucleoside monophosphate, 5-iodocytidylyl(3′–5′)guanosine. The acridine orange-iodoCpG2 crystals are monoclinic, space group P21, with unit cell dimensions , β = 102.5 °. The proflavine-iodoCpG crystals are monoclinic, space group C2, with unit cell dimensions , β = 123.3 °. Both structures have been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least-squares.Acridine orange forms an intercalative structure with iodoCpG in much the same manner as ethidium, ellipticine and 3,5,6,8-tetramethyl-N-methyl phenanthrolinium (Jain et al., 1977, Jain et al., 1979), except that the acridine nucleus lies asymmetrically in the intercalation site. This asymmetric intercalation is accompanied by a sliding of base-pairs upon the acridine nucleus and is similar to that observed with the 9-aminoacridine-iodoCpG asymmetric intercalative binding mode described in the previous papers (Sakore et al., 1977, Sakore et al., 1979). Basepairs above and below the drug are separated by about 6.8 Å and are twisted about 10 °; this reflects the mixed sugar puckering pattern observed in the sugar-phospate chains: C3′ endo (3′–5′) C2′ endo (i.e. each cytidine residue has a C3′ endo sugar comformation, while each guanosine residue has a C2′ endo sugar conformation), alterations in glycosidic torsional angles and other small but significant conformational changes in the sugar-phosphate backbone.Proflavine, on the other hand, demonstrates symmetric intercalation with iodoCpG. Hydrogen bonds connect amino groups on proflavine with phosphate oxygen atoms on the dinucleotide. In contrast to the acridine orange structure, base-pairs above and below the intercalative proflavine molecule are twisted about 36 °. The altered magnitude of this angular twist reflects the sugar puckering pattern that is observed: C3′ endo (3′–5′) C3′ endo. Since proflavine is known to unwind DNA in much the same manner as ethidium and acridine orange (Waring, 1970), one cannot use the information from this model system to understand how proflavine binds to DNA (it is possible, for example, that hydrogen bonding observed between proflavine and iodoCpG alters the intercalative geometry in this model system).Instead, we propose a model for proflavine-DNA binding in which proflavine lies asymmetrically in the intercalation site (characterized by the C3′ endo (3′–5′) C2′ endo mixed sugar puckering pattern) and forms only one hydrogen bond to a neighboring phosphate oxygen atom. Our model for proflavine-DNA binding, therefore, is very similar to our acridine orange-DNA binding model. We will describe these models in detail in this paper. 相似文献
5.
Fidel Ramón Nels C. Anderson Ronald W. Joyner John W. Moore 《Journal of theoretical biology》1976,59(2):381-408
A modified Hodgkin & Huxley (1952) model for axons was used to simulate smooth muscle action potentials. The modifications were such as to match our own experimental results and published data on the passive and active behavior of smooth muscle.A brief account of the modifications introduced to the HH model is as follows. The resting ionic conductances were obtained from the data of Casteels (1969). Chloride conductance was replaced by an ad hoc leakage conductance () in order to obtain a resting membrane resistance of about 11 kΩcm2. The ionic equilibrium potentials were according to Kao & Nishiyama (1969). The rate constants m, n and h have similar form to those in axons, but their different numerical values produce action potentials that match the duration of the smooth muscle action potential (about 16 ms) at half its maximum amplitude. The effective membrane capacitance was taken as 2.5 μF/cm2.The results obtained by implementing those smooth muscle parameters in the HH formulation include: (a) a membrane potential that matches the main characteristics of experimentally recorded action potentials in uterine smooth muscle and guinea-pig taenia-coli, and (b) a propagated action potential which, on a cable diameter of 5 μm (similar to the diameter of a single smooth muscle cell), has a speed of propagation within the range of the values experimentally recorded in smooth muscle. This observed velocity of propagation is not compatible with a large cable and it is concluded that “functional units” are not required to sustain propagation of action potentials in smooth muscle. 相似文献
6.
During recent years, numerous attempts have been made to correlate both quantitative (Davies &; Taylor, 1959; Engen, 1962; Beck, 1964; Engen, Cain &; Rovee, 1968; Cain, 1969; Dravnieks &; Laffoit, 1970; Laffort, 1969a,b) and qualitative (Davies, 1965; Amoore &; Venstrom, 1965; Döving, 1966a,b; Wright &; Michels, 1964; Leveteau &; MacLeod, 1969) odorous properties of single compounds to their molecular properties. These attempts have been only partially successful.In the present paper we will try to explain the several odorous properties of single compounds on the basis of the non-specific properties of odorants involved in solubility.This model is a first approach, and although it gives statistically highly significant relations, it is not as accurate as those advanced with respect to the physical and sensory dimensions of stimuli in the fields of vision and audition.We will first give the present definitions of the most suitable physicochemical parameters, and then advance quantitative and qualitative models for single compounds. Quantitative odorous properties are: odour threshold, rate of change of odour intensity with odorant concentration in the suprathreshold region, and the somewhat controversial upper odour intensity. Qualitative properties refer to odour character. 相似文献
7.
A theory of and conductance noise is given for ionic channels in nerve membrane. The theory is based on the assumption that the channels are in constant, stochastically independent, rotational motion within a fluid bilayer membrane. The resulting expression for the current noise power density S contains a conduction noise term consistent withStevens (1972) and Hill & Chen (1972) and a noise term consistent with Lundstrom & McQueen (1974) and Clay & Shlesinger (1976). The expression for S also contains a third term which is the spectrum of the product of the single channel conduction noise and noise correlation functions. This term is independent of the number of channels in the membrane, R. Consequently, the expression for S effectively reduces to a sum of and conduction noise for R 10–100 which is in agreement with noise measurements on squid axon. The theory is applied in detail to potassium squid noise measurements of Conti, DeFelice & Wanke (1975) using the stochastic analysis of single file ion motion developed in our previous paper (Clay & Shlesinger (1976)). 相似文献
8.
Fertilization of frog eggs by frog sperm is inhibited if the egg's membrane potential is positive (N. L. Cross and R. P. Elinson, 1980, Dev. Biol.75, 187–198); however, fertilization of salamander eggs by salamander sperm does not depend on membrane potential (M. Charbonneau, M. Moreau, B. Picheral, J. P. Vilain, and P. Guerrier, 1983, Dev. Biol.98, 304–318). Since salamander sperm can fertilize frog eggs, we have investigated whether this cross-fertilization is voltage dependent. If, during insemination with Notophthalmus sperm, Xenopus eggs were voltage clamped between +7 and +20 mV, fertilization proceeded in (70%) of the clamped eggs, compared to (79%) of the neighboring eggs. In control experiments in which voltage-clamped Xenopus eggs were inseminated with Xenopus sperm, fertilization proceeded in only (10%) of the clamped eggs, compared to (98%) of the neighbors. Similar results were obtained with cross-fertilization experiments between Notophthalmus sperm and Rana eggs. These experiments indicate that the voltage dependence of fertilization depends on the species of sperm. 相似文献
9.
The amino acid sequences of type I collagen containing α1(I) and α2 chains at a ratio of 2:1, and of type III collagen consisting of α1 (III) chains are known. A statistical analysis of the sequences of these α chains is presented. The inter-chain comparison showed a high level of homology between the three α chains. The interactive amino acids, such as the polar charged and part of the hydrophobic residues responsible for the assembly of the molecules, are strongly conserved. The intra-chain analysis revealed that the α chains are divided into four related D units, each with a length of 234 residues. Between the D units within a chain the polar residues show a higher variability than the hydrophobic amino acids.Besides the D units, other periodicities such as (78 residues), (39 residues), (21 residues) and (18 residues) were observed, particularly in α1 (I) and α1 (III). The D unit is a functional repeat that is formed by the interactive polar charged and hydrophobic residues and which determines the aggregation of the molecules. The unit is mainly pronounced by the non-interactive residues such as proline and alanine and appears to be a reminiscence of a primordial gene. The smaller periodic repeating units may be considered as additional genetic units or as structural units, which determine the triplehelical pitch and thus the lateral aggregation of the molecules.In contrast to α1 (I) and α1 (III), the α2 chain shows less regularity in its internal structure. 相似文献
10.
A. Gimelfarb 《Theoretical population biology》1983,23(2):147-158
An approximate formula for the expected within-sibship genotypic variance of a polygenic, diallelic, additive character is obtained for arbitrary recombination between the loci affecting the character. The formula is exact, when there is no recombination, or when the recombination is free. It is also shown that, if the value of (one-half of the parental genotypic variance) is assigned to the within-sibship genotypic variance, as in the model of Cavalli-Sforza and Feldman (1976, Proc. Natl. Acad. Sci. USA73, 1689–1692), it implies the assumptions of random mating and of the perfect linkage. If, on the other hand, the value of (one-half of the linkage equilibrium genotypic variance) is assigned to the within-sibship variance, as in the model of Rice, Cloninger, and Reich (1978, Amer. J. Hum. Genet.30, 618–643), it implies the assumptions of random mating and either of the free recombination, or of the linkage equilibrium, if the recombination is not free. 相似文献
11.
Nosema pulvisPerez, 1905, Ameson pulvis (Perez) Sprague, 1977, in muscles of the crabs Carcinus maenas and C. mediterraneus from the coast of France, was observed with the electron microscope. It was found to be structurally similar to the type species A. michaelis (Sprague, 1970). Sprague, 1977, having moniliform sporogonial plasmodia, unikaryotic sporoblasts, and hirsute sporulation stages. It is treated as distinct from A. michaelis because it has slightly smaller spores (by comparison with syntype material of A. michaelis) and appears to have fewer coils in the polar filament. The results require the removal of the genus Ameson from the family Nosematidae Labbé, 1899, where Sprague (1977) had placed it under the erroneous supposition that its sporoblasts are diplokaryotic. Ameson is transferred to family Unikaryonidae Sprague, 1977. Ameson is distinguished from PereziaLéger and Duboscq, 1909, shown by Ormieres et al. to have a similar developmental pattern, by presence of appendages on its sporulation stage. A. nelsoni (Sprague, 1950), the third, and only other species of Ameson, lacks the appendages and is transferred to genus Perezia. 相似文献
12.
13.
Elisabeth Bertrand Monique Erard Macarena Gómez-Lira Jürgen Bode 《Archives of biochemistry and biophysics》1984,229(1):395-398
Recently, Bode et al. [J. Bode, M. Gómez-Lira, and H. Schröter (1983)Eur. J. Biochem.130, 437–445] have observed that monomeric nucleosomal particles from butyrate-treated Namalva lymphoma cells display a distinct heterogeneity in their mobilities on a non-denaturing 4% polyacrylamide gel. They have proposed that histone hyperacetylation induces a conformational change in monomers that can be modulated by the presence of HMG . The electron microscopic analyses presented here support these proposals. 相似文献
14.
Electron microscopic examination of the histone H1-depleted, folded genomes of Drosophila melanogaster reveals that they are composed of long cylindrical cables of about 100 Å diameter. Limited single-strand nicking with DNAase I relaxes the 100 Å fibers to a “beads-on-a-string” structure, showing the nucleosomes and internucleosome DNA.Based on these results and other available data, we have constructed a detailed space-filling model for the higher order DNA coiling in chromatin, starting with the symmetrical nucleosome core previously described (Weintraub, Worcel and Alberts, 1976). The model defines the path of the DNA helix and the nucleosome arrangement along the DNA coil for both the 100 Å and the 200–300 Å fibers.Following Sobell et al. (1976), we believe that the DNA is coiled in the 100 Å nucleofilament in a uniform left-handed supercoil of about 90 base pairs (bp) per turn and 47 Å pitch; the 140 bp symmetrical nucleosome cores align themselves along this uniform DNA superhelix so that the isologous outer surfaces of adjacent nucleosomes touch and the internucleosome spacer DNA coils between them. A few single-strand discontinuities [about one nick per 85 kilobases (kb); Benyajati and Worcel, 1976] in the H1-depleted 100 Å fiber can thus relax the negatively supercoiled internucleosome DNA generating the “beads-on -a-string” appearance.We propose that histone H1 binds to the 100 Å diameter superhelix and coils it into tightly packed, 110 Å pitch super-superhelices (“solenoids;” Finch and Klug, 1976) of variable diameter (between 200–300 Å). In our model, the “thick” 200–300 Å fiber is stabilized at metaphase by histone H1-H1 heterologous interactions between adjacent helical turns of the nucleofilament, and the internucleosome spacer DNA is located on the outside. Symmetry considerations demand that changes in the length of the repeat should lead to variations in the number of nucleosomes per helical turn and in the handedness of these turns in the 200–300 Å metaphase fiber. 相似文献
15.
Plasmodium vaughaniNovy and MacNeal, 1904, Plasmodium tenueLaveran and Marullaz, 1914, and Plasmodium merulaeCorradetti and Scanga, 1972 are shown to differ. It is suggested that P. tenue and P. merulae should be considered as subspecies belonging to Plasmodium vaughani-complex.More investigations are needed for a sufficient knowledge of the complex, particularly because at least 36 species of birds harbor P. vaughani-like parasites and cover an immense geographical area in all the parts of the world. 相似文献
16.
The nucleotide sequence of the 5S rRNA from a mushroom, , was determined to be: pAUCCACGGCCAUACGACUCUGAAAGCACCGCACCGCAUCCCGUCCGAUCUGCGCAGUUAACCAGAGUGCCGCUCAGUUAGUACCACGGUGGGGGACCACGCGGGAAUCCUGGGUGCUGUGGUU. This sequence is consistent with current models for the secondary structure of 5S RNAs and indicates a very high degree of sequence conservation among the most highly evolved fungi. Sequence heterogeneity was not evident in this fungus suggesting that the more highly evolved fungi may not contain the dispersed pattern of 5S rRNA genes which have been observed in intermediate fungi such as (Selker, E.U., and Yanofsky, C. (1981) Cell , 819–828.) 相似文献
17.
D Thusius 《Journal of molecular biology》1977,115(2):243-247
The recent work of Cohen &; Benedek (1976) and Cohen et al. (1975, 1976) on the apparent interdependence of beef liver glutamate dohydrogenase catalytic activity and degree of polymerization is examined in the light of previously published equilibrium and kinetic results. It is shown that some of the hypotheses central to the Cohen &; Benedek (1976) model are in contradiction with existent data. Consideration of all available information leads to the conclusion that effector-induced depolymerization may simply be an incidental side reaction in the events leading to inhibition. 相似文献
18.
An autoradiographic analysis of the time of appearance of neurons in the developing chick neural retina 总被引:11,自引:0,他引:11
A J Kahn 《Developmental biology》1974,38(1):30-40
The pattern of incorporation of [3H]thymidine into the chick neural retina has been used to establish the time and order in which different classes of neuroepithelial cells withdraw from the cell cycle and initiate migration and differentiation.The posterior pole of the retina is the first to form during development. In this region most neuroepithelial cells complete mitotic activity between the third and sixth day of incubation. Presumptive ganglion cells initiate the withdrawal process, and they are soon followed by the neuroepithelial precursors of amacrine, horizontal, and receptor cells. Bipolar cell precursors are the last to begin and the last to complete cell cycle activity. It is worthy of note, however, that, in any given region of the retina, neuroepithelial cells of all types cease mitosis in close, overlapping succession.These results are in reasonable agreement with those previously published on the chick retina by Fujita and Horii (1963), and other investigators on the mouse (Mus), killifish (Fundulus), and toad (Xenopus). The present data are also consistent with those proposals of Angevine (1970), Jacobson, 1968a, Jacobson, 1968b, Jacobson, 1970, and others that relate the cessation of mitotic activity of neuroepithelial cells to the determination of neuronal size, axon length, and the specification of neuronal connections. 相似文献
19.
John H. Gillespie 《Theoretical population biology》1976,10(2):227-238
The Island Model introduced by Sewall Wright (1951) has proven to be a useful construction for studying the interaction of genetic drift, population subdivision, and mutation. Interest in the model has recently increased because of its relevance to certain questions involving the rate of differentiation of sub-populations under the neutral allele hypothesis (e.g., Smith, 1970; Latter, 1973). It is perhaps the only realistic population structure in which the test for neutrality proposed by Lewontin and Krakauer (1973) is valid (Lewontin and Krakauer, 1975). If data from natural populations is to be compared to the predictions of the Island Model, it is desirable to have an alternative model with the same migration pattern but with natural selection operating. In this paper one such model will be introduced where the stochastic element comes from random fluctuations in the environment rather than from genetic drift. The model is a direct extension of the one in the previous paper in this series (Gillespie, 1975) which dealt with a population which is subdivided into two patches with restricted migration between them. 相似文献