Properties of Oligonucleotide with Phenyl-Substituted Carbocyclic Nucleoside Analogs for the Formation of Duplex and Triplex DNA

(1S,3S,4R)-1-Phenyl-1-thymidyl-3-hydroxy-4-hydroxymethylcyclopentane (10) and their analogs were synthesized, incorporated into the oligodeoxynucleotides, and their properties were evaluated for the formation of duplex and triplex DNA. The known chiral cyclopentanone derivative was converted into the corresponding ketimine sulfonamide derivative, which was subjected to a stereoselective PhLi addition. The formed sulfonamide was hydrolyzed to afford the primary amino group, on which the thymine moiety was built. The benzyl protecting groups were removed to form the nucleoside analog having a phenyl group and the thymine unit at the 1′ position of a carbocyclic skeleton (10). In the estimation of the oligodeoxynucleotides incorporating 10 for duplex and triplex formation, the carbocyclic nucleoside analog 10 did not show the stabilizing effect for duplex formation; on the other hand, it stabilized the triplex. Therefore, the skeleton of the phenyl-substituted carbocyclic nucleoside analog 10 may be a platform for the formation of stable triplex DNA.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Novel Hoogsteen-like Bases for Recognition of the C-G Base Pair by DNA Triplex Formation

Effective sequence-specific recognition of duplex DNA is possible by triplex formation with natural oligonucleotides via Hoogsteen H-bonding. However, triplex formation is in practice limited to pyrimidine oligonucleotides that bind duplex A-T or G-C base pair DNA sequences specifically at homopurine sites in the major groove as T·A-T and C⁺ ·G-C triplets. Here we report the successful modelling of novel unnatural nucleosides that recognize the C-G DNA base pair by Hoogsteen-like major groove interaction. These novel Hoogsteen nucleotides are examined within model A-type and B-type conformation triplex structures since the DNA triplex can be considered to incorporate A-type and/or B-type configurational properties. Using the same deoxyribose-phosphodiester and base-deoxyribose dihedral angle configuration, a triplet comprised of a C-G base pair and the novel Hoogsteen nucleotide, Y2, replaces the central T·A-T triplet in the triplex. The presence of any structural or energetic perturbations due to the central triplet in the energy-minimized triplex is assessed with respect to the unmodified energy minimized (T·A-T)₁₁ starting structures. Incorporation of this novel triplet into both A-type and B-type natural triplex structures provokes minimal change in the configuration of the central and adjacent triplets.     

Interaction of Oligodeoxyribonucleotides Through Formation of Chimeric Duplex/Triplex Complexes

Abstract

An intramolecular duplex/triplex chimera is formed between d-CTTCCT-(T)₄-TCCTTCAGCACA and target d-GTT TGTGCTGAAGGA CACAC. The high Tm and hypochromicity of the triplex part of the chimera may be due to additional interactions outside the underlined binding site of the 20-mer.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

Triplex Formation Between DNA and Mixed Purine-Pyrimidine PNA Analog with Lysines in Backbone

Abstract

Melting UV experiments and mixing curves indicated slow triplex formation between lysine comprising PNA and DNA complement in 100mM Na⁺ solution.     

Intramolecular Recombination R-Triplex in Solution: Stabilization by bis-intercalator YOYO

Abstract

Recognition of double-stranded DNA with a mixed nucleotide sequence by oligonucleotide is a long-term challenge. This aim can be achieved via formation of the recombination R-triplex, accommodating two identical DNA strands in parallel orientation, and antiparallel complementary strand. In the absence of proteins the R-triplex stability is low, however, so that intermolecular R-triplex is not formed by three DNA strands in a ligand-free system. Recently, recognition of DNA with mixed base sequence by single-stranded oligonucleotide in the presence of bis-intercalator YOYO was reported. Here, we describe thermodynamic characteristics of YOYO complexes with the model oligonucleotides 5′-GT- 2AP-GACTGAG TTTT CTCAGTCTACGC GAA GCGTAGACTGAG-3′ (R^2APCW) bearing a single reporting 2-aminopurine (2AP) in place of adenine and 5′- CTCAGTCTACGC GAA GCGTAGACTGAG-3′ (CW). We found that each oligonucleotide is able to bind two YOYO molecules via intercalation mode in 0.5 M LiCl. Fluorescence intensity of YOYO intercalated in triplex R^2APCW and in CW hairpin increased 40-fold compared to the free YOYO. Remarkably, the melting temperature of the triplex (determined using temperature dependence of the 2AP fluorescence) increased from 19° C to 33° C upon binding two YOYO molecules. Further increase in the YOYO concentration resulted in binding of up to five YOYO molecules to R^2APCW triplex and up to six YOYO molecules to CW hairpin.     

Different Effects of Nonintercalative Antitumor Drugs on DNA Triple Helix Stability: SN-18071 Promotes Triple Helix Formation

Abstract

The interaction of the nonintercalating bisquaternary ammonium heterocyclic drugs SN- 18071 and SN-6999 with a DNA triple helix has been studied using thermal denaturation and CD spectroscopy. Our data show, that both minor groove binders can bind to the triple helix of poly(dA)-2poly(dT) under comparable ionic conditions, but they influence the stability of the triplex relative to the duplex structure of poly(dA)-poly(dT) in a different manner. SN- 18071, a ligand devoid of forming hydrogen bonds, can promote triplex formation and thermally stabilizes it up to 500 mM Na+ concentration. SN-6999 destabilizes the triplex to duplex equibilirium whereas it stabilizes the duplex. The binding constant of SN-18071 is found to be greater than that to the duplex. The stabilizing effect of SN-18071 is explained by electrostatic inetractions of three ligand molecules with the three grooves of the triple stranded structure. From the experiments it is concluded that SN-6999 binds to the triplex minor groove thereby destabilizing the triplex similar as previously reported for netropsin.     

New 3′-3′ Linkers for Alternate Strand Triplex Forming Oligonucleotides

Abstract

New solid supports, functionalized with suitably protected 1,2,3-propanetriol and cis,cis-1,3,5-cyclohexanetriol, were efficiently prepared and used in the standard automated synthesis of 3′-3′ linked ODNs for triplex formation experiments.     

PROMOTION OF TRIPLEX FORMATION BY 2′-O,4′-C-METHYLENE BRIDGED NUCLEIC ACID (2′,4′-BNA) MODIFICATION: THERMODYNAMIC AND KINETIC STUDIES

We analyzed the effect of 2′-O,4′-C-methylene bridged nucleic acid (2′,4′-BNA) modification of triplex-forming oligonucleotide (TFO) on pyrimidine motif triplex formation at neutral pH, a condition where pyrimidine motif triplexes are unstable. The binding constant of the pyrimidine motif triplex formation at pH 6.8 with 2′,4′-BNA modified TFO was about 20 times larger than that observed with unmodified TFO. The observed increase in the binding constant at neutral pH by the 2′,4′-BNA modification resulted from the considerable decrease in the dissociation rate constant.     

4-Guanidino-2-pyrimidinone Nucleobases: Synthesis and Hybridization Properties

Abstract

N-Alkylated 4-guanidino-2-pyrimidinone-containing nucleosides, in which the guanidine group mimics the double hydrogen bond donor pattern of protonated cytosine, were introduced in polypyrimidine sequences to explore their triple-helix forming capabilites. UV and CD melting experiments showed that strands containing these base analogues did not form triplex complexes.     

Triplex Formation Involving 2′-O,4′-C-Methylene Bridged Nucleic Acid (2′,4′-BNA) with 2-Pyridone Base Analogue: Efficient and Selective Recognition of C:G Interruption

Abstract

For the effective recognition of C:G interruption in homopurine-homopyrimidine duplex DNA, we examined triplex-forming ability and sequence-selectivity of a triplex-forming oligonucleotide (TFO) involving of 2′-O,4′-C-methylene bridged nucleic acid with 2-pyridone base analogue. We found that the modified TFO formed stable triplex with high binding affinity and sequence-selectivity.     

Triplex Formation Involving 2′-O,4′-C-Methylene Bridged Nucleic Acid (2′,4′-BNA) with 1-Is oquinolone Base Analogue: Efficient and Selective Recognition of C:G Interruption

Abstract

For the effective recognition of C ? G interruption in homopurine-homopyrimidine duplex DNA, we examined triplex-forming ability and sequence-selectivity of a triplex-forming oligonucleotide (TFO) involving of 2′-O, 4′-C-methylene bridged nucleic acid with 1-isoquinolone base analogue. We found that the modified TFO formed stable triplex with high binding affinity and sequence-selectivity.     

A Novel PNA-Monomer for Recognition of Thymine in Triple-Helix Structures

Abstract

To expand the triplex recognition repertoire of Nucleic Acids, novel nucleobases that recognize thymine in a T-A base pair are still required. A novel conformationally constrained PNA-monomer (II) capable of binding T in a triplex motif was designed and synthesized in 7 steps starting from commercially available dimethyl 2-oxoglutarate.     

Promotion mechanism of triplex DNA formation by comb-type polycations: thermodynamic analyses of sequence specificity and ionic strength dependence.

We have previously reported that in the presence of poly (L-lysine)-graft-Dextran (PLL-g-Dex) copolymer, the binding constant of the pyrimidine-motif triplex formation at neutral pH is about 100-times higher than that observed without any triplex stabilizer. Here, to explore the mechanism of the promotion effect of the PLL-g-Dex copolymer at neutral pH, the sequence specificity and the ionic strength dependence of the pyrimidine-motif triplex formation was examined in the absence or presence of the copolymer. The sequence specificity of the pyrimidine-motif triplex formation at neutral pH in the presence of copolymer was almost similar to that at acidic pH without the copolymer. As the concentration of magnesium cation increased, the binding constant of the pyrimidine-motif triplex formation without the copolymer increased. On the other hand, the binding constant of the pyrimidine-motif triplex formation in the presence of the copolymer decreased upon the increase in the concentration of magnesium cation. Considering these results in light of counterion condensation (CC) theory, we conclude that the copolymer does not hinder the sequence specificity of the triplex formation, and isolates the triplex formation from the CC effect, which may lead to a net increase in entropy change upon the triplex formation, providing a favorable component to binding constant of the triplex formation.     

Comb-Type Copolymers for Controlled DNA Delivery

Abstract

Various comb-type copolymer containing a polycation as a main chain was design to construct delivery systems of DNAs. The comb-type copolymers having cell-specific polysaccharides were proved to be useful to deliver DNA to the target cells in vivo. Of interest, the copolymers with abundant side chains of hydrophilic polymers are capable of stabilizing DNA triplex. Further, injectable nanoparticles for controlled releases of DNAs were fabricated from the copolymer and a biodegradable polymer.     

Protoberberine Alkaloids Berberine,Palmatine, and Coralyne Binding to Poly(dT)⋅(Poly(dA)⋅Poly(dT)) Triplex: Comparative Structural Aspects and Energetics Profiles of the Interaction

The interaction of bioactive protoberberine alkaloids berberine, palmatine, and coralyne with the DNA triplex poly(dT)⋅(poly(dA)⋅poly(dT)) was studied using biophysical and calorimetric techniques. All three alkaloids bound the triplex cooperatively. Berberine and palmatine predominantly stabilized the triplex structure, while coralyne stabilized both triplex and duplex structures as inferred from optical thermal melting profiles. Fluorescence quenching, polarization, and viscometric studies hinted at an intercalative mode of binding for the alkaloids to the triplex, coralyne being more strongly intercalated compared to partial intercalation of berberine and palmatine. The overall affinity of coralyne was two order higher (2.29×10⁷ M ⁻¹) than that of berberine (3.43×10⁵ M ⁻¹) and palmatine (2.34×10⁵ M ⁻¹). Isothermal titration calorimetric studies revealed that the binding to the triplex was favored by negative enthalpy change (ΔH=−3.34 kcal/mol) with favorable entropy contribution (TΔS = 4.07 kcal/mol) for berberine, favored by almost equal negative enthalpy (ΔH =−3.88 kcal/mol) and entropy changes (TΔS = 3.37 kcal/mol) for palmatine, but driven by large enthalpy contributions (ΔH =−25.62 kcal/mol and TΔS =−15.21 kcal/mol) for coralyne. These results provide new insights on the binding of isoquinoline alkaloids to the DNA triplex structure.     

Novel Hoogsteen-like bases for configurational recognition of the T-A base pair by DNA triplex formation

Effective sequence-specific recognition of duplex DNA is possible by triplex formation with natural oligonucleotides via Hoogsteen H-bonding. However, triplex formation is in practice limited to pyrimidine oligonucleotides binding duplex A-T or G-C base-pair DNA sequences specifically at homopurine sites in the major groove as T·A-T and C⁺·G-C triplets. Here we report the successful modeling of novel unnatural nucleosides that recognize the T-A DNA base pair by Hoogsteen interaction. Since the DNA triplex can be considered to assume an A-type or B-type conformation, these novel Hoogsteen nucleotides are tested within model A-type and B-type conformation triplex structures. A triplet consisting of the T-A base pair and one of the novel Hoogsteen nucleotides replaces the central T·A-T triplet in the triplex using the same deoxyribose-phosphodiester and base-deoxyribose dihedral angle configuration. The entire triplex is energy minimized and the presence of any structural or energetic perturbations due to the central triplet is assessed with respect to the unmodified energy-minimized (T·A-T)₁₁ proposed starting structures. Incorporation of these novel triplets into both A-type and B-type natural triplex structures provokes minimal change in the configuration of the central and adjacent triplets. The plan is to produce a series of Hoogsteen-like bases that preferentially bind the T-A major groove in either an A-type or B-type conformation. Selective recognition of the T-A major groove with respect to the G-C major groove, which presents similar keto and amine placement, is also assessed with configurational preference. Evaluation of the triplex solution structure by using these unnatural bases as binding conformational probes is a prerequisite to the further design of triplet forming bases. © 1996 John Wiley & Sons, Inc.     

Single-Stranded DNA and RNA Targeted Triplex-Formation: UV,CD and Molecular Modeling Studies of Foldback Triplexes Containing Different RNA, 2′-OMe-RNA and DNA Strand Combinations

Abstract

We studied the influence of different 2′-OMe-RNA and DNA strand combinations on single strand targeted foldback triplex formation in the Py.Pu:Py motif using ultraviolet (UV) and circular dichroism (CD) spectroscopy, and molecular modeling. The study of eight combinations of triplexes (D D:D, R* D:D, D D:R*, R* D:R*, D R:D, R* R:D, DR:R*, and R*-R:R*; where the first, middle, and last letters stand for the Hoogsteen Pyrimidine, Watson-Crick [WC] purine and WC pyrimidine strands, respectively, and D, R and R* stand for DNA, RNA and 2′-OMe-RNA strands, respectively) indicate more stable foldback triplex formation with a DNA purine strand than with an RNA purine strand. Of the four possible WC duplexes with RNA/DNA combinations, the duplex with a DNA purine strand and a 2′-O-Me-RNA pyrimidine strand forms the most thermally stable triplex, although its thermal stability is the lowest of all four duplexes. Irrespective of the duplex combination, a 2′-OMe-RNA Hoogsteen pyrimidine strand forms a stable foldback triplex over a DNA Hoogsteen pyrimidine strand confirming the earlier reports with conventional and circular triplexes. The CD studies suggest a B-type conformation for an all DNA homo-foldback triplex (D.D.D), while hetero-foldback triplex spectra suggest intermediate conformation to both Atype and B-type structures. A novel molecular modeling study has been carried out to understand the stereochemical feasibility of all the combinations of foldback triplexes using a geometric approach. The new approach allows use of different combinations of chain geometries depending on the nature of the chain (RNA vs. DNA).     

Pyrrolidino-DNA

Abstract

We synthesized pyrrolidino-C-nucleosides, incorporated them into oligodeoxynucleotides and investigated their pairing properties. The thermal duplex and triplex stabilities were measured. While triplex formation is destabilized in the case of pyrrolidino-pseudo-U and -T, pyrrolidino-pseudo-iso-C leads to an increase of the T_m value for third strand dissociation. Duplexes are destabilized with all pyrrolidino-C-nucleosides.