The nuclear poly(A) binding protein, PABP2, forms an oligomeric particle covering the length of the poly(A) tail

The mammalian nuclear poly(A) binding protein, PABP2, controls the length of the newly synthesized poly(A) tail on messenger RNAs. To gain a better understanding of the mechanism of length control, we have investigated the structure of the PABP2.poly(A) complex. Electron microscopy and scanning force microscopy studies reveal that PABP2, when bound to poly(A), forms both linear filaments and discrete-sized, compact, oligomeric particles. The maximum diameter of the filament is 7 nm; the maximum diameter of the particle is 21(+/-2) nm. Maximum particle size is realized when the PABP2. poly(A) complex is formed with poly(A) molecules 200-300 nt long, which corresponds to the average length of the newly synthesized poly(A) tail in vitro and in vivo. The equilibrium between filaments and particles is highly sensitive to ionic strength; filaments are favored at low ionic strength, while particles predominate at moderate to high ionic strength. Nitrocellulose filter binding and gel mobility shift assays indicate that the PABP2.poly(A) particle formed on A(300) is not significantly more stable than complexes formed with smaller species of poly(A). These results are discussed in the context of the proposed functions for PABP2.     

Inhibitory effect of naked neural BC1 RNA or BC200 RNA on eukaryotic in vitro translation systems is reversed by poly(A)-binding protein (PABP)

Regulated protein biosynthesis in dendrites of neurons might be a key mechanism underlying learning and memory. Neuronal dendritic BC1 RNA and BC200 RNA and similar small untranslated RNAs inhibit protein translation in vitro systems, such as rabbit reticulocyte lysate. Likewise, co-transfection of these RNAs with reporter mRNA suppressed translation levels in HeLa cells. The oligo(A)-rich region of all active small RNAs were identified as the RNA domains chiefly responsible for the inhibitory effects. Addition of recombinant human poly(A)-binding protein (PABP) significantly compensated the inhibitory effect of the small oligo(A)-rich RNA. In vivo, all BC1 RNA appears to be complexed with PABP. Nevertheless, in the micro-environment of dendritic spines of neuronal cells, BC1 RNPs or BC200 RNPs might mediate regulatory functions by differential interactions with locally limited PABP and/or directly or indirectly, with other translation initiation factors.     

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.     

The poly(A)-binding protein facilitates in vitro translation of poly(A)-rich mRNA

To investigate the role of the 73-kDa poly(A)-binding protein in protein synthesis, the effect of the addition of homo-polyribonucleotides on the translation of polyadenylated and non-adenylated mRNA was studied in the rabbit reticulocyte lysate. Poly(A) was found to be the most effective polynucleotide in inhibiting duck-globin mRNA translation, whereas it had no effect on the translation of polyribosomal duck-globin mRNP, or on the endogenous synthesis of the rabbit reticulocyte lysate. The translation of poly(A)-free mRNA was not affected by the addition of poly(A). Furthermore, we found that the inhibiting effect of poly(A) can be reversed by addition of purified poly(A)-binding protein. It is thus likely that the 73-kDa poly(A)-binding protein is an essential factor necessary for poly(A)-rich mRNA translation.     

Stimulation of picornavirus replication by the poly(A) tail in a cell-free extract is largely independent of the poly(A) binding protein (PABP)

Picornavirus infectivity is dependent on the RNA poly(A) tail, which binds the poly(A) binding protein (PABP). PABP was reported to stimulate viral translation and RNA synthesis. Here, we studied encephalomyocarditis virus (EMCV) and poliovirus (PV) genome expression in Krebs-2 and HeLa cell-free extracts that were drastically depleted of PABP (96%-99%). Although PABP depletion markedly diminished EMCV and PV internal ribosome entry site (IRES)-mediated translation of a polyadenylated luciferase mRNA, it displayed either no (EMCV) or slight (PV) deleterious effect on the translation of the full-length viral RNAs. Moreover, PABP-depleted extracts were fully competent in supporting EMCV and PV RNA replication and virus assembly. In contrast, removing the poly(A) tail from EMCV RNA dramatically reduced RNA synthesis and virus yields in cell-free reactions. The advantage conferred by the poly(A) tail to EMCV synthesis was more pronounced in untreated than in nuclease-treated extract, indicating that endogenous cellular mRNAs compete with the viral RNA for a component(s) of the RNA replication machinery. These results suggest that the poly(A) tail functions in picornavirus replication largely independent of PABP.     

Identification of a C-terminal poly(A)-binding protein (PABP)-PABP interaction domain: role in cooperative binding to poly (A) and efficient cap distal translational repression

The poly(A)-binding protein (PABP), bound to the 3' poly(A) tail of eukaryotic mRNAs, plays critical roles in mRNA translation and stability. PABP autoregulates its synthesis by binding to a conserved A-rich sequence present in the 5'-untranslated region of PABP mRNA and repressing its translation. PABP is composed of two parts: the highly conserved N terminus, containing 4 RNA recognition motifs (RRMs) responsible for poly(A) and eIF4G binding; and the more variable C terminus, which includes the recently described PABC domain, and promotes intermolecular interaction between PABP molecules as well as cooperative binding to poly(A). Here we show that, in vitro, GST-PABP represses the translation of reporter mRNAs containing 20 or more A residues in their 5'-untranslated regions and remains effective as a repressor when an A61 tract is placed at different distances from the cap, up to 126 nucleotides. Deletion of the PABP C terminus, but not the PABC domain alone, significantly reduces its ability to inhibit translation when bound to sequences distal to the cap, but not to proximal ones. Moreover, cooperative binding by multiple PABP molecules to poly(A) requires the C terminus, but not the PABC domain. Further analysis using pull-down assays shows that the interaction between PABP molecules, mediated by the C terminus, does not require the PABC domain and is enhanced by the presence of RRM 4. In vivo, fusion proteins containing parts of the PABP C terminus fused to the viral coat protein MS2 have an enhanced ability to prevent the expression of chloramphenicol acetyltransferase reporter mRNAs containing the MS2 binding site at distal distances from the cap. Altogether, our results identify a proline- and glutamine-rich linker located between the RRMs and the PABC domain as being strictly required for PABP/PABP interaction, cooperative binding to poly(A) and enhanced translational repression of reporter mRNAs in vitro and in vivo.     

The yeast poly(A)-binding protein Pab1p stimulates in vitro poly(A)-dependent and cap-dependent translation by distinct mechanisms.

Translation initiation in extracts from Saccharomyces cerevisiae involves the concerted action of the cap-binding protein eIF4E and the poly(A) tail-binding protein Pab1p. These two proteins bind to translation initiation factor eIF4G and are needed for the translation of capped or polyadenylated mRNA, respectively. Together, these proteins synergistically activate the translation of a capped and polyadenylated mRNA. We have discovered that excess Pab1p also stimulates the translation of capped mRNA in extracts, a phenomenon that we define as trans-activation. Each of the above activities of Pab1p requires its second RNA recognition motif (RRM2). We have found that RRM2 from human PABP cannot substitute functionally for yeast RRM2. Using the differences between human and yeast RRM2 sequences as a guide, we have mutagenized yeast RRM2 and discovered residues that are required for eIF4G binding and poly(A)-dependent translation but not for trans-activation. Similarly, other residues within RRM2 were found to be required for trans-activation but not for eIF4G binding or poly(A)-dependent translation. These data show that Pab1p has at least two biochemically distinct activities in translation extracts.     

An essential cytoplasmic function for the nuclear poly(A) binding protein, PABP2, in poly(A) tail length control and early development in Drosophila

Translational control of maternal mRNA through regulation of poly(A) tail length is crucial during early development. The nuclear poly(A) binding protein, PABP2, was identified biochemically from its role in nuclear polyadenylation. Here, we analyze the in vivo function of PABP2 in Drosophila. PABP2 is required in vivo for polyadenylation, and Pabp2 function, including poly(A) polymerase stimulation, is essential for viability. We also demonstrate an unanticipated cytoplasmic function for PABP2 during early development. In contrast to its role in nuclear polyadenylation, cytoplasmic PABP2 acts to shorten the poly(A) tails of specific mRNAs. PABP2, together with the deadenylase CCR4, regulates the poly(A) tails of oskar and cyclin B mRNAs, both of which are also controlled by cytoplasmic polyadenylation. Both Cyclin B protein levels and embryonic development depend upon this regulation. These results identify a regulator of maternal mRNA poly(A) tail length and highlight the importance of this mode of translational control.     

Chromomycin A3 binds to left-handed poly(dG-m5dC)

The interaction of chromomycin A3 (an antitumor antibiotic) with right-handed and left-handed polynucleotides has been studied by absorbance, fluorescence, circular dichroism, 31P-NMR and 1H-NMR techniques. Binding to either the B form of poly(dG-dC) or the Z form of poly(dG-m5dC) shifts the absorbance maximum to higher wavelength and enhances the fluorescence of the drug. Circular dichroic spectra of solutions containing various concentrations of chromomycin A3 and fixed concentrations of either B or Z polynucleotides show well defined isoelliptic points at similar wavelengths. At the isoelliptic point, the drug complex with B DNA exhibits positive ellipticity while with Z DNA it exhibits negative ellipticity. 31P-NMR spectra of the chromomycin A3 complex with the Z form of poly(dG-m5dC) demonstrate that the Z conformation is retained in the drug complex up to one molecule drug/four base pairs. At Mg2+ concentrations lower than that necessary to stabilize the left-handed conformation of poly(dG-m5dC) alone, 31P analysis shows that chromomycin A3 can bind simultaneously to both the B and Z conformations of poly(dG-m5dC), with no effect on the B-Z equilibrium. These data demonstrate that chromomycin A3 binds to left-handed poly(dG-m5dC) with retention of the left-handed conformation up to saturating drug concentrations.     

A mammalian factor that binds telomeric TTAGGG repeats in vitro.

We have identified a DNA-binding activity with specificity for the TTAGGG repeat arrays found at mammalian telomeres. This factor, called TTAGGG repeat factor (TRF), is present in nuclear extracts of human, mouse, and monkey cells. TRF from HeLa cells was characterized in detail by electrophoretic mobility shift assays. It binds double-stranded TTAGGG repeats in linear and circular DNAs. Single-stranded repeats are not recognized. The optimal site for TRF appears to contain more than six contiguous TTAGGG repeats. Tandem arrays of TAGGG, TTTAGGG, TTTTAGGG, TTGGGG, and TTAGGC repeats do not bind TRF well, indicating that TRF preferentially recognizes the telomeric repeat sequence present at mammalian chromosome ends. The apparent molecular mass of this factor, based on recovery of TRF from sodium dodecyl sulfate-polyacrylamide gels, is approximately 50 kDa. We suggest that TRF binds along the length of mammalian telomeres.     

Cell death inhibiting RNA (CDIR) derived from a 3'-untranslated region binds AUF1 and heat shock protein 27

Regulators of programmed cell death were previously identified using a technical knockout genetic screen. Among the elements that inhibited interferon-gamma-induced apoptosis of HeLa cells was a 441-nucleotide fragment derived from the 3'-untranslated region (UTR) of KIAA0425, a gene of unknown function. This fragment was termed cell death inhibiting RNA (CDIR). Deletion and mutation analyses of CDIR were employed to identify the features required for its anti-apoptotic activity. Single nucleotide alterations within either copy of the duplicated U-rich motif found in the CDIR sequence abolished the anti-apoptotic activity of CDIR and altered its in vitro association with a protein complex. Further analysis of the CDIR-binding complex indicated that it contained heat shock protein 27 (Hsp27) and the regulator of mRNA turnover AUF1 (heterogeneous nuclear ribonucleoprotein D). In addition, recombinant AUF1 bound directly to CDIR. Furthermore, expression of another AUF1-binding RNA element, derived from the 3'-UTR of c-myc, inhibited apoptosis. We also demonstrate that the level and the stability of p21(waf1/Cip1/sdi1) mRNA, a target of AUF1 with anti-apoptotic activity, were increased in CDIR-transfected cells. The level of mRNA and protein of Bcl-2, another anti-apoptotic gene, containing an AUF1 binding site in its 3'-UTR was also increased in CDIR-transfected cells. Our data suggest that AUF1 regulates apoptosis by altering mRNA turnover. We propose that CDIR inhibits apoptosis by acting as a competitive inhibitor of AUF1, preventing AUF1 from binding to its targets.     

The multifunctional poly(A)-binding protein (PABP) 1 is subject to extensive dynamic post-translational modification, which molecular modelling suggests plays an important role in co-ordinating its activities

PABP1 [poly(A)-binding protein 1] is a central regulator of mRNA translation and stability and is required for miRNA (microRNA)-mediated regulation and nonsense-mediated decay. Numerous protein, as well as RNA, interactions underlie its multi-functional nature; however, it is unclear how its different activities are co-ordinated, since many partners interact via overlapping binding sites. In the present study, we show that human PABP1 is subject to elaborate post-translational modification, identifying 14 modifications located throughout the functional domains, all but one of which are conserved in mouse. Intriguingly, PABP1 contains glutamate and aspartate methylations, modifications of unknown function in eukaryotes, as well as lysine and arginine methylations, and lysine acetylations. The latter dramatically alter the pI of PABP1, an effect also observed during the cell cycle, suggesting that different biological processes/stimuli can regulate its modification status, although PABP1 also probably exists in differentially modified subpopulations within cells. Two lysine residues were differentially acetylated or methylated, revealing that PABP1 may be the first example of a cytoplasmic protein utilizing a 'methylation/acetylation switch'. Modelling using available structures implicates these modifications in regulating interactions with individual PAM2 (PABP-interacting motif 2)-containing proteins, suggesting a direct link between PABP1 modification status and the formation of distinct mRNP (messenger ribonucleoprotein) complexes that regulate mRNA fate in the cytoplasm.     

A nuclear matrix-associated factor, SAF-B, interacts with specific isoforms of AUF1/hnRNP D

One class of heterogeneous nuclear ribonucleoproteins (hnRNPs), AUF1/hnRNP D, consists of four isoform proteins (p45, p42, p40, and p37) which are generated by alternative splicing. The present study was therefore undertaken to clarify any isoform-specific differences in terms of their functions and nucleocytoplasmic localization. All isoforms primarily localized in the nucleus. However, heterokaryon analysis and a study using RNA polymerase II inhibitor revealed that p40/p37 exhibited a continuous shuttling between the nucleus and cytoplasm. Constant nuclear retention activity was mapped to the p45/p42-specific sequence at the C-terminal region, which is retained by alternative splicing. Using this domain as a probe, we performed a yeast two-hybrid screening and we found that scaffold attachment factor B (SAF-B), a nuclear matrix-associated protein, exhibits protein-protein interaction to this region. Colocalization of p45/p42 and SAF-B was observed as a speckle in the nucleus. Interestingly, p45/p42 isoforms appeared to act as a negative regulator in gene expression by forming a complex with SAF-B. Thus, the present study revealed that the isoform-specific functions of AUF1/hnRNP D are defined by intracellular shuttling capacity.     

Poly(rA) binds poly(rG).poly(rC) to form a triple helix.

Poly(rA) binds poly(rG).poly(rC) to form a triple helix. Evidence for this structure includes ultraviolet absorbance mixing curves and melting curves, and circular dichroism spectroscopy. The formation of the triple helix depends on the length of the poly(rC) strand. Triple helix forms when the average length is around 100 nucleotides but does not form when the average length is about 500 nucleotides.     

Molecular recognition of nucleic acids: coralyne binds strongly to poly(A)

The small molecule coralyne was found to bind preferentially and strongly to single-stranded poly(A) with an apparent association constant (Ka) of (1.8+/-0.3) x 10(6)M(-1). Binding of coralyne to poly(A) is predominantly enthalpically driven with a stoichiometry of one coralyne per four adenine bases. Poly(A) forms a coralyne dependent secondary structure with a melting temperature of 60 degrees C, for the conditions of our study.