Enzymatic alteration of the anticodon IAC of Torulopsis tRNAVal to IAU for isoleucine anticodon and aminoacylation of the variant

By enzymatic cleavage and ligation of tRNAVa1, its anticodon sequence IAC was altered to IAU, the anticodon of tRNAI1e. Valine acceptor activity of this variant tRNAVa1 (IAU) was reduced to the extent much lower than tyrosine acceptability of the previously prepared tRNATyr (GAA) (anticodon for tRNAPhe). Isoleucine acceptor activity was undetected, contrary to tRNATyr (GAA) which accepted phenylalanine weakly. Cleavage of tRNAVa1 (IAC) between IACA37 and C38 of its anticodon loop reduced the valine acceptor activity, suggesting some contribution of the conformation of the anticodon loop to the aminoacylation reaction.     

Isoaccepting lysine transfer ribonucleic acid species of Pseudomonas aeruginosa.

Pseudomonas aeruginosa tRNA was treated with iodine, CNBr and N-ethylmaleimide, three thionucleotide-specific reagents. Reaction with iodine resulted in extensive loss of acceptor activity by lysine tRNA, glutamic acid tRNA, glutamine tRNA, serine tRNA and tyrosine tRNA. CNBr treatment resulted in high loss of acceptor ability by lysine tRNA, glutamic acid tRNA and glutamine tRNA. Only the acceptor ability of tyrosine tRNA was inhibited up to 66% by N-ethylmaleimide treatment, a reagent specific for 4-thiouridine. By the combined use of benzoylated DEAE-cellulose and DEAE-Sephadex columns, lysine tRNA of Ps. aeruginosa was resolved into two isoaccepting species, a major, tRNA Lys1 and a minor, tRNALys1. Co-chromatography of 14C-labelled tRNALys1 and 3H-labelled tRNALys2 on benzoylated DEAE-cellulose at pH 4.5 gave two distinct, non-superimposable profiles for the two activity peaks, suggesting that they were separate species. The acceptor activity of these two species was inhibited by about 95% by iodine and CNBr. Both the species showed equal response to codons AAA and AAG and also for poly(A) and poly(A1,G1) suggesting that the anticodon of these species was UUU. Chemical modification of these two species by iodine did not inhibit the coding response. The two species of lysine of Ps. aeruginosa are truly redundant in that they are indistinguishable either by chemical modification or by their coding response.     

molecular mechanism of lysidine synthesis that determines tRNA identity and codon recognition

Lysidine (2-lysyl cytidine) is a lysine-containing cytidine derivative commonly found at the wobble position of bacterial AUA codon-specific tRNA(Ile). This modification determines both codon and amino acid specificities of tRNA(Ile). We previously identified tRNA(Ile)-lysidine synthetase (tilS) that synthesizes lysidine, for which it utilizes ATP and lysine as substrates. Here, we show that lysidine synthesis consists of two consecutive reactions that involve an adenylated tRNA intermediate. A mutation study revealed that Escherichia coli TilS discriminates tRNA(Ile) from the structurally similar tRNA(Met) having the same anticodon loop by recognizing the anticodon loop, the anticodon stem, and the acceptor stem. TilS was shown to bind to the anticodon region and 3' side of the acceptor stem, which cover the recognition sites. These findings reveal a dedicated mechanism embedded in tRNA(Ile) that controls its recognition and discrimination by TilS, and indicate the significance of this enzyme in the proper deciphering of genetic information.     

Nucleotide sequence of three isoaccepting lysine tRNAs from rabbit liver and SV40-transformed mouse fibroblasts.

The lysine isoacceptor tRNAs differ in two aspects from the majority of the other mammalian tRNA species: they do not contain ribosylthymine (T) in loop IV, and a 'new' lysine tRNA, which is practically absent in non-dividing tissue, appears at elevated levels in proliferating cells. We have therefore purified the three major isoaccepting lysine tRNAs from rabbit liver and the 'new' lysine tRNA isolated from SV40-transformed mouse fibroblasts, and determined their nucleotide sequences. Our basic findings are as follows. a) The three major lysine tRNAs (species 1, 2 and 3) from rabbit liver contain 2'-O-methylribosylthymine (Tm) in place of T. tRNA1Lys and tRNA2Lys differ only by a single base pair in the middle of the anticodon stem; the anticodon sequence C-U-U is followed by N-threonyl-adenosine (t6A). TRNA3Lys has the anticodon S-U-U and contains two highly modified thionucleosides, S (shown to be 2-thio-5-carboxymethyl-uridine methyl ester) and a further modified derivative of t6 A (2-methyl-thio-N6-threonyl-adenosine) on the 3' side of the anticodon. tRNA3Lys differs in 14 and 16 positions, respectively, from the other two isoacceptors. b) Protein synthesis in vitro, using synthetic polynucleotides of defined sequence, showed that tRNA2Lys with anticodon C-U-U recognized A-A-G only, whereas tRNA3Lys, which contains thio-nucleotides in and next to the anticodon, decodes both lysine codons A-A-G and A-A-A, but with a preference for A-A-A. In a globin-mRNA-translating cell-free system from ascites cells, both lysine tRNAs donated lysine into globin. The rate and extent of lysine incorporation, however, was higher with tRNA2Lys than with tRNA3Lys, in agreement with the fact that alpha-globin and beta-globin mRNAs contain more A-A-G than A-A-A- codons for lysine. c) A comparison of the nucleotide sequences of lysine tRNA species 1, 2 and 3 from rabbit liver, with that of the 'new' tRNA4Lys from transformed and rapidly dividing cells showed that this tRNA is not the product of a new gene or group of genes, but is an undermodified tRNA derived exclusively from tRNA2Lys. Of the two dihydrouridines present in tRNA2Lys, one is found as U in tRNA4Lys; the purine next to the anticodon is as yet unidentified but is known not be t6 A. In addition we have found U, T and psi besides Tm as the first nucleoside in loop IV.     

An anticodon change switches the identity of E. coli tRNA(mMet) from methionine to threonine.

Recent evidence indicates that the anticodon may often play a crucial role in selection of tRNAs by aminoacyl-tRNA synthetases. In order to quantitate the contribution of the anticodon to discrimination between cognate and noncognate tRNAs by E. coli threonyl-tRNA synthetase, derivatives of the E. coli elongator methionine tRNA (tRNA(mMet)) containing wild type and threonine anticodons have been synthesized in vitro and assayed for threonine acceptor activity. Substitution of the threonine anticodon GGU for the methionine anticodon CAU increased the threonine acceptor activity of tRNA(mMet) by four orders of magnitude while reducing methionine acceptor activity by an even greater amount. These results indicate that the anticodon is the major element which determines the identity of both threonine and methionine tRNAs.     

Transfer RNA Identity Change in Anticodon Variants of E. coli tRNAPhe in Vivo

The anticodon sequence is a major recognition element for most aminoacyl-tRNA synthetases. We investigated the in vivo effects of changing the anticodon on the aminoacylation specificity in the example of E. coli tRNA^Phe. Constructing different anticodon mutants of E. coli tRNA^Phe by site-directed mutagenesis, we isolated 22 anticodon mutant tRNA^Phe; the anticodons corresponded to 16 amino acids and an opal stop codon. To examine whether the mutant tRNAs had changed their amino acid acceptor specificity in vivo, we tested the viability of E. coli strains containing these tRNA^Phe genes in a medium which permitted tRNA induction. Fourteen mutant tRNA genes did not affect host viability. However, eight mutant tRNA genes were toxic to the host and prevented growth, presumably because the anticodon mutants led to translational errors. Many mutant tRNAs which did not affect host viability were not aminoacylated in vivo. Three mutant tRNAs containing anticodon sequences corresponding to lysine (UUU), methionine (CAU) and threonine (UGU) were charged with the amino acid corresponding to their anticodon, but not with phenylalanine. These three tRNAs and tRNA^Phe are located in the same cluster in a sequence similarity dendrogram of total E. coli tRNAs. The results support the idea that such tRNAs arising from in vivo evolution are derived by anticodon change from the same ancestor tRNA.     

Acceptor stem and anticodon RNA hairpin helix interactions with glutamine tRNA synthetase

The class I glutamine (Gln) tRNA synthetase interacts with the anticodon and acceptor stem of glutamine tRNA. RNA hairpin helices were designed to probe acceptor stem and anticodon stem-loop contacts. A seven-base pair RNA microhelix derived from the acceptor stem of tRNA^Gln was aminoacylated by Gln tRNA synthetase. Variants of the glutamine acceptor stem microhelix implicated the discriminator base as a major identity element for glutaminylation of the RNA helix. A second RNA microhelix representing the anticodon stem-loop competitively inhibited tRNA^Gln charging. However, the anticodon stem-loop microhelix did not enhance aminoacylation of the acceptor stem microhelix. Thus, transduction of the anticodon identity signal may require covalent continuity of the tRNA chain to trigger efficient aminoacylation.     

Mutual conformational changes of tryptophanyl-tRNA synthetase and tRNATrp in the course of their specific interaction

tRNATrp (beef, yeast) is capable of accelerating limited tryptic hydrolysis of the N-terminal part in the polypeptide chains of dimeric beef pancreas tryptophanyl-tRNA synthetase; it can also eliminate the protective effect of tryptophanyl adenylate on the enzyme proteolysis. The effect of tRNA on the proteolysis is manifested even when the 3'-CCA terminus is removed. It has been concluded that the conformation of the synthetase changes when it forms a complex with tRNATrp. Yeast tRNATrp lacking the 3'-half of the acceptor stem can still interact with the synthetase and, to certain extent, induces changes in the conformation of the latter. The susceptibility of single-stranded and double-stranded regions of tRNATrp to cleavage with endonucleases has been studied, and the results are indicative of the fact that, regardless of considerable differences in the nucleotide sequence of yeast and beef tRNATrp, their three-dimensional structures are similar. This fact is consistent with the finding that parameters for the interaction of these tRNAsTrp with beef tryptophanyl-tRNA synthetase are rather close. The three-dimensional structure of tRNATrp is altered when the enzyme forms a complex with it, as seen from (a) a change in the circular dichroic spectrum and (b) an elevated susceptibility of the anticodon and, apparently, acceptor stems to cleavage with nuclease. The conversion of exposed cytidine residues in tRNATrp into uridine residues results in a loss of the acceptor activity; the capability to accelerate limited tryptic hydrolysis of tryptophanyl-tRNA synthetase is also lost although the enzyme-substrate complex, as seen from circular dichroic spectra, can still be formed. The conversion of cytosine in the anticodon stem into uracil modifies the conformation of the anticodon stem. The anticodon arm (including the anticodon) and the acceptor stem play an essential role in the interaction between tRNATrp and tryptophanyl-tRNA synthetase.     

Suppression of amber codons in vivo as evidence that mutants derived from Escherichia coli initiator tRNA can act at the step of elongation in protein synthesis

The absence of a Watson-Crick base pair at the end of the amino acid acceptor stem is one of the features which distinguishes prokaryotic initiator tRNAs as a class from all other tRNAs. We show that this structural feature prevents Escherichia coli initiator tRNA from acting as an elongator in protein synthesis in vivo. We generated a mutant of E. coli initiator tRNA in which the anticodon sequence is changed from CAU to CUA (the T35A36 mutant). This mutant tRNA has the potential to read the amber termination codon UAG. We then coupled this mutation to others which change the C1.A72 mismatch at the end of the acceptor stem to either a U1:A72 base pair (T1 mutant) or a C1:G72 base pair (G72 mutant). Transformation of E. coli CA274 (HfrC Su- lacZ125am trpEam) with multicopy plasmids carrying the mutant initiator tRNA genes show that mutant tRNAs carrying changes in both the anticodon sequence and the acceptor stem suppress amber codons in vivo, whereas mutant tRNA with changes in the anticodon sequence alone does not. Mutant tRNAs with the above anticodon sequence change are aminoacylated with glutamine in vitro. Measurement of kinetic parameters for aminoacylation by E. coli glutaminyl-tRNA synthetase show that both the nature of the base pair at the end of the acceptor stem and the presence or absence of a base pair at this position can affect aminoacylation kinetics. We discuss the implications of this result on recognition of tRNAs by E. coli glutaminyl-tRNA synthetase.     

Mimics of yeast tRNAAsp and their recognition by aspartyl-tRNA synthetase.

Assuming that the L-shaped three-dimensional structure of tRNA is an architectural framework allowing the proper presentation of identity nucleotides to aminoacyl-tRNA synthetases implies that altered and/or simplified RNA architectures can fulfill this role and be functional substrates of these enzymes, provided they contain correctly located identity elements. In this work, this paradigm was submitted to new experimental verification. Yeast aspartyl-tRNA synthetase was the model synthetase, and the extent to which the canonical structural framework of cognate tRNAAsp can be altered without losing its ability to be aminoacylated was investigated. Three novel architectures recognized by the synthetase were found. The first resembles that of metazoan mitochondrial tRNASer lacking the D-arm. The second lacks both the D- and T-arms, and the 5'-strand of the amino acid acceptor arm. The third structure is a construct in which the acceptor and anticodon helices are joined by two connectors. Aspartylation specificity of these RNAs is verified by the loss of aminoacylation activity upon mutation of the putative identity residues. Kinetic data indicate that the first two architectures are mimics of the whole tRNAAsp molecule, while the third one behaves as an aspartate minihelix mimic. Results confirm the primordial role of the discriminator nucleotide G73 in aspartylation and demonstrate that neither a helical structure in the acceptor domain nor the presence of a D- or T-arm is mandatory for specific aspartylation, but that activity relies on the presence of the cognate aspartate GUC sequence in the anticodon loop.     

Divergent adaptation of tRNA recognition by Methanococcus jannaschii prolyl-tRNA synthetase

Analysis of prolyl-tRNA synthetase (ProRS) across all three taxonomic domains (Eubacteria, Eucarya, and Archaea) reveals that the sequences are divided into two distinct groups. Recent studies show that Escherichia coli ProRS, a member of the "prokaryotic-like" group, recognizes specific tRNA bases at both the acceptor and anticodon ends, whereas human ProRS, a member of the "eukaryotic-like" group, recognizes nucleotide bases primarily in the anticodon. The archaeal Methanococcus jannaschii ProRS is a member of the eukaryotic-like group, although its tRNA(Pro) possesses prokaryotic features in the acceptor stem. We show here that, in some respects, recognition of tRNA(Pro) by M. jannaschii ProRS parallels that of human, with a strong emphasis on the anticodon and only weak recognition of the acceptor stem. However, our data also indicate differences in the details of the anticodon recognition between these two eukaryotic-like synthetases. Although the human enzyme places a stronger emphasis on G35, the M. jannaschii enzyme places a stronger emphasis on G36, a feature that is shared by E. coli ProRS. These results, interpreted in the context of an extensive sequence alignment, provide evidence of divergent adaptation by M. jannaschii ProRS; recognition of the tRNA acceptor end is eukaryotic-like, whereas the details of the anticodon recognition are prokaryotic-like. This divergence may be a reflection of the unusual dual function of this enzyme, which catalyzes specific aminoacylation with proline as well as with cysteine.     

Lysine tRNAs from rat liver: lysine tRNA sequences are highly conserved

The two major lysine tRNAs from rat liver, tRNA2Lys and tRNA5Lys, were sequenced by rapid gel or chromatogram readout methods. The major tRNA2Lys differs from a minor form only by a base pair in positions 29 and 41; both tRNAs have an unidentified nucleotide, U**, in the third position of the anticodon. Although highly related, the major tRNA2Lys and tRNA5Lys differ in four base pairs and four unpaired nucleotides, including the first position of the anticodons, but have the same base pair in positions 29 and 41. The three tRNAs maintain a m2G-U pair in the acceptor stem. Detection of this m2G is in contrast to other reports of lysine tRNAs. Sequences of lysine tRNAs are strongly conserved in higher eukaryotes.     

The presence of pseudouridine in the anticodon alters the genetic code: a possible mechanism for assignment of the AAA lysine codon as asparagine in echinoderm mitochondria

It has been inferred from DNA sequence analyses that in echinoderm mitochondria not only the usual asparagine codons AAU and AAC, but also the usual lysine codon AAA, are translated as asparagine by a single mitochondrial (mt) tRNAAsn with the anticodon GUU. Nucleotide sequencing of starfish mt tRNAAsn revealed that the anticodon is GPsiU, U35 at the anticodon second position being modified to pseudouridine (Psi). In contrast, mt tRNALys, corresponding to another lysine codon, AAG, has the anticodon CUU. mt tRNAs possessing anti-codons closely related to that of tRNAAsn, but responsible for decoding only two codons each-tRNAHis, tRNAAsp and tRNATyr-were found to possess unmodified U35 in all cases, suggesting the importance of Psi35 for decoding the three codons. Therefore, the decoding capabilities of two synthetic Escherichia coli tRNAAla variants with the anticodon GPsiU or GUU were examined using an E.coli in vitro translation system. Both tRNAs could translate not only AAC and AAU with similar efficiency, but also AAA with an efficiency that was approximately 2-fold higher in the case of tRNAAlaGPsiU than tRNAAlaGUU. These findings imply that Psi35 of echinoderm mt tRNAAsn actually serves to decode the unusual asparagine codon AAA, resulting in the alteration of the genetic code in echinoderm mitochondria.     

Calcium induction of transglutaminase and the formation of epsilon(gamma-glutamyl) lysine cross-links in cultured mouse epidermal cells

A lysine tRNA (anticodon U¹UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm¹Am²GCUUAGAGCm²GUUAACCU$\text{U}{}^1\text{UU}$-t⁶AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCA_OH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U¹27 (probably 5-methoxycarbonylmethyluridine) and t⁶A30 (N-[N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U¹ in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t⁶A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon.     

Rare transfer ribonucleic acid essential for phage growth. Nucleotide sequence comparison of normal and mutant T4 isoleucine-accepting transfer ribonucleic acid.

One of the eight tRNA species coded by bacteriophage T4 is unique in that (1) it is found in a yield lower by three- to fourfold than that of any other tRNA and (2) while dispensable for growth in standard laboratory hosts, it is essential for phage propagation in a natural isolate of Escherichia coli (strain CT439). We report here the nucleotide sequence of this tRNA and of several mutationally altered forms. The molecule is 77 nucleotides in length and has the anticodon N-A-U. Depending on the pairing properties of the "wobble" nucleotide N, this sequence could correspond to one or more of the isoleucine-specific codons (formula: see text) or to the methionine-specific codon A-U-G. Since a T4-specific acceptor activity for isoleucine which is stimulated in ribosome binding by A-U-A but not A-U-U has been reported previously, we infer that we have sequenced a tRNA Ile species which preferentially recognizes A-U-A. Mutant HA1 is unable to grow in CT439; it produces no tRNA Ile. The primary mutational alteration is a transition four residues from the 5'terminus which converts a C.G to a U.G base pair. The consequences of this lesion can be partially reversed by second-site mutations nearby in the acceptor stem. Unexpectedly, the tRNA Ile synthesized in these revertants still retains two unusual structural features found in the wild-type molecule: the opposition of two Up residues in the amino acid acceptor stem and the opposition of an Ap and a Gp residue in the anticodon stem. Implications of these structual anomalies for a possibly unique physiological role of this minor tRNA species are discussed.     

Rabbit liver tRNA1Val:I. Primary structure and unusual codon recognition.

The major valine acceptor tRNA1Val from rabbit liver was purified and its nucleotide sequence determined by in vitro [32P] - labeling with T4 phage induced polynucleotide kinase and finger-printing techniques. Its primary structure was found to be identical with the major valine tRNA from mouse myeloma cells. According to the wobble hypothesis this tRNA, which exclusively has an IAC anticodon, should decode the valine codons GUU, GUC and GUA only. However, this tRNA recognizes all four valine codons with a surprising preference for GUG. It is unknown whether this is due to the lack of A37 modification next to the 3' end of the anticodon IAC. The nature of the inosine-guanosine interaction remains to be clarified.