Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.     

Nonradioactive method to detect native single-stranded G-tails on yeast telomeres using a modified Southern blot protocol

Because of their low abundance and short length, telomeric single-stranded extensions have not traditionally been assessed by Southern blot analysis. Instead, most methods have relied on hybridizing radioactively labeled oligonucleotide probes to electrophoresed DNA within agarose gels. Here we describe a rapid and nonradioactive Southern blot-derived method to transfer and detect telomeric single-stranded G-rich overhangs (G-tails) under nondenaturing (native) conditions, using Saccharomyces cerevisiae DNA. Restriction enzyme-digested chromosomal DNA is separated by agarose gel electrophoresis, transferred onto a charged membrane by electroblotting under nondenaturing conditions, and probed with a digoxigenin (DIG)-labeled oligonucleotide. Compared with the prolonged film exposure required to detect radioactive probes, detection of short single-strand G-tails with this method takes mere minutes. Furthermore, following detection of the single-stranded G-tails, the DNA on the membrane can be denatured and reprobed using conventional hybridization and detection methods.     

In vitro properties of the conserved mammalian protein hnRNP D suggest a role in telomere maintenance

Mammalian chromosomes terminate with a 3' tail which consists of reiterations of the G-rich repeat, d(TTAGGG). The telomeric tail is the primer for replication by telomerase, and it may also invade telomeric duplex DNA to form terminal lariat structures, or T loops. Here we show that the ubiquitous and highly conserved mammalian protein hnRNP D interacts specifically with the G-rich strand of the telomeric repeat. A single gene encodes multiple isoforms of hnRNP D. All isoforms bind comparably to the G-rich strand, and certain isoforms can also bind tightly and specifically to the C-rich telomeric strand. G-rich telomeric sequences readily form structures stabilized by G-G pairing, which can interfere with telomere replication by telomerase. We show that hnRNP D binding to the G-rich strand destabilizes intrastrand G-G pairing and that hnRNP D interacts specifically with telomerase in human cell extracts. This biochemical analysis suggest that hnRNP D could function in vivo to destabilize structures formed by telomeric G-rich tails and facilitate their extension by telomerase.     

Intramolecular Telomeric G-Quadruplexes Dramatically Inhibit DNA Synthesis by Replicative and Translesion Polymerases,Revealing their Potential to Lead to Genetic Change

Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.     

Neil3 and NEIL1 DNA Glycosylases Remove Oxidative Damages from Quadruplex DNA and Exhibit Preferences for Lesions in the Telomeric Sequence Context

The telomeric DNA of vertebrates consists of d(TTAGGG)_n tandem repeats, which can form quadruplex DNA structures in vitro and likely in vivo. Despite the fact that the G-rich telomeric DNA is susceptible to oxidation, few biochemical studies of base excision repair in telomeric DNA and quadruplex structures have been done. Here, we show that telomeric DNA containing thymine glycol (Tg), 8-oxo-7,8-dihydroguanine (8-oxoG), guanidinohydantoin (Gh), or spiroiminodihydantoin (Sp) can form quadruplex DNA structures in vitro. We have tested the base excision activities of five mammalian DNA glycosylases (NEIL1, NEIL2, mNeil3, NTH1, and OGG1) on these lesion-containing quadruplex substrates and found that only mNeil3 had excision activity on Tg in quadruplex DNA and that the glycosylase exhibited a strong preference for Tg in the telomeric sequence context. Although Sp and Gh in quadruplex DNA were good substrates for mNeil3 and NEIL1, none of the glycosylases had activity on quadruplex DNA containing 8-oxoG. In addition, NEIL1 but not mNeil3 showed enhanced glycosylase activity on Gh in the telomeric sequence context. These data suggest that one role for Neil3 and NEIL1 is to repair DNA base damages in telomeres in vivo and that Neil3 and Neil1 may function in quadruplex-mediated cellular events, such as gene regulation via removal of damaged bases from quadruplex DNA.     

Interaction of an Arabidopsis RNA-binding protein with plant single-stranded telomeric DNA modulates telomerase activity

Telomeres are the specialized structures at the end of linear chromosomes and terminate with a single-stranded 3' overhang of the G-rich strand. The primary role of telomeres is to protect chromosome ends from recombination and fusion and from being recognized as broken DNA ends. This protective function can be achieved through association with specific telomere-binding proteins. Although proteins that bind single-stranded G-rich overhang regulate telomere length and telomerase activity in mammals and lower eukaryotes, equivalent factors have yet to be identified in plants. Here we have identified proteins capable of interacting with the G-rich single-stranded telomeric repeat from the Arabidopsis extracts by affinity chromatography. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry analysis indicates that the isolated protein is a chloroplast RNA-binding protein (and a truncated derivative). The truncated derivative, which we refer to as STEP1 (single-stranded telomere-binding protein 1), binds specifically the single-stranded G-rich plant telomeric DNA sequences but not double-stranded telomeric DNA. Unlike the chloroplast-localized full-length RNA-binding protein, STEP1 localizes exclusively to the nucleus, suggesting that it plays a role in plant telomere biogenesis. We also demonstrated that the specific binding of STEP1 to single-stranded telomeric DNA inhibits telomerase-mediated telomere extension. The evidence presented here suggests that STEP1 is a telomere-end binding protein that may contribute to telomere length regulation by capping the ends of chromosomes and thereby repressing telomerase activity in plants.     

Site-directed mutagenesis using positive antibiotic selection

Various mutsgenesis protocols have been established that use the hybridization of a mismatched oligonucleotide to prime DNA synthesis on an M13 phagemid template. For efficient mutagenesis, all of these methods require a means to select for the mutant strand before or during amplification in anEscherichia coli host. In the Altered Sites II protocol, the mismatched oligonucleotide and an oligonucleotide that restores antibiotic resistance to the phagemid are simultaneously hybridized to the template and coupled by DNA synthesis and ligation. The restored antibiotic resistance is then used to select only those phagemids which incorporate the antibiotic repair oligonucleotide. Generally, between 60 and 90% of the phagemids recovered will incorporate both oligonucleotides. This method provides a simple an efficient technique for introducing specific mutations into DNA.     

Oligonucleotide-primed in situ DNA synthesis (PRINS): a method for chromosome mapping, banding, and investigation of sequence organization

Oligonucleotides were annealed to complementary sequences in fixed human metaphase chromosomes and extended with DNA polymerase. The newly synthesized fragments were labeled by incorporating bio-11-dUTP instead of TTP, and the sites of synthesis were detected by immunocytochemistry, using fluorochromes as the reporter molecules. We have obtained clear localization with oligonucleotides from alphoid (centromeric sequences), simple sequence (satellite) DNAs, a variety of Alu-dispersed repeated sequences, and oligonucleotides derived from the Tetrahymena and Trypanosoma telomere-specific sequences. The simple sequence and alphoid oligonucleotides gave results at least comparable to those obtained using the whole molecule as a probe for in situ hybridization, whereas the Alu oligonucleotides produced a diversity of results which depended on the absolute length and location of the oligonucleotide within the Alu sequence. The telomere-specific oligomers also produced a variety of results. The G-rich Trypanosoma oligomer and its complementary C-rich sequence produced strong telomeric signals and some interstitial signals on mouse chromosomes, but only weak telomeric signals on human chromosomes. The G-rich Tetrahymena oligomer produced detectable telomeric signals on human chromosomes. The technique appears to be a valuable extension of present tools for mapping and examining the organization of DNA sequences within chromosomes.     

Leishmania amazonensis: Partial purification and study of the biochemical properties of the telomerase reverse transcriptase activity from promastigote-stage

Telomeres are protein–DNA complexes that protect chromosome ends from degradation and fusion. In Leishmania spp., telomeric DNA comprises a conserved TTAGGG repeat and is maintained by telomerase. Telomerase is a multisubunit enzymatic complex that ensures the complete DNA replication by adding new telomeric repeats to the G-rich strand. In this report we aimed to purify and study the biochemical properties of Leishmani amazonensis telomerase. In a first trial we used affinity chromatography with antisense 2′-O-methyl oligonucleotide without success since the Leishmania telomerase, similarly to Trypanosoma cruzi enzyme, was not eluted by competition, but instead, it remained bound to the column. Partially purified L. amazonensis telomerase activity was achieved by fractionation of extracts on complementary ion exchange and Heparin columns. Further purification of these fractions on a G-rich telomeric DNA affinity chromatography enriched for telomerase activity. The knowledge of telomerase characteristics in Leishmania could help to develop new strategies to overcome leishmaniasis.     

Interaction of telomestatin with the telomeric single-strand overhang

The extremities of chromosomes end in a G-rich single-stranded overhang that has been implicated in the onset of the replicative senescence. The repeated sequence forming a G-overhang is able to adopt a peculiar four-stranded DNA structure in vitro called a G-quadruplex, which is a poor substrate for telomerase. Small molecule ligands that selectively stabilize the telomeric G-quadruplex induce telomere shortening and a delayed growth arrest. Here we show that the G-quadruplex ligand telomestatin has a dramatic effect on the conformation of intracellular G-overhangs. Competition experiments indicate that telomestatin strongly binds in vitro and in vivo to the telomeric overhang and impairs its single-stranded conformation. Long-term treatment of cells with telomestatin greatly reduces the G-overhang size, as evidenced by specific hybridization or telomeric oligonucleotide ligation assay experiments, with a concomitant delayed loss of cell viability. In vivo protection experiments using dimethyl sulfate also indicate that telomestatin treatment alters the dimethyl sulfate effect on G-overhangs, a result compatible with the formation of a local quadruplex structure at telomeric overhang. Altogether these experiments strongly support the hypothesis that the telomeric G-overhang is an intracellular target for the action of telomestatin.     

DNA-induced dimerization of the single-stranded DNA binding telomeric protein Pot1 from Schizosaccharomyces pombe

Eukaryotic chromosome ends are protected from illicit DNA joining by protein-DNA complexes called telomeres. In most studied organisms, telomeric DNA is composed of multiple short G-rich repeats that end in a single-stranded tail that is protected by the protein POT1. Mammalian POT1 binds two telomeric repeats as a monomer in a sequence-specific manner, and discriminates against RNA of telomeric sequence. While addressing the RNA discrimination properties of SpPot1, the POT1 homolog in Schizosaccharomyces pombe, we found an unanticipated ssDNA-binding mode in which two SpPot1 molecules bind an oligonucleotide containing two telomeric repeats. DNA binding seems to be achieved via binding of the most N-terminal OB domain of each monomer to each telomeric repeat. The SpPot1 dimer may have evolved to accommodate the heterogeneous spacers that occur between S. pombe telomeric repeats, and it also has implications for telomere architecture. We further show that the S. pombe telomeric protein Tpz1, like its mammalian homolog TPP1, increases the affinity of Pot1 for telomeric single-stranded DNA and enhances the discrimination of Pot1 against RNA.     

A multi-approach analysis highlights the relevance of RPA-1 as a telomere end-binding protein (TEBP) in Leishmania amazonensis

BackgroundTelomeres are chromosome end structures important in the maintenance of genome homeostasis. They are replenished by the action of telomerase and associated proteins, such as the OB (oligonucleotide/oligosaccharide-binding)-fold containing telomere-end binding proteins (TEBP) which plays an essential role in telomere maintenance and protection. The nature of TEBPs is well known in higher and some primitive eukaryotes, but it remains undetermined in trypanosomatids. Previous in silico searches have shown that there are no homologs of the classical TEPBs in trypanosomatids, including Leishmania sp. However, Replication Protein A subunit 1 (RPA-1), an OB-fold containing DNA-binding protein, was found co-localized with trypanosomatids telomeres and showed a high preference for the telomeric G-rich strand.Methods and resultsWe predicted the absence of structural homologs of OB-fold containing TEBPs in the Leishmania sp. genome using structural comparisons. We demonstrated by molecular docking that the ssDNA binding mode of LaRPA-1 shares features with the higher eukaryotes POT1 and RPA-1 crystal structures ssDNA binding mode. Using fluorescence spectroscopy, protein-DNA interaction assays, and FRET, we respectively show that LaRPA-1 shares some telomeric functions with the classical TEBPs since it can bind at least one telomeric repeat, protect the telomeric G-rich DNA from 3′-5′ Exonuclease I digestion, and unfold telomeric G-quadruplex.ConclusionsOur results suggest that RPA-1 emerges as a TEBP in trypanosomatids, and in this context, we present two possible evolutionary landscapes of trypanosomatids RPA-1 that could reflect upon the evolution of OB-fold containing TEBPs from all eukaryotes.     

Multiple POT1-TPP1 proteins coat and compact long telomeric single-stranded DNA

Telomeres are nucleoprotein complexes that cap and protect the ends of linear chromosomes. In humans, telomeres end in 50-300 nt of G-rich single-stranded DNA (ssDNA) overhangs. Protection of telomeres 1 (POT1) binds with nanomolar affinity to the ssDNA overhangs and forms a dimer with another telomere-end binding protein called TPP1. Whereas most previous studies utilized telomeric oligonucleotides comprising single POT1-TPP1 binding sites, here, we examined 72- to 144-nt tracts of telomeric DNA containing 6-12 POT1-TPP1 binding sites. Using electrophoretic mobility gel shift assays, size-exclusion chromatography, and electron microscopy, we analyzed telomeric nucleoprotein complexes containing POT1 alone, POT1-TPP1, and a truncated version of POT1 (POT1-N) that maintains its DNA-binding domain. The results revealed that POT1-N and POT1-TPP1 can completely coat long telomeric ssDNA substrates. Furthermore, we show that ssDNA coated with human POT1-TPP1 heterodimers forms compact, potentially ordered structures.     

Recognition and elongation of telomeres by telomerase

Telomeres stabilize chromosomal ends and allow their complete replication in vivo. In diverse eukaryotes, the essential telomeric DNA sequence consists of variable numbers of tandem repeats of simple, G + C rich sequences, with a strong strand bias of G residues on the strand oriented 5' to 3' toward the chromosomal terminus. This strand forms a protruding 3' over-hang at the chromosomal terminus in three different eukaryotes analyzed. Analysis of yeast and protozoan telomeres showed that telomeres are dynamic structures in vivo, being acted on by shortening and lengthening activities. We previously identified and partially purified an enzymatic activity, telomere terminal transferase, or telomerase, from the ciliate Tetrahymena. Telomerase is a ribonucleoprotein enzyme with essential RNA and protein components. This activity adds repeats of the Tetrahymena telomeric sequence, TTGGGG, onto the 3' end of a single-stranded DNA primer consisting of a few repeats of the G-rich strand of known telomeric, and telomere-like, sequences. The shortest oligonucleotide active as a primer was the decamer G4T2G4. Structural analysis of synthetic DNA oligonucleotides that are active as primers showed that they all formed discrete intramolecular foldback structures at temperatures below 40 degrees C. Addition of TTGGGG repeats occurs one nucleotide at a time by de novo synthesis, which is not templated by the DNA primer. Up to 8000 nucleotides of G4T2 repeats were added to the primer in vitro. We discuss the implications of this finding for regulation of telomerase in vivo and a model for telomere elongation by telomerase.     

Binding properties of human telomeric quadruplex multimers: a new route for drug design

Human telomeric G-quadruplex structures are known to be promising targets for an anticancer therapy. In the past decade, several research groups have been focused on the design of new ligands trying to optimize the interactions between these small molecules and the G-quadruplex motif. In most of these studies, the target structures were the single quadruplex units formed by short human DNA telomeric sequences (typically 21-26 nt). However, the 3′-terminal single-stranded human telomeric DNA is actually 100-200 bases long and can form higher-order structures by clustering several consecutive quadruplex units (multimers). Despite the increasing number of structural information on longer DNA telomeric sequences, very few data are available on the binding properties of these sequences compared with the shorter DNA telomeric sequences.In this paper we use a combination of spectroscopic (CD, UV and fluorescence) and calorimetric techniques (ITC) to compare the binding properties of the (TTAGGG)₈TT structure formed by two adjacent quadruplex units with the binding properties of the (AG₃TT)₄ single quadruplex structure. The three side-chained triazatruxene derivative azatrux and TMPyP4 cationic porphyrin were used as quadruplex ligands. We found that, depending on the drug, the number of binding sites per quadruplex unit available in the multimer structure was smaller or greater than the one expected on the basis of the results obtained from individual quadruplex binding studies. This work suggests that the quadruplex units along a multimer structure do not behave as completely independent. The presence of adjacent quadruplexes results in a diverse binding ability not predictable from single quadruplex binding studies. The existence of quadruplex-quadruplex interfaces in the full length telomeric overhang may provide an advantageous factor in drug design to enhance both affinity and selectivity for DNA telomeric quadruplexes.     

Telomeric repeat mutagenicity in human somatic cells is modulated by repeat orientation and G-quadruplex stability

Telomeres consisting of tandem guanine-rich repeats can form secondary DNA structures called G-quadruplexes that represent potential targets for DNA repair enzymes. While G-quadruplexes interfere with DNA synthesis in vitro, the impact of G-quadruplex formation on telomeric repeat replication in human cells is not clear. We investigated the mutagenicity of telomeric repeats as a function of G-quadruplex folding opportunity and thermal stability using a shuttle vector mutagenesis assay. Since single-stranded DNA during lagging strand replication increases the opportunity for G-quadruplex folding, we tested vectors with G-rich sequences on the lagging versus the leading strand. Contrary to our prediction, vectors containing human [TTAGGG]₁₀ repeats with a G-rich lagging strand were significantly less mutagenic than vectors with a G-rich leading strand, after replication in normal human cells. We show by UV melting experiments that G-quadruplexes from ciliates [TTGGGG]₄ and [TTTTGGGG]₄ are thermally more stable compared to human [TTAGGG]₄. Consistent with this, replication of vectors with ciliate [TTGGGG]₁₀ repeats yielded a 3-fold higher mutant rate compared to the human [TTAGGG]₁₀ vectors. Furthermore, we observed significantly more mutagenic events in the ciliate repeats compared to the human repeats. Our data demonstrate that increased G-quadruplex opportunity (repeat orientation) in human telomeric repeats decreased mutagenicity, while increased thermal stability of telomeric G-quadruplexes was associated with increased mutagenicity.     

Telomerase-dependent repeat divergence at the 3' ends of yeast telomeres

Yeast telomeres consist of ~300 nt of degenerate repeats with the consensus sequence G_2–3(TG)_1–6. We developed a method for the amplification of a genetically marked telomere by PCR, allowing precise length and sequence determination of the G-rich strand including the 3′ terminus. We examined wild-type cells, telomerase RNA deficient cells and a strain deleted for YKU70, which encodes for a protein involved in telomere maintenance and DNA double strand break repair. The 3′ end of the G-rich strand was found to be at a variable position within the telomeric repeat. No preference for either thymine or guanine as the 3′ base was detected. Comparison of telomere sequences from clonal populations revealed that telomeres consist of a centromere-proximal region of stable sequence and a distal region with differing degenerate repeats. In wild-type as well as yku70-Δ cells, variation in the degenerate telomeric repeats was detected starting 40–100 nt from the 3′ end. Sequence divergence was abolished after deletion of the telomerase RNA gene. Thus, this region defines the domain where telomere shortening and telomerase-mediated extension occurs. Since this domain is much larger than the number of nucleo­tides lost per generation in the absence of telomerase, we propose that telomerase does not extend a given telomere in every cell cycle.     

Oligonucleotide Models of Telomeric DNA and RNA Form a Hybrid G-quadruplex Structure as a Potential Component of Telomeres

Telomeric repeat-containing RNA, a non-coding RNA molecule, has recently been found in mammalian cells. The detailed structural features and functions of the telomeric RNA at human chromosome ends remain unclear, although this RNA molecule may be a key component of the telomere machinery. In this study, using model human telomeric DNA and RNA sequences, we demonstrated that human telomeric RNA and DNA oligonucleotides form a DNA-RNA G-quadruplex. We next employed chemistry-based oligonucleotide probes to mimic the naturally formed telomeric DNA-RNA G-quadruplexes in living cells, suggesting that the process of DNA-RNA G-quadruplex formation with oligonucleotide models of telomeric DNA and RNA could occur in cells. Furthermore, we investigated the possible roles of this DNA-RNA G-quadruplex. The formation of the DNA-RNA G-quadruplex causes a significant increase in the clonogenic capacity of cells and has an effect on inhibition of cellular senescence. Here, we have used a model system to provide evidence about the formation of G-quadruplex structures involving telomeric DNA and RNA sequences that have the potential to provide a protective capping structure for telomere ends.