共查询到20条相似文献,搜索用时 15 毫秒
1.
2.
《Biochimica et Biophysica Acta (BBA)/Molecular Cell Research》2020,1867(9):118743
Liver diseases, including hepatitis due to hepatitis B or C virus infection, non-alcoholic fatty liver disease, and hepatocellular carcinoma pose major challenges for overall health due to limited curative treatment options. Thus, there is an urgent need to develop new therapeutic strategies for the treatment of these diseases. A better understanding of the signaling pathways involved in the pathogenesis of liver diseases can help to improve the efficacy of emerging therapies, mainly based on pharmacological approaches, which influence one or more specific molecules involved in key signal transduction pathways. These emerging therapies are very promising for the prevention and treatment of liver diseases. One promising druggable molecular target is the multifunctional serine/threonine kinase, glycogen synthase kinase 3 (GSK-3). In this review, we discuss conditions in which GSK-3 is implicated in liver diseases. In addition, we explore newly emerging drugs that target GSK-3β, as well as their potential use in and impact on the management of liver diseases. 相似文献
3.
Astier J Kulik A Koen E Besson-Bard A Bourque S Jeandroz S Lamotte O Wendehenne D 《Free radical biology & medicine》2012,53(5):1101-1110
Nitric oxide (NO) is now recognized as a key regulator of plant physiological processes. Understanding the mechanisms by which NO exerts its biological functions has been the subject of extensive research. Several components of the signaling pathways relaying NO effects in plants, including second messengers, protein kinases, phytohormones, and target genes, have been characterized. In addition, there is now compelling experimental evidence that NO partly operates through posttranslational modification of proteins, notably via S-nitrosylation and tyrosine nitration. Recently, proteome-wide scale analyses led to the identification of numerous protein candidates for S-nitrosylation in plants. Subsequent biochemical and in silico structural studies revealed certain mechanisms through which S-nitrosylation impacts their functions. Furthermore, first insights into the physiological relevance of S-nitrosylation, particularly in controlling plant immune responses, have been recently reported. Collectively, these discoveries greatly extend our knowledge of NO functions and of the molecular processes inherent to signal transduction in plants. 相似文献
4.
Darabi K Karulin AY Boehm BO Hofstetter HH Fabry Z LaManna JC Chavez JC Tary-Lehmann M Lehmann PV 《Journal of immunology (Baltimore, Md. : 1950)》2004,173(1):92-99
The initial event in the pathogenesis of autoimmune disease is thought to be the priming of naive autoreactive T cells by an infection with a cross-reactive microorganism. Although such cross-reactive priming should be a common event, autoimmune disease does not frequently develop. This situation is reflected after the immunization of C57BL/6 mice with the neuroantigen myelin oligodendrocyte glycoprotein (MOG) with CFA, which primes a type 1 T cell response but does not lead to clinical or histological manifestation of experimental allergic encephalomyelitis unless pertussis toxin is injected in addition. We show in this study that, in MOG:CFA-primed mice, the autoimmune CNS pathology develops after intracerebral deposition of TLR9-activating CpG oligonucleotides, but not following non-CpG oligonucleotide injection or after aseptic cryoinjury of the brain. Thus, access of primed MOG-specific Th1 cells to the uninflamed CNS or to CNS undergoing sterile inflammation did not suffice to elicit autoimmune pathology; only if the APC in the target organ were activated in addition by the TLR9-stimulating microbial product did they exert local effector functions. The data suggest that such licensing of APC in the target organ by microbial stimuli represents a checkpoint for functional self-tolerance. Therefore, microorganisms unrelated to the cross-reactive agent that primes the autoreactive T cells could dictate the onset and exacerbation of autoimmune diseases. 相似文献
5.
Karen Bannert Angela Kuhla Kerstin Abshagen Brigitte Vollmar 《Apoptosis : an international journal on programmed cell death》2014,19(8):1243-1253
A variety of data suggesting apoptotic cell death as a key feature of liver injury stimulated researchers to investigate the therapeutic potential of anti-apoptotic strategies in experimental models. However, the overestimated role of apoptotic cell death in liver injury has tempered the clinical translation of the protection afforded by anti-apoptotic regimes in experimental models. Thus, the hope for apoptosis modulation as potential treatment strategy for injured liver in humans could not be confirmed. Herein, we evaluated the degree of apoptosis in different hepatic stress models which are relevant for the human pathophysiology. Using morphological criteria of apoptosis, caspase-3 activation as well as TUNEL assay in combination with a positive control of apoptosis in liver injury, we quantified apoptotic cell death discriminating between parenchymal and non-parenchymal cells and confirmed these results by cleaved caspase-3 and PARP-1 protein expression. Discussing our findings and relating them to the existing literature on the potential role of apoptotic cell death, we strongly recommend reconsidering anti-apoptotic strategies to ameliorate liver injury efficiently. 相似文献
6.
Originally described in insect viruses, cellular proteins with Baculoviral IAP repeat (BIR) motifs have been thought to function primarily as inhibitors of apoptosis. The subsequent finding that a subset of IAPs that contain a RING domain have ubiquitin protein ligase (E3) activity implied the presence of other functions. It is now known that IAPs are involved in mitotic chromosome segregation, cellular morphogenesis, copper homeostasis, and intracellular signaling. Here, we review the current understanding of the roles of IAPs in apoptotic and nonapoptotic processes and explore the notion that the latter represents the primary physiologic activities of IAPs. 相似文献
7.
DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove. 相似文献
8.
Borah GL 《Plastic and reconstructive surgery》2000,106(6):1418-1420
9.
Sakuragi J 《Uirusu》2011,61(1):91-98
In general, the retrovirus particles become infectious on post-budding with cleavages of structural protein Gag by viral protease. Protease defective mutants bud particles normally, but the particles are non-infectious and called donuts-like particle because of their morphology. The viral genomes inside the donuts-like particles form very fragile dimer, which are far different from those in wild-type particles. The ordered particle maturation process is essential for infectivity of virus, but its mechanism largely remains unclear. We have constructed HIV-1 Gag cleavage site mutants to enable the steady state observation of virion maturation steps, and precisely study Gag processing, RNA dimerization, virion morphology and infectivity. As results, we found that these process progressed synchronously, but each transition point did not coincide completely. The mutual relationship between viral protein and RNA maturation is discussed for a further understanding of the retroviral life cycle. 相似文献
10.
11.
12.
Behr MA 《Microbes and infection / Institut Pasteur》2008,10(9):968-972
Tremendous resources are being directed towards fundamental and applied research on Mycobacterium tuberculosis. Concurrently, diseases caused by other, non-tuberculous mycobacteria (NTM), are on the rise in many settings. For many of these 'atypical mycobacteria', there is no genome sequence data and a limited understanding of their biology. Consequently, they are often felt to be 'ubiquitous' in the environment and that disease occurs largely independent of bacterial factors, in an immunocompromised host. As the distribution of these organisms in human and environmental samples is decidedly non-random, there is indirect evidence that exposure, infection and disease due to these organisms are in part determined by bacterial factors. Knowledge on how different mycobacterial species engage the host differently will help provide predictive information on the epidemiology and biology of infection with these organisms. Already, post-genomic study of M. avium has pointed to the existence of variable genomic regions that likely represent mycobacterial pathogenicity islands. An additional benefit of further genomic study of NTM will be the provision of an out-group to better appreciate M. tuberculosis, potentially explaining the sequence of genomic events that originally permitted an environmental mycobacterium to evolve into a host-associated pathogen. 相似文献
13.
Transgenic Research - 相似文献
14.
Howe CJ 《Current biology : CB》2008,18(10):R429-R431
Mitochondria and their relatives constitute a wide range of organelles, only some of which function in aerobic respiration. Mitochondrial remnants from different anaerobic lineages show a striking degree of functional convergence. 相似文献
15.
16.
17.
Shu Zhang Kai Jiang Chun Sun Haojie Lu Yinkun Liu 《Acta biochimica et biophysica Sinica》2013,(12):1021-1029
The site-specific characterization of N-glycans in glycopro- teins with the potential of clinical application is important. In our previous report, the overall N-glycans of sera haptoglobin (Hp) β chain were found to be different in liver diseases. Hp β chain contains four potential sites of N-glycosylation. In this study, we investigated the potential change of N-glycans on Hp β chain in a site-specific fashion. Sera Hp β chain in healthy individuals as well as patients with hepatitis B virus (HBV), liver cirrhosis (LC) and hepatocellular carcinoma (HCC) were purified, digested and subjected to liquid chromatography-electro- spray ionization-higher energy collision dissociation mass spectrometry, which allowed identification and structure determination of the glycopeptide, as well as the relative quantification of glycans present on each glycopeptide. The quantitative results revealed that the sialylation of NLFLN207HSEN211 ATAK and the fucosylated structure at all glycopeptides increased significantly in LC and HCC patients compared with those in HBV patients and healthy individuals. A set of different N-glycan patterns of Hp β chain in various liver diseases has been determined. Thus, the sialylated and fucosylated glycoforms of Hp β chain might be related to early hepatocarcinogenesis and also might be useful as novel differential markers for LC and HCC patients. 相似文献
18.
19.
Plastids are organelles derived from cyanobacterial endosymbionts and the evolutionary process that gave rise to them is well understood. Or is it? The complete genome sequence of a recently evolved photosynthetic body in Paulinella chromatophora is cause for reflection on the distinction between 'endosymbiont' and 'organelle', and how the boundaries between these terms can blur. 相似文献
20.