共查询到20条相似文献,搜索用时 0 毫秒
1.
Goremykin VV Hirsch-Ernst KI Wölfl S Hellwig FH 《Molecular biology and evolution》2004,21(7):1445-1454
Angiosperms (flowering plants) dominate contemporary terrestrial flora with roughly 250,000 species, but their origin and early evolution are still poorly understood. In recent years, molecular evidence has accumulated suggesting a dicotyledonous origin of monocots. Phylogenetic reconstructions have suggested that several dicotyledonous groups that include taxa such as Amborella, Austrobaileya, and Nymphaea branch off as the most basal among angiosperms. This has led to the concept of monocots, "eudicots," "basal dicots," and "ANITA" groupings. Here, we present the sequence and phylogenetic analyses of the chloroplast DNA of Nymphaea alba. Phylogenetic analyses of our 14-species data set, consisting of 29,991 aligned nucleotide positions per chloroplast genome, revealed consistent support for Nymphaea being a divergent member of a monophyletic dicot assemblage. Three distinct angiosperm lineages were supported in the majority of our phylogenetic analyses-eudicots, Magnoliopsida, and monocots. However, the monocot lineage leading to the grasses was the deepest branching. Although analyses of only one individual gene alignment (out of 61) is consistent with some recently proposed hypotheses for the paraphyly of dicots, we also report observations that nine genes do not support paraphyly of dicots. Instead, they support the basal monocot-dicot split. Consistent with this finding, we also report observations suggesting that the monocot lineage leading to the grasses has the strongest phylogenetic affinity to gymnosperms. Our findings have general implications for studies of substitution model specification and analyses of concatenated genome data. 相似文献
2.
Goremykin VV Holland B Hirsch-Ernst KI Hellwig FH 《Molecular biology and evolution》2005,22(9):1813-1822
Determining the phylogenetic relationships among the major lines of angiosperms is a long-standing problem, yet the uncertainty as to the phylogenetic affinity of these lines persists. While a number of studies have suggested that the ANITA (Amborella-Nymphaeales-Illiciales-Trimeniales-Aristolochiales) grade is basal within angiosperms, studies of complete chloroplast genome sequences also suggested an alternative tree, wherein the line leading to the grasses branches first among the angiosperms. To improve taxon sampling in the existing chloroplast genome data, we sequenced the chloroplast genome of the monocot Acorus calamus. We generated a concatenated alignment (89,436 positions for 15 taxa), encompassing almost all sequences usable for phylogeny reconstruction within spermatophytes. The data still contain support for both the ANITA-basal and grasses-basal hypotheses. Using simulations we can show that were the ANITA-basal hypothesis true, parsimony (and distance-based methods with many models) would be expected to fail to recover it. The self-evident explanation for this failure appears to be a long-branch attraction (LBA) between the clade of grasses and the out-group. However, this LBA cannot explain the discrepancies observed between tree topology recovered using the maximum likelihood (ML) method and the topologies recovered using the parsimony and distance-based methods when grasses are deleted. Furthermore, the fact that neither maximum parsimony nor distance methods consistently recover the ML tree, when according to the simulations they would be expected to, when the out-group (Pinus) is deleted, suggests that either the generating tree is not correct or the best symmetric model is misspecified (or both). We demonstrate that the tree recovered under ML is extremely sensitive to model specification and that the best symmetric model is misspecified. Hence, we remain agnostic regarding phylogenetic relationships among basal angiosperm lineages. 相似文献
3.
Chang CC Lin HC Lin IP Chow TY Chen HH Chen WH Cheng CH Lin CY Liu SM Chang CC Chaw SM 《Molecular biology and evolution》2006,23(2):279-291
Whether the Amborella/Amborella-Nymphaeales or the grass lineage diverged first within the angiosperms has recently been debated. Central to this issue has been focused on the artifacts that might result from sampling only grasses within the monocots. We therefore sequenced the entire chloroplast genome (cpDNA) of Phalaenopsis aphrodite, Taiwan moth orchid. The cpDNA is a circular molecule of 148,964 bp with a comparatively short single-copy region (11,543 bp) due to the unusual loss and truncation/scattered deletion of certain ndh subunits. An open reading frame, orf91, located in the complementary strand of the rrn23 was reported for the first time. A comparison of nucleotide substitutions between P. aphrodite and the grasses indicates that only the plastid expression genes have a strong positive correlation between nonsynonymous (Ka) and synonymous (Ks) substitutions per site, providing evidence for a generation time effect, mainly across these genes. Among the intron-containing protein-coding genes of the sampled monocots, the Ks of the genes are significantly correlated to transitional substitutions of their introns. We compiled a concatenated 61 protein-coding gene alignment for the available 20 cpDNAs of vascular plants and analyzed the data set using Bayesian inference, maximum parsimony, and neighbor-joining (NJ) methods. The analyses yielded robust support for the Amborella/Amborella-Nymphaeales-basal hypothesis and for the orchid and grasses together being a monophyletic group nested within the remaining angiosperms. However, the NJ analysis using Ka, the first two codon positions, or amino acid sequences, respectively, supports the monocots-basal hypothesis. We demonstrated that these conflicting angiosperm phylogenies are most probably linked to the transitional sites at all codon positions, especially at the third one where the strong base-composition bias and saturation effect take place. 相似文献
4.
Evidence for the most basal split in land plants dividing bryophyte and tracheophyte lineages 总被引:2,自引:0,他引:2
The problem of relationships among the major basal living groups of land plants is long standing, yet the uncertainty as to the phylogenetic affinity of these lines persists in the literature. Molecular and modern cladistic studies of the phylogenetic relationships of the above groups resulted in a large number of conflicting topologies. However, with the exception of the cladistic analyses of spermatogenesis, suggesting monophyly of extant bryophytes, these studies agree the paraphyletic bryophyte grade is basal within the embryophyte tree. Here we would like to present analyses on the basis of the concatenated datasets of nucleotide and amino-acid sequences of 57 protein-coding genes common to 17 chloroplast genomes of land plants and a charophyte alga Chaetosphaeridium globosum. Character-wise, these are the largest datasets currently available to address the problem of basal relationships within embryophytes. Main lineages of bryophytes, i.e liverworts, hornworts and mosses are represented in our alignments with a single taxon, whereas 14 taxa represent the tracheophytes. With our data, phylogeny with liverwort basal appears to be and artifact related to high and unequal A+T contents among the sequences analysed. Reducing this compositional bias and applying methods developed to counter it, we recovered an alternative, strongly supported topology wherein both bryophytes and tracheophytes are monophyletic. Within bryophytes, hornworts are basal and liverworts are sister to mosses. 相似文献
5.
Maciej A. Zwieniecki Charles K. Boyce 《Proceedings. Biological sciences / The Royal Society》2014,281(1779)
The main role of leaf venation is to supply water across the photosynthetic surface to keep stomata open and allow access to atmospheric CO2 despite evaporative demand. The optimal uniform delivery of water occurs when the distance between veins equals the depth of vein placement within the leaf away from the evaporative surface. As presented here, only angiosperms maintain this anatomical optimum across all leaf thicknesses and different habitats, including sheltered environments where this optimization need not be required. Intriguingly, basal angiosperm lineages tend to be underinvested hydraulically; uniformly high optimization is derived independently in the magnoliids, monocots and core eudicots. Gymnosperms and ferns, including available fossils, are limited by their inability to produce high vein densities. The common association of ferns with shaded humid environments may, in part, be a direct evolutionary consequence of their inability to produce hydraulically optimized leaves. Some gymnosperms do approach optimal vein placement, but only by virtue of their ability to produce thick leaves most appropriate in environments requiring water conservation. Thus, this simple anatomical metric presents an important perspective on the evolution and phylogenetic distribution of plant ecologies and further evidence that the vegetative biology of flowering plants—not just their reproductive biology—is unique. 相似文献
6.
7.
Borsch T Hilu KW Quandt D Wilde V Neinhuis C Barthlott W 《Journal of evolutionary biology》2003,16(4):558-576
Recent contributions from DNA sequences have revolutionized our concept of systematic relationships in angiosperms. However, parts of the angiosperm tree remain unclear. Previous studies have been based on coding or rDNA regions of relatively conserved genes. A phylogeny for basal angiosperms based on noncoding, fast-evolving sequences of the chloroplast genome region trnT-trnF is presented. The recognition of simple direct repeats allowed a robust alignment. Mutational hot spots appear to be confined to certain sectors, as in two stem-loop regions of the trnL intron secondary structure. Our highly resolved and well-supported phylogeny depicts the New Caledonian Amborella as the sister to all other angiosperms, followed by Nymphaeaceae and an Austrobaileya-Illicium-Schisandra clade. Ceratophyllum is substantiated as a close relative of monocots, as is a monophyletic eumagnoliid clade consisting of Piperales plus Winterales sister to Laurales plus Magnoliales. Possible reasons for the striking congruence between the trnT-trnF based phylogeny and phylogenies generated from combined multi-gene, multi-genome data are discussed. 相似文献
8.
9.
Sequences from 14 slowly evolving chloroplast genes (including three highly conserved introns) were obtained for representative basal angiosperm and seed-plant taxa, using novel primers described here. These data were combined with published sequences from atpB, rbcL, and newly obtained sequences from ndhF. Combined data from these 17 genes permit sturdy, well-resolved inference of major aspects of basal angiosperm relationships, demonstrating that the new primers are valuable tools for sorting out the deepest events in flowering plant phylogeny. Sequences from the inverted repeat (IR) proved to be particularly reliable (low homoplasy, high retention index). Representatives of Cabomba and Illicium were the first two successive branches of the angiosperms in an initial sampling of 19 exemplar taxa. This result was strongly supported by bootstrap analysis and by two small insertion/deletion events in the slowly evolving introns. Several paleoherb groups (representatives of Piperales) formed a strongly supported clade with taxa representing core woody magnoliids (Laurales, Magnoliales, and Winteraceae). The monophyly of the sampled eudicots and monocots was also well supported. Analyses of three major partitions of the data showed many of the same clades and supported the rooting seen with all the data combined. While Amborella trichopoda was supported as the sister group of the remaining angiosperms when we added Amborella and Nymphaea odorata to the analysis, a strongly conflicting rooting was observed when Amborella alone was added. 相似文献
10.
Examining rates and patterns of nucleotide substitution in plants 总被引:19,自引:0,他引:19
Muse SV 《Plant molecular biology》2000,42(1):25-43
Driven by rapid improvements in affordable computing power and by the even faster accumulation of genomic data, the statistical analysis of molecular sequence data has become an active area of interdisciplinary research. Maximum likelihood methods have become mainstream because of their desirable properties and, more importantly, their potential for providing statistically sound solutions in complex data analysis settings. In this chapter, a review of recent literature focusing on rates and patterns of nucleotide substitution rates in the nuclear, chloroplast, and mitochondrial genomes of plants demonstrates the power and flexibility of these new methods. The emerging picture of the nucleotide substitution process in plants is a complex one. Evolutionary rates are seen to be quite variable, both among genes and among plant lineages. However, there are hints, particularly in the chloroplast, that individual factors can have important effects on many genes simultaneously. 相似文献
11.
Takayuki Asano Takahiko Tsudzuki Sakiko Takahashi Hiroaki Shimada Koh-ichi Kadowaki 《DNA research》2004,11(2):93-99
The complete nucleotide sequence of the chloroplast genome of sugarcane (Saccharum officinarum) has been determined. It is a circular double-stranded DNA molecule, 141,182 bp in size, and is composed of a large single copy of 83,048 bp, a small single copy of 12,544 bp, and a pair of inverted repeat regions of 22,795 bp each. A comparative analysis among monocots showed that the sugarcane chloroplast genome was very similar to maize but not to rice or wheat. Between sugarcane and maize at the rps16-trnQ (UUG) region, however, a length polymorphism was identified. With regard to insertions/deletions equal to or longer than 5 bp, a total of 53 insertion and 31 deletion events were identified in the sugarcane chloroplast genome. Of the 84 loci identified, a pair of direct repeat sequences was located side by side in a tandem fashion in 47 loci (56.0%). A recombination event during plant evolution is discussed at two sites between the sugarcane and tobacco chloroplast genomes. 相似文献
12.
The phylum Streptophyta comprises all land plants and six monophyletic groups of charophycean green algae (Mesostigmatales, Chlorokybales, Klebsormidiales, Zygnematales, Coleochaetales, and Charales). Phylogenetic analyses of four genes encoded in three cellular compartments suggest that the Charales are sister to land plants and that charophycean green algae evolved progressively toward an increasing cellular complexity. To validate this phylogenetic hypothesis and to understand how and when the highly conservative pattern displayed by land plant chloroplast DNAs (cpDNAs) originated in the Streptophyta, we have determined the complete chloroplast genome sequence (184,933 bp) of a representative of the Charales, Chara vulgaris, and compared this genome to those of Mesostigma (Mesostigmatales), Chlorokybus (Chlorokybales), Staurastrum and Zygnema (Zygnematales), Chaetosphaeridium (Coleochaetales), and selected land plants. The phylogenies we inferred from 76 cpDNA-encoded proteins and genes using various methods favor the hypothesis that the Charales diverged before the Coleochaetales and Zygnematales. The Zygnematales were identified as sister to land plants in the best tree topology (T1), whereas Chaetosphaeridium (T2) or a clade uniting the Zygnematales and Chaetosphaeridium (T3) occupied this position in alternative topologies. Chara remained at the same basal position in trees including more land plant taxa and inferred from 56 proteins/genes. Phylogenetic inference from gene order data yielded two most parsimonious trees displaying the T1 and T3 topologies. Analyses of additional structural cpDNA features (gene order, gene content, intron content, and indels in coding regions) provided better support for T1 than for the topology of the above-mentioned four-gene tree. Our structural analyses also revealed that many of the features conserved in land plant cpDNAs were inherited from their green algal ancestors. The intron content data predicted that at least 15 of the 21 land plant group II introns were gained early during the evolution of streptophytes and that a single intron was acquired during the transition from charophycean green algae to land plants. Analyses of genome rearrangements based on inversions predicted no alteration in gene order during the transition from charophycean green algae to land plants. 相似文献
13.
Phylogenetic relationships among the 5 groups of extant seed plants are presently unsettled. To reexamine this long-standing debate, we determine the complete chloroplast genome (cpDNA) of Cycas taitungensis and 56 protein-coding genes encoded in the cpDNA of Gnetum parvifolium. The cpDNA of Cycas is a circular molecule of 163,403 bp with 2 typical large inverted repeats (IRs) of 25,074 bp each. We inferred phylogenetic relationships among major seed plant lineages using concatenated 56 protein-coding genes in 37 land plants. Phylogenies, generated by the use of 3 independent methods, provide concordant and robust support for the monophylies of extant seed plants, gymnosperms, and angiosperms. Within the modern gymnosperms are 2 highly supported sister clades: Cycas-Ginkgo and Gnetum-Pinus. This result agrees with both the "gnetifer" and "gnepines" hypotheses. The sister relationships in Cycas-Ginkgo and Gnetum-Pinus clades are further reinforced by cpDNA structural evidence. Branch lengths of Cycas-Ginkgo and Gnetum were consistently the shortest and the longest, respectively, in all separate analyses. However, the Gnetum relative rate test revealed this tendency only for the 3rd codon positions and the transversional sites of the first 2 codon positions. A PsitufA located between psbE and petL genes is here first detected in Anthoceros (a hornwort), cycads, and Ginkgo. We demonstrate that the PsitufA is a footprint descended from the chloroplast tufA of green algae. The duplication of ycf2 genes and their shift into IRs should have taken place at least in the common ancestor of seed plants more than 300 MYA, and the tRNAPro-GGG gene was lost from the angiosperm lineage at least 150 MYA. Additionally, from cpDNA structural comparison, we propose an alternative model for the loss of large IR regions in black pine. More cpDNA data from non-Pinaceae conifers are necessary to justify whether the gnetifer or gnepines hypothesis is valid and to generate solid structural evidence for the monophyly of extant gymnosperms. 相似文献
14.
Identifying the basal angiosperm node in chloroplast genome phylogenies: sampling one's way out of the Felsenstein zone 总被引:11,自引:0,他引:11
Leebens-Mack J Raubeson LA Cui L Kuehl JV Fourcade MH Chumley TW Boore JL Jansen RK depamphilis CW 《Molecular biology and evolution》2005,22(10):1948-1963
While there has been strong support for Amborella and Nymphaeales (water lilies) as branching from basal-most nodes in the angiosperm phylogeny, this hypothesis has recently been challenged by phylogenetic analyses of 61 protein-coding genes extracted from the chloroplast genome sequences of Amborella, Nymphaea, and 12 other available land plant chloroplast genomes. These character-rich analyses placed the monocots, represented by three grasses (Poaceae), as sister to all other extant angiosperm lineages. We have extracted protein-coding regions from draft sequences for six additional chloroplast genomes to test whether this surprising result could be an artifact of long-branch attraction due to limited taxon sampling. The added taxa include three monocots (Acorus, Yucca, and Typha), a water lily (Nuphar), a ranunculid (Ranunculus), and a gymnosperm (Ginkgo). Phylogenetic analyses of the expanded DNA and protein data sets together with microstructural characters (indels) provided unambiguous support for Amborella and the Nymphaeales as branching from the basal-most nodes in the angiosperm phylogeny. However, their relative positions proved to be dependent on the method of analysis, with parsimony favoring Amborella as sister to all other angiosperms and maximum likelihood (ML) and neighbor-joining methods favoring an Amborella + Nymphaeales clade as sister. The ML phylogeny supported the later hypothesis, but the likelihood for the former hypothesis was not significantly different. Parametric bootstrap analysis, single-gene phylogenies, estimated divergence dates, and conflicting indel characters all help to illuminate the nature of the conflict in resolution of the most basal nodes in the angiosperm phylogeny. Molecular dating analyses provided median age estimates of 161 MYA for the most recent common ancestor (MRCA) of all extant angiosperms and 145 MYA for the MRCA of monocots, magnoliids, and eudicots. Whereas long sequences reduce variance in branch lengths and molecular dating estimates, the impact of improved taxon sampling on the rooting of the angiosperm phylogeny together with the results of parametric bootstrap analyses demonstrate how long-branch attraction might mislead genome-scale phylogenetic analyses. 相似文献
15.
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCA-DAGCGCAψUUGUUUUGGNψFACAAAAUmsu7GUCACGGGTψCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNAPro (UGG), the other two known plant organellar tRNAsPro. 相似文献
16.
Ashby Mark K. Warry Andrew Bejarano Eduardo R. Khashoggi Alaa Burrell Michael Lichtenstein Conrad P. 《Plant molecular biology》1997,35(3):313-321
Previously, we discovered multiple direct repeats of geminivirus-related DNA (GRD) sequences clustered at a single chromosomal position in Nicotiana tabacum (tobacco). Here we show that, in addition to tobacco, multiple copies of these elements occur in the genomes of three related Nicotiana species, all in the section Tomentosae: N. tomentosiformis, N. tomentosa and N. kawakamii, but not in 9 other more distantly related Nicotiana species, nor in various other solanaceous and non-solanaecous plants. DNA sequence analysis of 18 GRD copies reveal 4 distinct, but highly related, sub-families: GRD5, GRD3 and GRD53 in tobacco; GRD5 in N. tomentosiformis and N. kawakamii; and GRD2 in N. tomentosa. In addition to novel sequences, all elements share significant but varying lengths of DNA sequence similarity with the geminiviral replication origin plus the adjacent rep gene. There is extended sequence similarity to REP protein at the deduced amino acid sequence level, including motifs associated with other rolling circle replication proteins. Our data suggest that all GRD elements descend from a unique geminiviral integration event, most likely in a common ancestor of these Tomentosae species. 相似文献
17.
18.
Chumley TW Palmer JD Mower JP Fourcade HM Calie PJ Boore JL Jansen RK 《Molecular biology and evolution》2006,23(11):2175-2190
The chloroplast genome of Pelargonium x hortorum has been completely sequenced. It maps as a circular molecule of 217,942 bp and is both the largest and most rearranged land plant chloroplast genome yet sequenced. It features 2 copies of a greatly expanded inverted repeat (IR) of 75,741 bp each and, consequently, diminished single-copy regions of 59,710 and 6,750 bp. Despite the increase in size and complexity of the genome, the gene content is similar to that of other angiosperms, with the exceptions of a large number of pseudogenes, the recognition of 2 open reading frames (ORF56 and ORF42) in the trnA intron with similarities to previously identified mitochondrial products (ACRS and pvs-trnA), the losses of accD and trnT-ggu and, in particular, the presence of a highly divergent set of rpoA-like ORFs rather than a single, easily recognized gene for rpoA. The 3-fold expansion of the IR (relative to most angiosperms) accounts for most of the size increase of the genome, but an additional 10% of the size increase is related to the large number of repeats found. The Pelargonium genome contains 35 times as many 31 bp or larger repeats than the unrearranged genome of Spinacia. Most of these repeats occur near the rearrangement hotspots, and 2 different associations of repeats are localized in these regions. These associations are characterized by full or partial duplications of several genes, most of which appear to be nonfunctional copies or pseudogenes. These duplications may also be linked to the disruption of at least 1 but possibly 2 or 3 operons. We propose simple models that account for the major rearrangements with a minimum of 8 IR boundary changes and 12 inversions in addition to several insertions of duplicated sequence. 相似文献
19.
Richard G. Olmstead Jennifer A. Sweere Kenneth H. Wolfe 《Plant molecular biology》1993,22(6):1191-1193
Corrections to the published sequence of the tobacco chloroplast genendhF are presented, including a 90 bpAlu I restriction enzyme fragment internal to the gene that was apparently missed during the original sequencing effort. A summary of the corrections to the published tobacco chloroplast DNA that have come to light since its original publication is included. 相似文献
20.
Summary An EcoRI 2.7 kbp fragment from Chlorella ellipsoidea chloroplast DNA (cpDNA) cloned in YIp5 was shown to promote autonomous replication in Saccharomyces cerevisiae. The fragment was localized in the small single copy region close to the inverted repeat. The ARS activity (autonomously replicating sequences in yeast) was found to be confined within a subclone of a ca. 300 bp HindIII fragment. Sequence analysis of this fragment revealed its high AT content and the presence of several direct and inverted repeats and a few elements that were related to the yeast ARS consensus sequence. Electron microscopic studies revealed that this sequence did not coincide with the primary replication origin of chloroplast DNA. The functioning of this sequence as a possible origin of plasmid replication in vivo is discussed. This is the first report on Chlorella cpDNA sequence. re]19850821 rv]19851211 ac]19851216 相似文献