Quantitative measurements and rational materials design for intracellular delivery of oligonucleotides

Antisense oligonucleotides and short interfering RNAs are widely used for sequence-specific silencing of gene expression. More widespread acceptance and adoption of these agents in vitro and in vivo is limited by the efficiency and cell-type variability of oligonucleotide delivery. An impressive variety of polymeric and lipid-based reagents have been developed to improve oligonucleotide delivery, but their development, testing, and interpretation have relied primarily on empirical design and measurement methodologies. Recently, mathematical models and quantitative measurements of biophysical events experienced by delivery vectors have emerged, paving the way for rational design of materials that can overcome intracellular delivery barriers. Recent progress toward the iterative design and quantitative measurement of intracellular events in oligonucleotide delivery is reviewed.     

Structure-based rational design of a Toll-like receptor 4 (TLR4) decoy receptor with high binding affinity for a target protein

Repeat proteins are increasingly attracting much attention as alternative scaffolds to immunoglobulin antibodies due to their unique structural features. Nonetheless, engineering interaction interface and understanding molecular basis for affinity maturation of repeat proteins still remain a challenge. Here, we present a structure-based rational design of a repeat protein with high binding affinity for a target protein. As a model repeat protein, a Toll-like receptor4 (TLR4) decoy receptor composed of leucine-rich repeat (LRR) modules was used, and its interaction interface was rationally engineered to increase the binding affinity for myeloid differentiation protein 2 (MD2). Based on the complex crystal structure of the decoy receptor with MD2, we first designed single amino acid substitutions in the decoy receptor, and obtained three variants showing a binding affinity (K(D)) one-order of magnitude higher than the wild-type decoy receptor. The interacting modes and contributions of individual residues were elucidated by analyzing the crystal structures of the single variants. To further increase the binding affinity, single positive mutations were combined, and two double mutants were shown to have about 3000- and 565-fold higher binding affinities than the wild-type decoy receptor. Molecular dynamics simulations and energetic analysis indicate that an additive effect by two mutations occurring at nearby modules was the major contributor to the remarkable increase in the binding affinities.     

Interaction of monomolecular G4-DNA nanowires with TMPyP: evidence for intercalation

Interaction of meso-tetrakis(4-N-methylpyridyl)porphyrin (TMPyP) with G4-wires composed of approximately 1000 stacked tetrads (Kotlyar, A. B., Borovok, N., Molotsky, T., Cohen, H., Shapir, E., and Porath, D. (2005) Long monomolecular G4-DNA nanowires, Adv. Mater. 17, 1901-1905) was studied. These wires exist in either K (Na)-free or K forms in contrast to short telomeric G-quadruplexes, which are stable only in the presence of monovalent cations. We showed that a stable complex between K-free G4-wires and the porphyrin is formed at a TMPyP to tetrad molar ratio of 0.5. A 19 nm shift and a hypochromicity of 58% in the absorption spectrum, the induced CD of the porphyrin, and efficient energy transfer between TMPyP and K-free G4-wires suggest an intercalative mechanism of TMPyP binding. The K form interacts with TMPyP much weaker than the K-free form of the wires. Binding of TMPyP to the K form is characterized by a small (3 nm) shift of the Soret band, a weak positive induced CD in the Soret region, and the absence of energy transfer between the G-bases and the porphyrin. These parameters reflect a nonintercalative binding of TMPyP to the K form of the wires. We suggest that K ions positioned in the center space between the adjacent tetrads limit the access of TMPyP and other organic molecules to this region, thus enabling only nonintercalative modes of ligand binding to G-quadruplex DNAs.     

Efficient procedure of preparation and properties of long uniform G4-DNA nanowires

Here we describe a novel and efficient procedure for preparation of long uniform G4-DNA wires. The procedure includes (i) enzymatic synthesis of double-stranded DNA molecules consisting of long (up to 10,000 bases), continuous G strands and chains of complementary (dC)20-oligonucleotides, poly(dG)-n(dC)20; (ii) size exclusion HPLC separation of the G strands from the (dC)20 oligonucleotides in 0.1M NaOH; and (iii) folding of the purified G strands into G4-DNA structures by lowering the pH to 7.0. We show by atomic force microscopy (AFM) that the preparation procedure yielded G4-DNA wires with a uniform morphology and a narrow length distribution. The correlation between the total amount of nucleotides in the G strands and the contour length of the G4-DNA molecules estimated by AFM suggests monomolecular folding of the G strands into quadruplex structures. The folding takes place either in the presence or in the absence of stabilizing ions (K+ or Na+). The addition of these cations leads to a dramatic change in the circular dichroism spectrum of the G4-DNA.     

G4 resolvase 1 binds both DNA and RNA tetramolecular quadruplex with high affinity and is the major source of tetramolecular quadruplex G4-DNA and G4-RNA resolving activity in HeLa cell lysates

Quadruplex structures that result from stacking of guanine quartets in nucleic acids possess such thermodynamic stability that their resolution in vivo is likely to require specific recognition by specialized enzymes. We previously identified the major tetramolecular quadruplex DNA resolving activity in HeLa cell lysates as the gene product of DHX36 (Vaughn, J. P., Creacy, S. D., Routh, E. D., Joyner-Butt, C., Jenkins, G. S., Pauli, S., Nagamine, Y., and Akman, S. A. (2005) J. Biol Chem. 280, 38117-38120), naming the enzyme G4 Resolvase 1 (G4R1). G4R1 is also known as RHAU, an RNA helicase associated with the AU-rich sequence of mRNAs. We now show that G4R1/RHAU binds to and resolves tetramolecular RNA quadruplex as well as tetramolecular DNA quadruplex structures. The apparent K(d) values of G4R1/RHAU for tetramolecular RNA quadruplex and tetramolecular DNA quadruplex were exceptionally low: 39 +/- 6 and 77 +/- 6 Pm, respectively, as measured by gel mobility shift assay. In competition studies tetramolecular RNA quadruplex structures inhibited tetramolecular DNA quadruplex structure resolution by G4R1/RHAU more efficiently than tetramolecular DNA quadruplex structures inhibited tetramolecular RNA quadruplex structure resolution. Down-regulation of G4R1/RHAU in HeLa T-REx cells by doxycycline-inducible short hairpin RNA caused an 8-fold loss of RNA and DNA tetramolecular quadruplex resolution, consistent with G4R1/RHAU representing the major tetramolecular quadruplex helicase activity for both RNA and DNA structures in HeLa cells. This study demonstrates for the first time the RNA quadruplex resolving enzymatic activity associated with G4R1/RHAU and its exceptional binding affinity, suggesting a potential novel role for G4R1/RHAU in targeting in vivo RNA quadruplex structures.     

Rational design of switched triple helix-forming oligonucleotides: Extension of sequences for triple helix formation

A rational design by means of molecular mechanics has been carried out in an effort to extend the range of double-helical DNA sequences that could be recognized by triple helix-forming oligonucleotides. The DNA target is composed of alternating, adjacent fragments of oligopurine·oligopyrimidine sequences, instead of a long stretch of polypurine·polypyrimidine sequence used for canonical triple helix formation. Based on the combination of different triple helix motifs in eitherHoogsteen orreverse Hoogsteen configuration, mini-triple helices can be formed at each oligopurine·oligopyrimidine part of the target sequence with either parallel or antiparallel orientation with respect to the purine strand. As the adjacent purine target sequences are located in the complementary strands, the third strand oligonucleotides can be joined together through a natural phosphodiester backbone at the junctions in either a 5-3 or a 3-5 polarity. There are six distinct junction steps. Molecular modeling was aimed at optimizing the cooperative binding of the so-called switched triple helix-forming oligonucleotides by choosing appropriate nucleotide(s) at the junction between two adjacent minitriple helices. A comprehensiveswitch code describing the rules for forming switched triple helices has been established. Its practical applications in extending DNA recognition by this new generation of tailor-made triple helix-forming oligonucleotides are discussed.     

Cyclin b1 promoter activity and functional cdk1 complex formation in G1 phase of human breast cancer cells.

Overexpression of cyclin B has been detected in various human breast cancer cell lines, breast tumor tissues, and immortalized but nontransformed breast cells. The cause of this overexpression has not been thoroughly investigated, nor is it known if cyclin B protein forms a functional complex with its partner, cdk1, at inappropriate cell cycle periods. In this study we examined the pattern of cyclin B1 promoter activity in three breast cancer cell lines, BT-549, MDA-MB-157, T-47D, and the immortalized breast cell line MCF-10F. Using cells stably transfected with a cyclin B1 promoter-luciferase reporter, luciferase activity was measured throughout the cell cycle in lovastatin synchronized cells and in G1 and S/G2 phases of asynchronized cells by flow cytometry. Results demonstrate that the cyclin B1 promoter activity increases, as expected, during the S/G2 period in all the cell lines. However, some promoter activity can be detected in G1 phase of the different cell line with BT-549 displaying the more altered pattern. Functional cyclin B1-cdk 1 protein complex was detected in G1 phase of BT-549 and T-47D cell lines. These results suggest that in a subset of transformed breast cancer cells altered cyclin B1 promoter activity may contribute to the misexpression of cyclin B protein.     

Identification of non-telomeric G4-DNA binding proteins in human,E. coli,yeast, and Arabidopsis

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.     

Optimizing the design of oligonucleotides for homology directed gene targeting

Background

Gene targeting depends on the ability of cells to use homologous recombination to integrate exogenous DNA into their own genome. A robust mechanistic model of homologous recombination is necessary to fully exploit gene targeting for therapeutic benefit.

Methodology/Principal Findings

In this work, our recently developed numerical simulation model for homology search is employed to develop rules for the design of oligonucleotides used in gene targeting. A Metropolis Monte-Carlo algorithm is used to predict the pairing dynamics of an oligonucleotide with the target double-stranded DNA. The model calculates the base-alignment between a long, target double-stranded DNA and a probe nucleoprotein filament comprised of homologous recombination proteins (Rad51 or RecA) polymerized on a single strand DNA. In this study, we considered different sizes of oligonucleotides containing 1 or 3 base heterologies with the target; different positions on the probe were tested to investigate the effect of the mismatch position on the pairing dynamics and stability. We show that the optimal design is a compromise between the mean time to reach a perfect alignment between the two molecules and the stability of the complex.

Conclusion and Significance

A single heterology can be placed anywhere without significantly affecting the stability of the triplex. In the case of three consecutive heterologies, our modeling recommends using long oligonucleotides (at least 35 bases) in which the heterologous sequences are positioned at an intermediate position. Oligonucleotides should not contain more than 10% consecutive heterologies to guarantee a stable pairing with the target dsDNA. Theoretical modeling cannot replace experiments, but we believe that our model can considerably accelerate optimization of oligonucleotides for gene therapy by predicting their pairing dynamics with the target dsDNA.     

Nucleic acids for the rational design of reaction circuits

1. Download : Download high-res image (123KB)
2. Download : Download full-size image

Highlights► Nucleic acids can be used to build reaction modules modeled after in vivo or in silico computers. ► In vitro circuits built from these modules perform one-shot calculations or show complex dynamics. ► Applications at the interface with biology, or for molecular-scale robotics, are burgeoning.     

Spermidine and spermine stimulate the activity of T4-DNA ligase

When the ability of T4-DNA ligase from E. coli NM 989 to form higher molecular weight polymers from linearized plasmid pJDB 207 was followed, it was observed that physiological concentrations (0.5 to 1.0 mM) of spermidine and spermine greatly stimulated the formation of these polymers. The effect had a strict specificity since 1,3-diaminopropane, putrescine (1,4-diaminobutane) and N1-acetylspermidine neither stimulated nor inhibited this activity of DNA ligase. The structural analogues of spermidine, methyl bis(guanylhydrazone) and 1,1'-[(methylethanediylidene)dinitrilo]bis(3-aminoguanidine) totally abolished the stimulatory effect of spermidine on T4-DNA ligase without affecting the enzyme's basal activity.