The poly(A)-binding protein and an mRNA stability protein jointly regulate an endoribonuclease activity

We previously identified a sequence-specific erythroid cell-enriched endoribonuclease (ErEN) activity involved in the turnover of the stable alpha-globin mRNA. We now demonstrate that ErEN activity is regulated by the poly(A) tail. The unadenylated alpha-globin 3' untranslated region (3'UTR) was an efficient substrate for ErEN cleavage, while the polyadenylated 3'UTR was inefficiently cleaved in an in vitro decay assay. The influence of the poly(A) tail was mediated through the poly(A)-binding protein (PABP) bound to the poly(A) tail, which can inhibit ErEN activity. ErEN cleavage of an adenylated alpha-globin 3'UTR was accentuated upon depletion of PABP from the cytosolic extract, while addition of recombinant PABP reestablished the inhibition of endoribonuclease cleavage. PABP inhibited ErEN activity indirectly through an interaction with the alphaCP mRNA stability protein. Sequestration of alphaCP resulted in an increase of ErEN cleavage activity, regardless of the polyadenylation state of the RNA. Using electrophoretic mobility shift assays, PABP was shown to enhance the binding efficiency of alphaCP to the alpha-globin 3'UTR, which in turn protected the ErEN target sequence. Conversely, the binding of PABP to the poly(A) tail was also augmented by alphaCP, implying that a stable higher-order structural network is involved in stabilization of the alpha-globin mRNA. Upon deadenylation, the interaction of PABP with alphaCP would be disrupted, rendering the alpha-globin 3'UTR more susceptible to endoribonuclease cleavage. The data demonstrated a specific role for PABP in protecting the body of an mRNA in addition to demonstrating PABP's well-characterized effect of stabilizing the poly(A) tail.     

The poly(A)-binding protein facilitates in vitro translation of poly(A)-rich mRNA

To investigate the role of the 73-kDa poly(A)-binding protein in protein synthesis, the effect of the addition of homo-polyribonucleotides on the translation of polyadenylated and non-adenylated mRNA was studied in the rabbit reticulocyte lysate. Poly(A) was found to be the most effective polynucleotide in inhibiting duck-globin mRNA translation, whereas it had no effect on the translation of polyribosomal duck-globin mRNP, or on the endogenous synthesis of the rabbit reticulocyte lysate. The translation of poly(A)-free mRNA was not affected by the addition of poly(A). Furthermore, we found that the inhibiting effect of poly(A) can be reversed by addition of purified poly(A)-binding protein. It is thus likely that the 73-kDa poly(A)-binding protein is an essential factor necessary for poly(A)-rich mRNA translation.     

The poly(A)-poly(A)-binding protein complex is a major determinant of mRNA stability in vitro.

Using an in vitro mRNA decay system, we investigated how poly(A) and its associated poly(A)-binding protein (PABP) affect mRNA stability. Cell extracts used in the decay reactions were depleted of functional PABP either by adding excess poly(A) competitor or by passing the extracts over a poly(A)-Sepharose column. Polyadenylated mRNAs for beta-globin, chloramphenicol acetyltransferase, and simian virus 40 virion proteins were degraded 3 to 10 times faster in reactions lacking PABP than in those containing excess PABP. The addition of purified Saccharomyces cerevisiae or human cytoplasmic PABP to PABP-depleted reactions stabilized the polyadenylated mRNAs. In contrast, the decay rates of nonpolyadenylated mRNAs were unaffected by PABP, indicating that both the poly(A) and its binding protein were required for maintaining mRNA stability. A nonspecific single-stranded binding protein from Escherichia coli did not restore stability to polyadenylated mRNA, and the stabilizing effect of PABP was inhibited by anti-PABP antibody. The poly(A) tract was the first mRNA segment to be degraded in PABP-depleted reactions, confirming that the poly(A)-PABP complex was protecting the 3' region from nucleolytic attack. These results indicate that an important function of poly(A), in conjunction with its binding protein, is to protect polyadenylated mRNAs from indiscriminate destruction by cellular nucleases. A model is proposed to explain how the stability of an mRNA could be affected by the stability of its poly(A)-PABP complex.     

Embryonic poly(A)-binding protein stimulates translation in germ cells

The function of poly(A)-binding protein 1 (PABP1) in poly(A)-mediated translation has been extensively characterized. Recently, Xenopus laevis oocytes and early embryos were shown to contain a novel poly(A)-binding protein, ePABP, which has not been described in other organisms. ePABP was identified as a protein that binds AU-rich sequences and prevents shortening of poly(A) tails. Here, we show that ePABP is also expressed in X. laevis testis, suggesting a more general role for ePABP in gametogenesis. We find that ePABP is conserved throughout vertebrates and that mouse and X. laevis cells have similar tissue-specific ePABP expression patterns. Furthermore, we directly assess the role of ePABP in translation. We show that ePABP is associated with polysomes and can activate the translation of reporter mRNAs in vivo. Despite its relative divergence from PABP1, we find that ePABP has similar functional domains and can bind to several PABP1 partners, suggesting that they may use similar mechanisms to activate translation. In addition, we find that PABP1 and ePABP can interact, suggesting that these proteins may be bound simultaneously to the same mRNA. Finally, we show that the activity of both PABP1 and ePABP increases during oocyte maturation, when many mRNAs undergo polyadenylation.     

Examination of the kinetic mechanism of mitogen-activated protein kinase activated protein kinase-2

The kinetic mechanism of mitogen-activated protein kinase activated protein kinase-2 (MAPKAPK2) was investigated using a peptide (LKRSLSEM) based on the phosphorylation site found in serum response factor (SRF). Initial velocity studies yielded a family of double-reciprocal lines that appear parallel and indicative of a ping-pong mechanism. The use of dead-end inhibition studies did not provide a definitive assignment of a reaction mechanism. However, product inhibition studies suggested that MAPKAPK2 follows an ordered bi-bi kinetic mechanism, where ATP must bind to the enzyme prior to the SRF-peptide and the phosphorylated product is released first, followed by ADP. In agreement with these latter results, surface plasmon resonance measurements demonstrate that the binding of the inhibitor peptide to MAPKAPK2 requires the presence of ATP. Furthermore, competitive inhibitors of ATP, adenosine 5'-(beta,gamma-imino)triphosphate (AMPPNP) and a staurosporine analog (K252a), can inhibit this ATP-dependent binding providing further evidence that the peptide substrate binds preferably to the E:ATP complex.     

Identification of a C-terminal poly(A)-binding protein (PABP)-PABP interaction domain: role in cooperative binding to poly (A) and efficient cap distal translational repression

The poly(A)-binding protein (PABP), bound to the 3' poly(A) tail of eukaryotic mRNAs, plays critical roles in mRNA translation and stability. PABP autoregulates its synthesis by binding to a conserved A-rich sequence present in the 5'-untranslated region of PABP mRNA and repressing its translation. PABP is composed of two parts: the highly conserved N terminus, containing 4 RNA recognition motifs (RRMs) responsible for poly(A) and eIF4G binding; and the more variable C terminus, which includes the recently described PABC domain, and promotes intermolecular interaction between PABP molecules as well as cooperative binding to poly(A). Here we show that, in vitro, GST-PABP represses the translation of reporter mRNAs containing 20 or more A residues in their 5'-untranslated regions and remains effective as a repressor when an A61 tract is placed at different distances from the cap, up to 126 nucleotides. Deletion of the PABP C terminus, but not the PABC domain alone, significantly reduces its ability to inhibit translation when bound to sequences distal to the cap, but not to proximal ones. Moreover, cooperative binding by multiple PABP molecules to poly(A) requires the C terminus, but not the PABC domain. Further analysis using pull-down assays shows that the interaction between PABP molecules, mediated by the C terminus, does not require the PABC domain and is enhanced by the presence of RRM 4. In vivo, fusion proteins containing parts of the PABP C terminus fused to the viral coat protein MS2 have an enhanced ability to prevent the expression of chloramphenicol acetyltransferase reporter mRNAs containing the MS2 binding site at distal distances from the cap. Altogether, our results identify a proline- and glutamine-rich linker located between the RRMs and the PABC domain as being strictly required for PABP/PABP interaction, cooperative binding to poly(A) and enhanced translational repression of reporter mRNAs in vitro and in vivo.     

Unique features of HIV-1 Rev protein phosphorylation by protein kinase CK2 ('casein kinase-2')

The HIV-1 Rev transactivator is phosphorylated in vitro by protein kinase CK2 at two residues, Ser-5 and Ser-8; these sites are also phosphorylated in vivo. Here we show that the mechanism by which CK2 phosphorylates Rev is unique in several respects, notably: (i) it is fully dependent on the regulatory, beta-subunit of CK2; (ii) it relies on the integrity of an acidic stretch of CK2 beta which down-regulates the phosphorylation of other substrates; (iii) it is inhibited in a dose-dependent manner by polyamines and other polycationic effectors that normally stimulate CK2 activity. In contrast, a peptide corresponding to the amino-terminal 26 amino acids of Rev, including the phosphoacceptor site, is readily phosphorylated by the catalytic subunit of CK2 even in the absence of the beta-subunit. These data, in conjunction with the observation that two functionally inactive derivatives of Rev with mutations in its helix-loop-helix motif are refractory to phosphorylation, indicate the phosphorylation of Rev by CK2 relies on conformational features of distinct regions that are also required for the transactivator's biological activity.     

La-related protein 4 binds poly(A), interacts with the poly(A)-binding protein MLLE domain via a variant PAM2w motif, and can promote mRNA stability

The conserved RNA binding protein La recognizes UUU-3'OH on its small nuclear RNA ligands and stabilizes them against 3'-end-mediated decay. We report that newly described La-related protein 4 (LARP4) is a factor that can bind poly(A) RNA and interact with poly(A) binding protein (PABP). Yeast two-hybrid analysis and reciprocal immunoprecipitations (IPs) from HeLa cells revealed that LARP4 interacts with RACK1, a 40S ribosome- and mRNA-associated protein. LARP4 cosediments with 40S ribosome subunits and polyribosomes, and its knockdown decreases translation. Mutagenesis of the RNA binding or PABP interaction motifs decrease LARP4 association with polysomes. Several translation and mRNA metabolism-related proteins use a PAM2 sequence containing a critical invariant phenylalanine to make direct contact with the MLLE domain of PABP, and their competition for the MLLE is thought to regulate mRNA homeostasis. Unlike all ～150 previously analyzed PAM2 sequences, LARP4 contains a variant PAM2 (PAM2w) with tryptophan in place of the phenylalanine. Binding and nuclear magnetic resonance (NMR) studies have shown that a peptide representing LARP4 PAM2w interacts with the MLLE of PABP within the affinity range measured for other PAM2 motif peptides. A cocrystal of PABC bound to LARP4 PAM2w shows tryptophan in the pocket in PABC-MLLE otherwise occupied by phenylalanine. We present evidence that LARP4 expression stimulates luciferase reporter activity by promoting mRNA stability, as shown by mRNA decay analysis of luciferase and cellular mRNAs. We propose that LARP4 activity is integrated with other PAM2 protein activities by PABP as part of mRNA homeostasis.     

Translation of poly(A)-binding protein mRNA is regulated by growth conditions.

Translational efficiency of a minor group of mRNAs is regulated by serum levels in 3T6 fibroblasts. Included within this group is the poly(A)-binding protein (PABP) mRNA. We analyzed the distribution of PABP mRNA in polysome profiles and found a large percentage of this mRNA to be translationally repressed in both actively growing (approximately 60%) and resting cells (approximately 70%). Elevated serum levels induced a distinct bimodal distribution of this mRNA between actively translated and repressed fractions. Similarly, treatment of cells with low doses of cycloheximide also generated a partial shift of repressed PABP mRNA into the actively translated fraction. In an attempt to characterize the factors which regulate PABP mRNA translation we have identified the proteins which bind to this mRNA in vitro. Sequences within the 5' untranslated region were found to be sufficient for binding of all proteins to this mRNA. We suggest that this region and the proteins associated with it may be essential for translation control of PABP mRNA.     

Glucose activates mitogen-activated protein kinase (extracellular signal-regulated kinase) through proline-rich tyrosine kinase-2 and the Glut1 glucose transporter

Glucose serves as both a nutrient and regulator of physiological and pathological processes. Presently, we found that glucose and certain sugars rapidly activated extracellular signal-regulated kinase (ERK) by a mechanism that was: (a) independent of glucose uptake/metabolism and protein kinase C but nevertheless cytochalasin B-inhibitable; (b) dependent upon proline-rich tyrosine kinase-2 (PYK2), GRB2, SOS, RAS, RAF, and MEK1; and (c) amplified by overexpression of the Glut1, but not Glut2, Glut3, or Glut4, glucose transporter. This amplifying effect was independent of glucose uptake but dependent on residues 463-468, IASGFR, in the Glut1 C terminus. Accordingly, glucose effects on ERK were amplified by expression of Glut4/Glut1 or Glut2/Glut1 chimeras containing IASGFR but not by Glut1/Glut4 or Glut1/Glut2 chimeras lacking these residues. Also, deletion of Glut1 residues 469-492 was without effect, but mutations involving serine 465 or arginine 468 yielded dominant-negative forms that inhibited glucose-dependent ERK activation. Glucose stimulated the phosphorylation of tyrosine residues 402 and 881 in PYK2 and binding of PYK2 to Myc-Glut1. Our findings suggest that: (a) glucose activates the GRB2/SOS/RAS/RAF/MEK1/ERK pathway by a mechanism that requires PYK2 and residues 463-468, IASGFR, in the Glut1 C terminus and (b) Glut1 serves as a sensor, transducer, and amplifier for glucose signaling to PYK2 and ERK.     

Role of mitogen-activated protein kinase (MAPK) docking sites on Staufen2 protein in dendritic mRNA transport

Although transport and subsequent translation of dendritic mRNA play an important role in neuronal synaptic plasticity, the underlying mechanisms for modulating dendritic mRNA transport are almost completely unknown. In this study, we identified and characterized an interaction between Staufen2 and mitogen-activated protein kinase (MAPK) with co-immunoprecipitation assays. Staufen2 utilized a docking (D) site to interact with ERK1/2; deleting the D-site decreased colocalization of Staufen2 with immunoreactive ERK1/2 in the cell body regions of cultured hippocampal neurons, and it reduced the amount of Staufen2-containing RNP complexes in the distal dendrites. In addition, the deletion completely abolished the depolarization-induced increase of Staufen2-containing RNP complexes. These results suggest that the MAPK pathway could modulate dendritic mRNA transport through its interaction with Staufen2.     

HIV protease cleaves poly(A)-binding protein

The PABP [poly(A)-binding protein] is able to interact with the 3' poly(A) tail of eukaryotic mRNA, promoting its translation. Cleavage of PABP by viral proteases encoded by several picornaviruses and caliciviruses plays a role in the abrogation of cellular protein synthesis. We report that infection of MT-2 cells with HIV-1 leads to efficient proteolysis of PABP. Analysis of PABP integrity was carried out in BHK-21 (baby-hamster kidney) and COS-7 cells upon individual expression of the protease from several members of the Retroviridae family, e.g. MoMLV (Moloney murine leukaemia virus), MMTV (mouse mammary tumour virus), HTLV-I (human T-cell leukaemia virus type I), SIV (simian immunodeficiency virus), HIV-1 and HIV-2. Moreover, protease activity against PABP was tested in a HeLa-cell-free system. Only MMTV, HIV-1 and HIV-2 proteases were able to cleave PABP in the absence of other viral proteins. Purified HIV-1 and HIV-2 proteases cleave PABP1 directly at positions 237 and 477, separating the two first RNA-recognition motifs from the C-terminal domain of PABP. An additional cleavage site located at position 410 was detected for HIV-2 protease. These findings indicate that some retroviruses may share with picornaviruses and caliciviruses the capacity to proteolyse PABP.     

Mechanical pressure-induced phosphorylation of p38 mitogen-activated protein kinase in epithelial cells via Src and protein kinase C

The aim of this study was to determine the impact of lentiviral transduction on primary murine B cells. Studying B cell activities in vivo or using them for tolerance induction requires that the cells remain unaltered in their biological behavior except for expression of the transgene. As we show here, murine B cells can efficiently be transduced by lentiviral, VSV-G-pseudotyped vectors without the necessity of prior activation. Culture with LPS gave enhanced transduction efficiencies but led to the upregulation of CD86 and proliferation of the cells. Transduction of naive B cells by lentiviral vectors was dependent on multiplicity of infection and did not lead to a concomitant activation. Furthermore, the transduced cells could be used for studies in the NOD mouse system without altering the onset of diabetes. We conclude that lentiviral gene transfer into naive B cells is a powerful tool for manipulation of B cells for therapeutic applications.     

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.     

Poly(A), poly(A) binding protein and the regulation of mRNA stability

This review has focused on the possibility that interactions between mRNA sequences and the poly(A)-nucleoprotein complex play important roles in mRNA turnover. It is important to stress that additional genetic and biochemical tests are necessary to characterize how PABP interacts with mRNA in cells and to determine whether the poly(A) protection hypothesis is accurate. Moreover, there may be a significant number of mRNAs whose half-lives are independent of polyadenylation. For example, the stabilities of poly(A)-containing and deadenylated alpha 2u-globulin and interferon mRNAs are similar in microinjected oocytes. Thus, an important challenge in this field will be to analyse the complex and interactive factors that determine the half-lives of specific mRNAs.     

Degradation of poly(A)-binding protein in apoptotic cells and linkage to translation regulation

We have recently shown that poly(A)-binding protein (PABP) is cleaved during poliovirus and Coxsackievirus infection by viral 3Cprotease and that 3Cprotease modification of a subset of PABP can result in significant translation inhibition. During apoptosis, translation undergoes significant down-regulation that correlates with caspase-3 mediated cleavage of several translation factors, including eIF4G, 4EBP1 and eIF2alpha. The fate of PABP in apoptotic cells has not yet been examined. Here we show that PABP levels decline significantly via proteolytic degradation in apoptotic HeLa, Jurkat and MCF7 cells. The degradation of PABP correlated with translation inhibition but lagged behind cleavage of eIF4GI. In apoptotic MCF7 cells translation inhibition occurred without modification of most translation factors and correlated with PABP degradation. PABP was not cleaved during incubation with several caspases, yet caspase 3 induced weak PABP degradative activity in cells lysates. Both the caspase inhibitor zVAD and calpain inhibitors blocked PABP cleavage in vivo, while the proteosome inhibitor MG132 induced PABP degradation. Protease(s) activated during apoptosis preferentially degraded PABP associated with ribosomes and translation factors, but not PABP in other cellular compartments. The data suggest that targeted degradation of PABP contributes to translation inhibition in apoptotic cells.