Sequence and conformation of 5 S RNA from Chlorella cytoplasmic ribosomes: comparison with other 5 S RNA molecules

The sequence of Chlorella cytoplasmic 5 S RNA has been determined by fingerprinting techniques. Partial digests were fractionated by a two-dimensional acrylamide gel electrophoretic technique, which indicates whether specific fragments are paired in the molecule. In this way, the four main base-paired regions of the molecule were located. The sequence of Chlorella cytoplasmic 5 S RNA is related to, but different from, that of other eukaryotic 5 S RNAs: it shows approximately 60% homology with vertebrate 5 S RNA and 40% homology with yeast 5 S RNA. In some respects the conformation of the molecule in solution is quite different from that of other sequenced 5 S RNAs: in particular, the highly accessible region found around position 40 in all other 5 S RNAs (prokaryotic and eukaryotic) does not exist in this molecule.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

The nucleotide sequence of the 5S RNA of chicken embryo fibroblasts.

The nucleotide sequence of uniformly 32P-labelled chicken 5S RNA has been determined by analysing the end-products of T1 and pancreatic ribonuclease digestion. These oligonucleotides can be aligned by homology with the human sequence to give a sequence differing in only seven positions from that of Man. The sequence deduced here differs in two position from that previously published for chicken 5S RNA.     

Ribosomal RNA genes of Saccharomyces cerevisiae. I. Physical map of the repeating unit and location of the regions coding for 5 S, 5.8 S, 18 S, and 25 S ribosomal RNAs.

The organization of the ribosomal DNA repeating unit from Saccharomyces cerevisiae has been analyzed. A cloned ribosomal DNA repeating unit has been mapped with the restriction enzymes Xma 1, Kpn 1, HindIII, Xba 1, Bgl I + II, and EcoRI. The locations of the sequences which code for 5 S, 5.8 S, 18 S, and 25 S ribosomal RNAs have been determined by hybridization of the purified RNA species with restriction endonuclease generated fragments of the repeating unit. The position of the 5.8 S ribosomal DNA sequences within the repeat was also established by sequencing the DNA which codes for 83 nucleotides at the 5' end of 5.8 S ribosomal RNA. The polarity of the 35 S ribosomal RNA precursor has been established by a combination of hybridization analysis and DNA sequence determination and is 5'-18 S, 5.8 S, 25 S-3'.     

Nucleotide sequence, secondary structure and evolution of the 5S ribosomal RNA from five bacterial species

The nucleotide sequences of the 5S ribosomal RNAs of the bacteria Agrobacterium tumefaciens, Alcaligenes faecalis, Pseudomonas cepacia, Aquaspirillum serpens and Acinetobacter calcoaceticus have been determined. The sequences fit in a generally accepted model for 5S RNA secondary structure. However, a closer comparative examination of these and other bacterial 5S RNA primary structures reveals the potential of additional base pairing and of multiple equilibria between a set of slightly different alternative secondary structures in one area of the molecule. The phylogenetic position of the examined bacteria is derived from a 5S RNA sequence alignment by a clustering method and compared with the position derived on the basis of 16S ribosomal RNA oligonucleotide catalogs.     

Topography of 16 S RNA in 30 S subunits and 70 S ribosomes accessibility to cobra venom ribonuclease

A ribonuclease extracted from the venom of the cobra Naja oxiana, which shows an unusual specificity for double-stranded RNA regions, was used to obtain new insight on the topography of Escherichia coli ribosomal 16 S RNA in the 30 S subunit and in the 70 S couple. ³²P-labeled 30 S subunits or reconstituted 70 S tight couples containing ³²P-labeled 16 S RNA have been digested under progressively stronger conditions. The cleavage sites have been precisely localized and the chronology of the hydrolysis process studied.The enzyme cleaves the 16 S RNA within 30 S subunits at 21 different sites, which are not uniformly distributed along the molecule. These results provide valuable information on the 16 S RNA topography and evidence for secondary structure features.The binding of the 50 S subunit markedly reduces the rate of the 16 S RNA hydrolysis and provides protection for several cleavage sites. Four of them are clustered in the 3′-terminal 200 nucleotides of the molecule, one in the middle (at position 772) and one in the 5′ domain (at position 336). Our results provide further evidence that the 3′-terminal and central regions of the RNA chain are close to each other in the ribosome structure and lie at the interface of the two subunits. They also suggest that the 5′ domain is probably not involved exclusively in structure and assembly.     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

Nucleotide sequence and structure of cytoplasmic 5S RNA and 5.8S RNA of Chlamydomonas reinhardii.

Three small RNAs of the cytoplasmic 8OS ribosomes of the green unicellular alga Chlamydomonas reinhardii have been sequenced. They include two species of ribosomal 5S RNA, a major and a minor one of 122 and 121 nucleotides respectively, which differ from each other by 17 bases, and also the ribosomal 5.8S RNA of 156 nucleotides. Novel structural features can be recognized in the 5S RNAs of C. reinhardii by a comparison with published 5S RNA sequences. In addition the secondary structure of these small RNA molecules has been examined using a newly developed method based on differential nuclease susceptibility.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Oocyte and somatic 5S ribosomal RNA and 5S RNA encoding genes in Xenopus tropicalis.

We have investigated the structure of oocyte and somatic 5S ribosomal RNA and of 5S RNA encoding genes in Xenopus tropicalis. The sequences of the two 5S RNA families differ in four positions, but only one of these substitutions, a C to U transition in position 79 within the internal control region of the corresponding 5S RNA encoding genes, is a distinguishing characteristic of all Xenopus somatic and oocyte 5S RNAs characterized to date, including those from Xenopus laevis and Xenopus borealis. 5S RNA genes in Xenopus tropicalis are organized in clusters of multiple repeats of a 264 base pair unit; the structural and functional organization of the Xenopus tropicalis oocyte 5S gene is similar to the somatic but distinct from the oocyte 5S DNA in Xenopus laevis and Xenopus borealis. A comparative sequence analysis reveals the presence of a strictly conserved pentamer motif AAAGT in the 5'-flanking region of Xenopus 5S genes which we demonstrate in a separate communication to serve as a binding signal for an upstream stimulatory factor.     

Cytoplasmic methylation of mature 5.8 S ribosomal RNA

Levels of 2-O-methylation were determined in ribosomal 5·8 S RNAs from whole cells and both the nuclear and cytoplasmic fractions of rat liver, rat kidney cells in culture (NRK) and HeLa cells. All 5·8 S RNA molecules contained the alkali stable Gm-Cp dinucleotide at position 77 but only whole cell rat liver RNA contained large amounts (0·7 mol) of Um at position 14. All nuclear 5·8 S RNA fractions were largely undermethylated at this site. In contrast, cytoplasmic 5.8 S RNA from rat liver and, to a lesser degree, NRK cells contained significantly more Um; up to 80% of the molecules from rat liver contained the methylated residue. These results indicate that mature 5·8 S RNA can be methylated in the cytoplasm. When labeling kinetics were examined in NRK cells, the methylation at residue 14 was found to increase as a function of the time spent in the cytoplasm, confirming that this modification is, unlike other ribosomal RNA methylations, in part or largely cytoplasmic.     

Chromosomal localization of 18S + 28S and 5S ribosomal RNA genes in evolutionarily diverse anuran amphibians

The chromosomal locations of the 18S + 28S and 5S ribosomal RNA genes have been analyzed by in situ hybridization in ten anuran species of different taxonomic positions. The chosen species belong to both primitive and evolved families of the present day Anura. Each examined species has 18S + 28S rRNA genes clustered in one locus per haploid chromosome set: this locus is placed either in an intercalary position or proximal to the centromere, or close to the telomere. The 5S rRNA genes are arranged in clusters which vary in number from one to six per haploid set. The 5S rDNA sites are found in intercalary positions, at the telomeres, and at, or close to, the centromeres. Microchromosomes and small chromosomes in primitive karyotypes have been found to carry 5S rDNA sequences. The results are discussed in relation to ideas on the karyological evolution of Amphibia.     

Conformation of 4.5S RNA in the signal recognition particle and on the 30S ribosomal subunit

The signal recognition particle (SRP) from Escherichia coli consists of 4.5S RNA and protein Ffh. It is essential for targeting ribosomes that are translating integral membrane proteins to the translocation pore in the plasma membrane. Independently of Ffh, 4.5S RNA also interacts with elongation factor G (EF-G) and the 30S ribosomal subunit. Here we use a cross-linking approach to probe the conformation of 4.5S RNA in SRP and in the complex with the 30S ribosomal subunit and to map the binding site. The UV-activatable cross-linker p-azidophenacyl bromide (AzP) was attached to positions 1, 21, and 54 of wild-type or modified 4.5S RNA. In SRP, cross-links to Ffh were formed from AzP in all three positions in 4.5S RNA, indicating a strongly bent conformation in which the 5' end (position 1) and the tetraloop region (including position 54) of the molecule are close to one another and to Ffh. In ribosomal complexes of 4.5S RNA, AzP in both positions 1 and 54 formed cross-links to the 30S ribosomal subunit, independently of the presence of Ffh. The major cross-linking target on the ribosome was protein S7; minor cross-links were formed to S2, S18, and S21. There were no cross-links from 4.5S RNA to the 50S subunit, where the primary binding site of SRP is located close to the peptide exit. The functional role of 4.5S RNA binding to the 30S subunit is unclear, as the RNA had no effect on translation or tRNA translocation on the ribosome.     

5S RNA structure and interaction with transcription factor A. 1. Ribonuclease probe of the structure of 5S RNA from Xenopus laevis oocytes

The structure of Xenopus laevis oocyte (Xlo) 5S ribosomal RNA has been probed with single-strand-specific ribonucleases T1, T2, and A with double-strand-specific ribonuclease V1 from cobra venom. The digestion of 5'- or 3'-labeled renatured 5S RNA samples followed by gel purification of the digested samples allowed the determination of primary cleavage sites. Results of these ribonuclease digestions provide support for the generalized 5S RNA secondary structural model derived from comparative sequence analysis. However, three putative single-stranded regions of the molecule exhibited unexpected V1 cuts, found at C36, U73, U76, and U102. These V1 cuts reflect additional secondary structural features of the RNA including A.G base pairs and support the extended base pairing in the stem containing helices IV and V which was proposed by Stahl et al. [Stahl, D. A., Luehrsen, K. R., Woese, C. R., & Pace, N. R. (1981) Nucleic Acids Res. 9, 6129-6137]. A conserved structure for helix V having a common unpaired uracil residue at Xlo position 84 is proposed for all eukaryotic 5S RNAs. Our results are compared with nuclease probes of other 5S RNAs.     

Evolution of the 5 S RNA genes in vertebrates

Summary We have built the phylogenetic tree of Vertebrate 5S RNA using the sequence data of thirteen species belonging to six groups. Evolution of the 5S genes has been very slow in Vertebrates since 90 residues are identical in all 5S RNAs which are presently sequenced.In Amphibians and Teleosts different 5S genes are active in oocytes and in somatic cells. This dual gene system has probably been acquired independently by Amphibians and Teleosts. In Amphibians, the oocyte-type 5S genes have evolved much faster than the somatic-type genes. This is not true in all species since the oocyte-type genes of one Teleost (Tinca tinca) have evolved more slowly than the somatic-type genes.There are in all Vertebrate 5S RNAs five complementary regions which can be base-paired. The sequence data are compatible with the three secondary-structure models that have been proposed for 5S RNA.     

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris

The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5' (sequence in text) 3'. Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV. Some of these unusual structural features are shared by several of the known 5S RNA sequences from mycoplasmas. However, the characteristic bloc of deletions found in helix V of these mycoplasma 5S RNAs is not present in the 5S RNA of S. cremoris.     

Chromosome location of the genes for 28S, 18S and 5S ribosomal RNA in Triturus marmoratus (Amphibia Urodela)

The localization of the 28S, 18S and 5S rRNA genes in the mitotic chromosomes, and of the 5S rRNA genes in the lampbrush chromosomes of Triturus marmoratus has been studied by RNA/DNA in situ hybridization. The 28S and 18S genes are located in a subterminal position, and the 5S genes in an intermediate position, on the long arm of mitotic chromosome X. In situ hybridization on lampbrush chromosomes has shown that the 5S genes are located at or near a dense matrix loop landmark. The cytogenetic implications of these findings are briefly discussed.