The structure of nuclear pre-mRNA. VII. The hybridization and renaturation properties of double-stranded sequences of nuclear pre-mRNA]

Some properties of the double-stranded regions of pre-mRNA are discribed. 1. The double-stranded regions contain approximately 80 base pairs. 2. The material contains the heterogeneous populations of sequences and some homogenous material which renatures with a COT1/2 value of (1.5-3) X 10(-4). 3. Identical sequences of fast-renaturing "hairpins" may be found in various tissues. 4. Double-stranded RNA and mRNA have some sequences complementary to each other. These results consistent with the view that the hairpin sequences may act as specific recognition sites for ribonucleases involved in processing of pre-mRNA.     

Short artificial hairpins sequester splicing signals and inhibit yeast pre-mRNA splicing.

To examine the stability of yeast (Saccharomyces cerevisiae) pre-mRNA structures, we inserted a series of small sequence elements that generated potential RNA hairpins at the 5' splice site and branch point regions. We analyzed spliceosome assembly and splicing in vitro as well as splicing and nuclear pre-mRNA retention in vivo. Surprisingly, the inhibition of in vivo splicing approximately paralleled that of in vitro splicing. Even a 6-nucleotide hairpin could be shown to inhibit splicing, and a 15-nucleotide hairpin gave rise to almost complete inhibition. The in vitro results indicate that hairpins that sequester the 5' splice site have a major effect on the early steps of spliceosome assembly, including U1 small nuclear ribonucleoprotein binding. The in vivo experiments lead to comparable conclusions as the sequestering hairpins apparently result in the transport of pre-mRNA to the cytoplasm. The observations are compared with previous data from both yeast and mammalian systems and suggest an important effect of pre-mRNA structure on in vivo splicing.     

Hybridization of mRNA and pre-mRNA with the sequences forming double-stranded structures in pre-mRNA

About 25% of the double-stranded sequences isolated from pre-mRNA are able to hybridize, after melting, with either mRNA or non-melted pre-mRNA. The retention of one branch of pre-mRNA hairpin in mRNA was suggested. It was also found that in addition to the hairpin-like structures comprising about 3% of the total sequences another 15% of the pre-mRNA sequences can form double-stranded structures upon annealing over a broad interval of Cot values.     

Targeting a pre-mRNA structure with bipartite antisense molecules modulates tau alternative splicing

Approximately 15% of human genetic diseases are estimated to involve dysregulation of alternative pre-mRNA splicing. Antisense molecules designed to alter these and other splicing events typically target continuous linear sequences of the message. Here, we show that a structural feature in a pre-mRNA can be targeted by bipartite antisense molecules designed to hybridize with the discontinuous elements that flank the structure and thereby alter splicing. We targeted a hairpin structure at the boundary between exon 10 and intron 10 of the pre-mRNA of tau. Mutations in this region that are associated with certain forms of frontotemporal dementia, destabilize the hairpin to cause increased inclusion of exon 10. Via electrophoretic mobility shift and RNase protection assays, we demonstrate that bipartite antisense molecules designed to simultaneously interact with the available sequences that immediately flank the tau pre-mRNA hairpin do indeed bind to this structured region. Moreover, these agents inhibit exon 10 splicing and reverse the effect of destabilizing disease-causing mutations, in both in vitro splicing assays and cell culture. This general bipartite antisense strategy could be employed to modulate other splicing events that are regulated by RNA secondary structure.     

Characterization of inverted repeated sequences in wheat nuclear DNA.

The properties of inverted repeated sequences in wheat nuclear DNA have been studied by HAP(1) chromatography, nuclease S1 digestion and electron microscopy. Inverted repeated sequences comprise 1.7% of wheat genome. The HAP studies show that the amount of "foldback HAP bound DNA" depends on DNA length. Inverted repeats appear to be clustered with an average intercluster distance of 25 kb. It is estimated that there are approximately 3 x 10(6) inverted repeats per haploid wheat genome. The sequences around inverted repeats involve all families of repetition frequencies. Inverted repeats are observed as hairpins in electron microscopy. 20% of hairpins are terminated by a single-stranded spacer ranging from 0.3 to 1.5 kb in length. Duplex regions of the inverted repeats range from 0.1 to 0.45 kb with number average values of 0.24 kb and 0.18 kb for unlooped and looped hairpin respectively. Thermal denaturations and nuclease S1 digestions have revealed a length of about 100 bases for duplex regions. The methods used to study inverted repeated sequences are compared and discussed.     

Structure of nuclear pre-mRNA. VIII. Isolation and characterization of complementary sequences.

After the annealing of pre-mRNA at high Cot values, up to 20% of the material becomes resistant to the action of ribonuclease. This has been attributed to the presence of self-complementary sequences (scRNA) in the pre-mRNA. The most important properties of scRNA, which was isolated in preparative amounts, have been studied. The approximate dimensions of the complementary segments are 45-50 nucleotides. Hybridization experiments have shown that scRNA is transcribed from repeated segments of the genome. It may be postulated that the rapidly hybridizing pre-mRNA fraction consists mainly of self-complementary sequences.     

An electron microscopic study of mouse foldback DNA.

Foldback DNA is defined by its rapid, concentration-independent renaturation, consistent with intramolecular base pairing of inverted repeat sequences. Foldback DNA, isolated from renatured mouse main band DNA by hydroxyapatite chromatography, is spread for electron microscopy by the formamide isodenaturing technique. A large fraction of the molecules can be recognized as intramolecular "hairpins"--structures in which complementary sequences on a single DNA strand form base-paired "stem" regions analogous to tRNA stems. The stem regions of the hairpins have a wide distribution of lengths, averaging about 1000 base pairs. About 60% of the stem regions terminate in single-stranded loops, ranging from 400 to many thousands of nucleotides in length, while 40% of the hairpins do not have discernible loops. There are about 40,000 hairpin-forming sequences in the main band portion of the mouse haploid genome. They appear to be either clustered in groups or confined to about one third of the DNA, rather than uniformly or randomly distributed. Another large fraction of the molecules seen in foldback DNA consists of linear structures, some of which are probably also hairpins. The electron microscopic results, along with simple theoretical considerations, make possible a better interpretation of our previous studies of the yield and S1 nuclease resistance of mouse foldback DNA.     

Structural roles of CTG repeats in slippage expansion during DNA replication

CTG triplet repeat sequences have been found to form slipped-strand structures leading to self-expansion during DNA replication. The lengthening of these repeats causes the onset of neurodegenerative diseases, such as myotonic dystrophy. In this study, electrophoretic and NMR spectroscopic studies have been carried out to investigate the length and the structural roles of CTG repeats in affecting the hairpin formation propensity. Direct NMR evidence has been successfully obtained the first time to support the presence of three types of hairpin structures in sequences containing 1–10 CTG repeats. The first type contains no intra-loop hydrogen bond and occurs when the number of repeats is less than four. The second type has a 4 nt TGCT-loop and occurs in sequences with even number of repeats. The third type contains a 3 nt CTG-loop and occurs in sequences with odd number of repeats. Although stabilizing interactions have been identified between CTG repeats in both the second and third types of hairpins, the structural differences observed account for the higher hairpin formation propensity in sequences containing even number of CTG repeats. The results of this study confirm the hairpin loop structures and explain how slippage occurs during DNA replication.     

Direct demonstration of a complementarity between mRNA and double-stranded sequences of pre-mRNA

The total poly(A)-containing mRNA from mouse liver or Ehrlich ascites carcinoma cells was annealed with denatured ds RNA prepared from heavy nuclear ³H-labeled pre-mRNA of the same tissue. The hybrids formed were detected by binding of complexes to poly(U)-Sepharose columns through the poly(A) of mRNA. With this technique, about 30% of labeled ds RNA was bound to poly(U)-Sepharose after annealing it with an mRNA excess. The proportion of hybrid material detected by RNase treatment was two to three times lower than that obtained by poly(U)-Sepharose binding. The length of the RNase-stable acid precipitable hybrid material consisted of heterogeneous sequences of 10–100 nucleotides long when cytoplasmic, and 10–60 nucleotides long when polysomal mRNA was used in the hybridization reaction. The results obtained show that at least some of the mRNA molecules contain sequences complementary to one of the branches of the pre-mRNA hairpins. These results are compatible with the idea that the hairpin-like sequences in pre-mRNA are localized between mRNA and the non-informative part of the precursor molecule.     

A thermodynamic study of unusually stable RNA and DNA hairpins.

About 70% of the RNA tetra-loop sequences identified in ribosomal RNAs from different organisms fall into either (UNCG) or (GNRA) families (where N = A, C, G, or U; and R = A or G). RNA hairpins with these loop sequences form unusually stable tetra-loop structures. We have studied the RNA hairpin GGAC(UUCG)GUCC and several sequence variants to determine the effect of changing the loop sequence and the loop-closing base pair on the thermodynamic stability of (UNCG) tetra-loops. The hairpin GGAG(CUUG)CUCC with the conserved loop G(CUUG)C was also unusually stable. We have determined melting temperatures (Tm), and obtained thermodynamic parameters for DNA hairpins with sequences analogous to stable RNA hairpins with (UNCG), C(GNRA)G, C(GAUA)G, and G(CUUG)C loops. DNA hairpins with (TTCG), (dUdUCG), and related sequences in the loop, unlike their RNA counterparts, did not form unusually stable hairpins. However, DNA hairpins with the consensus loop sequence C(GNRA)G were very stable compared to hairpins with C(TTTT)G or C(AAAA)G loops. The C(GATA)G and G(CTTG)C loops were also extra stable. The relative stabilities of the unusually stable DNA hairpins are similar to those observed for their RNA analogs.     

A double hairpin structure is necessary for the efficient encapsidation of spleen necrosis virus retroviral RNA.

We conducted a mutational analysis within the previously defined encapsidation sequence (E) for spleen necrosis virus (SNV), an avian retrovirus. We found that two regions are necessary for efficient SNV replication. The first region is a double hairpin structure as proposed by Konings et al. (1992, J. Virol., 66, 632-640); the second region is located downstream of the hairpins. We showed further that the double hairpin structure is required for efficient SNV RNA encapsidation. Our work is the first to demonstrate, via linker-scanning and site-directed mutagenesis, that a specific RNA secondary structure is required for the encapsidation of retroviral RNA. Analysis of a series of mutations within the E region indicates (i) that preserving the secondary structure of the two hairpins is important for efficient encapsidation and (ii) that the stem regions of the hairpins contain specific sequences critical for encapsidation. Within the hairpins, the presence of at least one of the two conserved GACG four-residue loops, but not the moderately conserved bulge sequence of the first hairpin, is crucial for function. The function of the hairpins is independent of the relative order of the two hairpins. However, the two hairpins are not redundant and are not functionally identical. Replacement of SNV double hairpin sequences with those of Moloney murine leukemia virus (M-MLV) has no detectable effect on the replication of SNV-based retrovirus vectors with reticuloendotheliosis virus strain A (REV-A) helper virus. Furthermore, replacement of the entire E sequence of SNV with that of Moloney murine sarcoma virus (M-MSV) and M-MLV results in retroviral vectors that replicate as well as SNV vectors with wild type SNV E. This result indicates that the encapsidation sequences of M-MSV/M-MLV and SNV are not virus specific and that, during packaging of SNV and MLV RNA with viral proteins from REV-A, the encapsidation sequences are recognized largely by their secondary or tertiary structures.     

Multinuclear NMR studies of DNA hairpins. 2. Sequence-dependent structural variations

The solution conformation of three related DNA hairpins, each with five bases in the loop, is investigated by proton and phosphorus 2D NMR methods. The sequences of the three oligomers are d(CGCGTTGTTCGCG), d(CGCGTTTGTCGCG), and d(CTGCTCTTGTTGAGCAG). One pair of hairpins shares the same stem sequence but differs in the loop, and the appearance of an unusual phosphate torsion in the stem is found to depend on the sequence in the loop of the hairpin. The second pair of hairpins shares the same loop region but differs in the stem sequence in that the base pair which closes the loop is a C-G or G-C pair. The pattern of NOEs reveals that the stacking arrangement in the loop region depends on the base pair that closes the stem. These results suggest that hairpin loop conformation and dynamics are sensitive to small changes in the loop and adjacent stem sequences. These findings are discussed in relation to sequence-dependent thermodynamic changes that have been observed in RNA hairpins.     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

The structure of Tetrahymena pyriformis mitochondrial DNA. II. The complex structure of strain GL mitochondrial DNA.

1. Isolated mtDNA from Tetrahymena pyriformis strain GL is a linear duplex molecule with an average molecular weight of 32.6 - 10(6) and without internal gaps or breaks. Denaturation of this DNA results in single strands with a duplex hairpin at one end. The length of this hairpin varies between 0 and 5 micrometer within one preparation. 2. Uder renaturation conditions the single strands with hairpins are able to circularize in two ways, depending on the length of the hairpin. Circularization is also observed after partial digestion with exonuclease III of native strain GL mtDNA. 3. All these data fit a model (see Fig.2) in which the DNA is heterogeneous in length at both ends. At the left end a 10-micrometer duplication-inversion is present; part of this duplication-inversion is complementary to a region at the right end of the molecule. 4. The analogy between the structural peculiarities of strain GL mtDNA and of some linear viral DNAs is stressed.     

Letter: Filamentous bacterial viruses. X. X-ray diffraction studies of the R4-protein mutant

Eukaryotic DNA fragments that are totally denatured by alkali swiftly re-form duplex regions that are several hundred up to several thousand nucleotide pairs in length. A combination of sedimentation and electron microscopic studies demonstrate that they arise by the folding-back of a single linear chain, and not from cross-linking between the two complementary chains. Thus these “hairpin”-like structures must come from inverted repetitions of the type A B C t C′B′A′ that are located at intervals along the chromatid. Electron microscopic studies, reveal no unpaired single-chain regions in the “turn-around” t. The resistance of these hairpins to single-chain specific nucleases indicates that t must only consist of a few nucleotides. Therefore we call these regions in double-chain DNA palindromes, because, given the antiparallel arrangement of the polynucleotide chains, these sequences read the same both backwards and forwards. The thermal stability profile of these hairpins is nearly identical to that of sonicated duplex fragments of comparable length. Since these hairpins have the same average base composition as bulk DNA, the palindromes are nearly perfect. By studying the fraction of DNA retained on hydroxyapatite as a function of chain length, one may determine the distribution of palindromes along the DNA. These experiments are best explained by clusters of palindromes located at intervals of 10 to 80 /gm depending on the species. The presence of such long, well-matched palindromes suggests that the linear double helix may sometimes adopt an alternative configuration, the cruciform, in which mismatches that may occur are eliminated by excision and repair.     

Long double-stranded sequences (dsRNA-B) of nuclear pre-mRNA consist of a few highly abundant classes of sequences: evidence from DNA cloning experiments.

DNA preparations from about hundred randomly selected clones containing mouse DNA fragments were screened for the existence of sequences complementary to long double-stranded regions of pre-mRNA able to snap back after melting (dsRNA-B). Many clones containing such sequences were found. The cloned sequences can be subdivided into three groups: (1) those complementary to about a half (at least to 30-40%) of the total dsRNA, designated as sequences B1; (2) those complementary to a part of sequence B1; and (3) sequences complementary to about a quarter (at least to 15%) of the total dsRNA referred to as sequence B2. The size of DNA sequence complementary to dsRNA is about 400 base pairs.Melting experiments with hybrids show that the members of B1 family are very similar if not identical, while the divergence among B2 sequences is higher, but still the number of substitutions does not exceed 9% of bases. Thus, the major part of dsRNA-B consists of a small number of highly abundant sequences as was suggested earlier on the basis of renaturation kinetics /1-3/. Sequences B1 and B2 are represented by many copies in the mouse genome and in pre-mRNA, and many of them probably do not form hairpin-like structures.