Purification and characterization of a DNA polymerase from the archaebacterium Thermoplasma acidophilum

A thermophilic DNA polymerase has been purified to near homogeneity from the archaebacterium Thermoplasma acidophilum. Analysis of the purified enzyme by sodium dodecyl sulfate gel electrophoresis revealed a single polypeptide of 88 kDa which co-sediments with the DNA polymerase activity on sucrose gradients. Combination of sedimentation and gel filtration analyses indicates that this DNA polymerase is an 88-kDa monomeric enzyme in its native form. The DNA polymerase is resistant to aphidicolin, slightly sensitive to 2',3'-dideoxyribosylthymine triphosphate and inhibited by N-ethylmaleimide when preincubation with this reagent is performed at 65 degrees C. We find that a 3'----5' exonuclease activity is associated with the purified DNA polymerase; the two activities of the enzyme are optimal at 65 degrees C but the exonuclease activity is active in a broader range of lower temperatures and is more thermostable than the DNA polymerase activity.     

The nucleotide sequence of the tRNAMMet from the archaebacterium Thermoplasma acidophilum.

Using in vitro labelling techniques, a tRNAMMet from Thermoplasma acidophilum, a member of the Archaebacteriae, has been shown to have the sequence: pGCCGGG Gs4UGGCUCANCUGGAGGAGC m2(2)GCCGGACmUCAUt6AAUCCGGAGGUCUCGGG psi psi CmGAUCCCCGAUCCCGGCACCAOH. Despite the small genome size of this non-parasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. There is no close sequence homology between this tRNA and that of any other methionine tRNA so far sequenced (less than 70%) but it has almost 90% homology with the nucleotide sequence proposed by Eigen and Oswatitsch for the ancestral quasi-species.     

Purification and properties of malate dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum

Malate dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum is purified 50-fold to electrophoretic homogeneity. The purified enzyme crystallizes readily. Native malate dehydrogenase shows a relative molecular mass of 144 000. It is a tetramer of identical subunits with a relative molecular mass of 36 600. Malate dehydrogenase from Thermoplasma uses both NADH and NADPH as coenzyme to reduce oxaloacetate. The enzyme shows A-side (pro-R) stereospecificity for both coenzymes. The pH optimum for the reduction of oxaloacetate in the presence of NADH is found to be at pH 8.1. At pH 7.4 the Km value for oxaloacetate is found to be 5.6 microM while for NADH a value of 11.7 microM is found. The homogeneous enzyme shows a turnover number of kcat = 108 s-1.     

Purification, crystallization, and preliminary X-ray diffraction analysis of the Tricorn protease hexamer from Thermoplasma acidophilum

Tricorn protease from Thermoplasma acidophilum is a hexameric enzyme; in vivo the hexamers assemble further to form large icosahedral capsids of 14.6 MDa. Recombinant Tricorn protease was purified as an enzymatically active hexamer of 0.72 MDa that formed crystals of octahedral morphology under low-ionic-strength conditions. These crystals belong to space group C2 with unit cell dimensions a = 307.5 A, b = 163.2 A, c = 220.9 A, beta = 105.5 degrees and diffract to 2.2-A resolution using high-brilliance synchrotron radiation. Based on analysis of the self-rotation function and the presence of a pseudo-origin peak in the native Patterson map, a packing model was derived for the complex, comprising 1.5 hexamers per asymmetric unit with a solvent content of 43%. Due to the ninefold noncrystallographic symmetry the Tricorn crystals represent an interesting case for phasing X-ray crystallographic data by electron microscopic phase information.     

Crystallization and preliminary crystallographic study of glucose dehydrogenase from the archaebacterium Thermoplasma acidophilum

Single crystals of glucose dehydrogenase from the archaebacterium Thermoplasma acidophilum were obtained using the hanging-drop vapour diffusion method and polyethylene glycol as a precipitant in the presence of NADP+ at pH 5.4. The crystals belong to the hexagonal space group P6122 or P6522, with unit cell dimensions a = b = 121.9 angstrom, c = 229.6 angstrom and with two molecules in the asymmetric unit.     

Purification and characterization of glucose dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

Glucose dehydrogenase was purified to homogeneity from the thermoacidophilic archaebacterium Thermoplasma acidophilum. The enzyme is a tetramer of polypeptide chain Mr 38,000 +/- 3000, it is catalytically active with both NAD+ and NADP+ cofactors, and it is thermostable and remarkably resistant to a variety of organic solvents. The amino acid composition was determined and compared with those of the glucose dehydrogenases from the archaebacterium Sulfolobus solfataricus and the eubacteria Bacillus subtilis and Bacillus megaterium. The N-terminal amino acid sequence of the Thermoplasma acidophilum enzyme was determined to be: (S/T)-E-Q-K-A-I-V-T-D-A-P-K-G-G-V-K-Y-T-T-I-D-M-P-E.     

Organization of rRNA structural genes in the archaebacterium Thermoplasma acidophilum.

In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 Kb. No linkage between those genes has been found by the analysis of recombinant plasmids carrying Bam HI and Hind III rDNA fragments as by hybridizing those plasmids to fragments of Thermoplasma DNA generated by 6 individual restriction endonucleases, recognizing hexanucleotide sequences.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.     

The plasmids found in isolates of the acidothermophilic archaebacterium Thermoplasma acidophilum

Abstract Plasmids were detected in isolates of an acidothermophilic archaebacterium Thermoplasma acidophilum . One of the plasmids, pTA1, was characterized. The plasmid was a circular DNA of 15.2 kbp. A physical map was constructed using three restriction endonucleases. A copy number of this plasmid was estimated to be 7–13 per cell. The homologous sequence was not found in the chromosomal DNA of the host cell.     

Kinetics and mechanism of the citrate synthase from the thermophilic archaeon Thermoplasma acidophilum

The kinetics and mechanism of the citrate synthase from a moderate thermophile, Thermoplasma acidophilum (TpCS), are compared with those of the citrate synthase from a mesophile, pig heart (PCS). All discrete steps in the mechanistic sequence of PCS can be identified in TpCS. The catalytic strategies identified in PCS, destabilization of the oxaloacetate substrate carbonyl and stabilization of the reactive species, acetyl-CoA enolate, are present in TpCS. Conformational changes, which allow the enzyme to efficiently catalyze both condensation of acetyl-CoA thioester and subsequently hydrolysis of citryl-CoA thioester within the same active site, occur in both enzymes. However, significant differences exist between the two enzymes. PCS is a characteristically efficient enzyme: no internal step is clearly rate-limiting and the condensation step is readily reversible. TpCS is a less efficient catalyst. Over a broad temperature range, inadequate stabilization of the transition state for citryl-CoA hydrolysis renders this step nearly rate-limiting for the forward reaction of TpCS. Further, excessive stabilization of the citryl-CoA intermediate renders the condensation step nearly irreversible. Values of substrate and solvent deuterium isotope effects are consistent with the kinetic model. Near its temperature optimum (70 degrees C), there is a modest increase in the reversibility of the condensation step for TpCS, but reversibility still falls short of that shown by PCS at 37 degrees C. The root cause of the catalytic inefficiency of TpCS may lie in the lack of protein flexibility imposed by the requirement for thermal stability of the protein itself or its temperature-labile substrate, oxaloacetate.     

Glucosylcaldarchaetidylglycerol, a minor phosphoglycolipid from Thermoplasma acidophilum

A novel phosphoglycolipid (GPL-K) was isolated from Thermoplasma acidophilum (ATCC 27658). The chemical components of GPL-K were analyzed by gas liquid chromatography and GC-MS. The sugar moiety of GPL-K and its anomeric region were analyzed by NMR assignment. The core lipid of GPL-K was caldarchaeol, and its main hydrocarbon chains were acyclic and monocyclic C(40) biphytanyl. The polar head groups were alpha-glucose and glycerophosphate. The negative FAB-MS spectrum of GPL-K confirmed that the lipid peak of m/z 1614 consists of a caldarchaeol (including one cyclopentane ring), a hexose sugar, and a glycerophosphate. We have proposed the tentative structure of GPL-K.     

Preliminary X-ray crystallographic study of malate dehydrogenases from the thermoacidophilic Archaebacteria Thermoplasma acidophilum and Sulfolobus acidocaldarius

Malate dehydrogenases from the thermoacidophilic Archaebacteria Thermoplasma acidophilum and Sulfolobus acidocaldarius have been crystallized and characterized by X-ray diffraction measurements. Crystals of the enzyme from T. acidophilum display space-group symmetry P2(1), a = 63 A, b = 135 A, c = 83 A and beta = 105 degrees; they scattered to approximately 4 A resolution. Two crystal modifications of malate dehydrogenase from S. acidocaldarius were characterized; one displayed trigonal symmetry corresponding to space groups P321, P3(1)21 or P3(2)21 with lattice parameters a = 151 A and c = 248 A and with resolution approximately to 5 A, whereas the other modification displayed space group symmetry I23 or I2(1)3 with lattice parameters a = 129 A and approximately 4.5 A resolution.     

Purification and enzymic characterization of the cytoplasmic pyrophosphatase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

Cytoplasmic pyrophosphatase has been isolated from the thermoacidophilic archaebacterium Thermoplasma acidophilum. The enzyme was purified to electrophoretic homogeneity by combining ion-exchange and affinity-chromatographic separations. This soluble pyrophosphatase probably consists of six identical subunits, since SDS/PAGE gave an estimate of about 22 kDa for a single subunit and size-exclusion chromatography under non-denaturing conditions indicates a molecular mass of 110 +/- 5 kDa. The two most prominent catalytic features of this enzyme are the absolute requirement for divalent cations for catalytic action, Mg2+ conferring the highest activity, and the pronounced specificity for PPi. The catalytic behavior apparently follows simple Michaelis-Menten kinetics with a Km of about 7 microM for PPi and a specific activity of about 1200 U/mg at 56 degrees C. Surprisingly, maximum activity could be observed at 85 degrees C which is more than 20 degrees C above the temperature for optimal growth. Several cytoplasmic extracts of eubacteria and archaebacteria have been probed with a polyclonal antiserum raised against the purified archaebacterial protein. The only noticeable cross-reactivity could be detected with an extract from the methanogen Methanosarcina barkeri although this probably does not reflect the inferred phylogenetic relationship between methanogens and Thermoplasma acidophilum.     

Crystallization and preliminary X-ray diffraction analysis of 5,10- methylenetetrahydrofolate dehydrogenase/cyclohydrolase from Thermoplasma acidophilum DSM 1728

The methylenetetrahydrofolate dehydrogenase/ cyclohydrolase (MTHFDC) from the thermoacidophilic archaeon Thermoplasma acidophilum is a 30.6 kDa molecular-mass enzyme that sequentially catalyzes the conversion of formyltetrahydrofolate to methylenetetrahydrofolate, with a preference for NADP as a cofactor, rather than NAD. In order to elucidate the functional and structural features of MTHFDC from archaeons at a molecular level, it was overexpressed in Escherichia coli and crystallized in the presence of its cofactor, NADP, at 295 K using polyethylene glycol (PEG) 4000 as a precipitant. The crystal is a member of the monoclinic space group P21, with the following unit cell parameters: a=66.333 A, b=52.868 A, c=86.099 A, and beta= 97.570o, and diffracts to a resolution of at least 2.40 A at the synchrotron. Assuming a dimer in the crystallographic asymmetric unit, the calculated Matthews parameter (VM) was 2.44 A3/Da and the solvent content was 49.7%.     

Low-angle X-ray scattering analysis of the Thermoplasma acidophilum nucleoprotein subunit

A DNA-protein complex isolated from Thermoplasma acidophilum has been examined using low-angle X-ray scattering measurements. In agreement with the results of electron-microscopic studies a diamter of 5.5 nm is deduced. Finally, a simplified model of the DNA-protein particles is discussed postulating a kinked DNA.     

Cloning and sequencing of the gene for the cytoplasmic inorganic pyrophosphatase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

The gene (ppa) from the thermoacidophilic archaebacterium Thermoplasma acidophilum, encoding the cytoplasmic pyrophosphatase, has been cloned. Two degenerate oligonucleotide probes, synthesized according to the N-terminal amino acid sequence of the isolated protein, were used to screen subgenomic libraries. The DNA-derived amino acid sequence of the archaebacterial enzyme allows, for the first time, comparative studies of cytoplasmic pyrophosphatases to be extended to all three urkingdoms. The archaebacterial pyrophosphatase more closely resembles the eubacterial enzymes on the basis of sequence similarity and subunit size. The majority of amino acid residues considered to be essential for hydrolysis of pyrophosphate seem to have been conserved throughout evolution, as inferred from the results of an alignment of sequences from all three urkingdoms.     

Thermostability and thermoactivity of citrate synthases from the thermophilic and hyperthermophilic archaea, Thermoplasma acidophilum and Pyrococcus furiosus

Citrate synthases from Thermoplasma acidophilum (optimal growth at 55 degrees C) and Pyrococcus furiosus (100 degrees C) are homo-dimeric enzymes that show a high degree of structural homology with each other, and thermostabilities commensurate with the environmental temperatures in which their host cells are found. A comparison of their atomic structures with citrate synthases from mesophilic and psychrophilic organisms has indicated the potential importance of inter-subunit contacts for thermostability, and here we report the construction and analysis of site-directed mutants of the two citrate synthases to investigate the contribution of these interactions. Three sets of mutants were made: (a) chimeric mutants where the large (inter-subunit contact) and small (catalytic) domains of the T. acidophilum and P. furiosus enzymes were swapped; (b) mutants of the P. furiosus citrate synthase where the inter-subunit ionic network is disrupted; and (c) P. furiosus citrate synthase mutants in which the C-terminal arms that wrap around their partner subunits have been deleted. All three sets of mutant enzymes were expressed as recombinant proteins in Escherichia coli and were found to be catalytically active. Kinetic parameters and the dependence of catalytic activity on temperature were determined, and the stability of each enzyme was analysed by irreversible thermal inactivation experiments. The chimeric mutants indicate that the thermostability of the whole enzyme is largely determined by the origin of the large, inter-subunit domain, whereas the dependence of catalytic activity on temperature is a function of the small domain. Disruption of the inter-subunit ionic network and prevention of the C-terminal interactions both generated enzymes that were substantially less thermostable. Taken together, these data demonstrate the crucial importance of the subunit contacts to the stability of these oligomeric enzymes. Additionally, they also provide a clear distinction between thermostability and thermoactivity, showing that stability is necessary for, but does not guarantee, catalytic activity at elevated temperatures.     

Crystal structure of a nicotinate phosphoribosyltransferase from Thermoplasma acidophilum

We have determined the crystal structure of nicotinate phosphoribosyltransferase from Themoplasma acidophilum (TaNAPRTase). The TaNAPRTase has three domains, an N-terminal domain, a central functional domain, and a unique C-terminal domain. The crystal structure revealed that the functional domain has a type II phosphoribosyltransferase fold that may be a common architecture for both nicotinic acid and quinolinic acid (QA) phosphoribosyltransferases (PRTase) despite low sequence similarity between them. Unlike QAPRTase, TaNAPRTase has a unique extra C-terminal domain containing a zinc knuckle-like motif containing 4 cysteines. The TaNAPRTase forms a trimer of dimers in the crystal. The active site pocket is formed at dimer interfaces. The complex structures with phosphoribosylpyrophosphate (PRPP) and nicotinate mononucleotide (NAMN) showed, surprisingly, that functional residues lining on the active site of TaNAPRTase are quite different from those of QAPRTase, although their substrates are quite similar to each other. The phosphate moiety of PRPP and NAMN is anchored to the phosphate-binding loops formed by backbone amides, as found in many alpha/beta barrel enzymes. The pyrophosphate moiety of PRPP is located at the entrance of the active site pocket, whereas the nicotinate moiety of NAMN is located deep inside. Interestingly, the nicotinate moiety of NAMN is intercalated between highly conserved aromatic residues Tyr(21) and Phe(138). Careful structural analyses combined with other NAPRTase sequence subfamilies reveal that TaNAPRTase represents a unique sequence subfamily of NAPRTase. The structures of TaNAPRTase also provide valuable insight for other sequence subfamilies such as pre-B cell colony-enhancing factor, known to have nicotinamide phosphoribosyltransferase activity.