Mammalian 2',3' cyclic nucleotide phosphodiesterase (CNP) can function as a tRNA splicing enzyme in vivo

Yeast and plant tRNA splicing entails discrete healing and sealing steps catalyzed by a tRNA ligase that converts the 2',3' cyclic phosphate and 5'-OH termini of the broken tRNA exons to 3'-OH/2'-PO4 and 5'-PO4 ends, respectively, then joins the ends to yield a 2'-PO4, 3'-5' phosphodiester splice junction. The junction 2'-PO4 is removed by a tRNA phosphotransferase, Tpt1. Animal cells have two potential tRNA repair pathways: a yeast-like system plus a distinctive mechanism, also present in archaea, in which the 2',3' cyclic phosphate and 5'-OH termini are ligated directly. Here we report that a mammalian 2',3' cyclic nucleotide phosphodiesterase (CNP) can perform the essential 3' end-healing steps of tRNA splicing in yeast and thereby complement growth of strains bearing lethal or temperature-sensitive mutations in the tRNA ligase 3' end-healing domain. Although this is the first evidence of an RNA processing function in vivo for the mammalian CNP protein, it seems unlikely that the yeast-like pathway is responsible for animal tRNA splicing, insofar as neither CNP nor Tpt1 is essential in mice.     

Crystal structure of the 2'-5' RNA ligase from Thermus thermophilus HB8

The 2'-5' RNA ligase family members are bacterial and archaeal RNA ligases that ligate 5' and 3' half-tRNA molecules with 2',3'-cyclic phosphate and 5'-hydroxyl termini, respectively, to the product containing the 2'-5' phosphodiester linkage. Here, the crystal structure of the 2'-5' RNA ligase protein from an extreme thermophile, Thermus thermophilus HB8, was solved at 2.5A resolution. The structure of the 2'-5' RNA ligase superimposes well on that of the Arabidopsis thaliana cyclic phosphodiesterase (CPDase), which hydrolyzes ADP-ribose 1",2"-cyclic phosphate (a product of the tRNA splicing reaction) to the monoester ADP-ribose 1"-phosphate. Although the sequence identity between the two proteins is remarkably low (9.3%), the 2'-5' RNA ligase and CPDase structures have two HX(T/S)X motifs in their corresponding positions. The HX(T/S)X motifs play important roles in the CPDase activity, and are conserved in both the CPDases and 2'-5' RNA ligases. Therefore, the catalytic mechanism of the 2'-5' RNA ligase may be similar to that of the CPDase. On the other hand, the electrostatic potential of the cavity of the 2'-5' RNA ligase is positive, but that of the CPDase is negative. Furthermore, in the CPDase, two loops with low B-factors cover the cavity. In contrast, in the 2'-5' RNA ligase, the corresponding loops form an open conformation and are flexible. These characteristics may be due to the differences in the substrates, tRNA and ADP-ribose 1",2"-cyclic phosphate.     

3'' Terminal labelling of RNA of RNA with beta-32P-pyrophosphate group and its application to the sequence analysis of 5S RNA from Streptomyces griseus.

Nucleotide pyrophosphate transferase isolated from Streptomyces griseus is used to transfer pyrophosphate group from gamma-32P-ATP to the 3'-OH of tRNA, generating a strictly terminal label at its 3' end. Using yeast tRNAPhe as model compound, it is demonstrated that the labelled molecule is suitable for rapid gel sequencing by both enzymatic and chemical methods. RNA molecules terminated by pyrimidine nucleoside are poor pyrophosphate acceptors. To label RNAs of this kind, first guanosine 5'-phosphate 3'-(beta-32P)-pyrophosphate (pGpp) is prepared from gamma-32P-ATP and GMP by nucleotide pyrophosphate transferase. pGpp is then ligated to the 3' end of RNA by T4 RNA ligase. The complete nucleotide sequence of 5S RNA from Streptomyces griseus is established by rapid gel sequencing methods performed on 3'-(beta-32P)-pyrophosphate labelled molecule.     

In vivo repair of the 3''terminus of transfer RNA injected into amphibian oocytes.

Yeast transfer RNA specific for phenylalanine has been treated chemically to remove either one or two nucleotides of its 3' terminus and has been injected into Xenopus laevis oocytes to test whether this RNA can be repaired in vivo. The results obtained showed that oocytes could aminoacylate and thus repair tRNAPhe that has lost both its terminal adenosine and 3' phosphate. A similar result was obtained with tRNAPhe that had undergone two full cycles of 3' terminal nucleotide removal. The oocytes cannot aminoacylate tRNAPhe whose 3' terminal ribose has been oxidized with periodate or the derivative that retains a 3' phosphate after adenosine removal. In vitro assays show that the Xenopus ovary contains a tRNA nucleotidyl transferase with the properties similar to enzymes obtained from other sources which may be responsible for the 3' terminal repair observed in vitro.     

RtcB is the RNA ligase component of an Escherichia coli RNA repair operon

RNA 2',3'-cyclic phosphate ends play important roles in RNA metabolism as substrates for RNA ligases during tRNA restriction-repair and tRNA splicing. Diverse bacteria from multiple phyla encode a two-component RNA repair cassette, comprising Pnkp (polynucleotide kinase-phosphatase-ligase) and Hen1 (RNA 3'-terminal ribose 2'-O-methyltransferase), that heals and then seals broken tRNAs with 2',3'-cyclic phosphate and 5'-OH ends. The Pnkp-Hen1 repair operon is absent in the majority of bacterial species, thereby raising the prospect that other RNA repair systems might be extant. A candidate component is RNA 3'-phosphate cyclase, a widely distributed enzyme that transforms RNA 3'-monophosphate termini into 2',3'-cyclic phosphates but cannot seal the ends it produces. Escherichia coli RNA cyclase (RtcA) is encoded in a σ(54)-regulated operon with RtcB, a protein of unknown function. Taking a cue from Pnkp-Hen1, we purified E. coli RtcB and tested it for RNA ligase activity. We report that RtcB per se seals broken tRNA-like stem-loop structures with 2',3'-cyclic phosphate and 5'-OH ends to form a splice junction with a 2'-OH, 3',5'-phosphodiester. We speculate that: (i) RtcB might afford bacteria a means to recover from stress-induced RNA damage; and (ii) RtcB homologs might catalyze tRNA repair or splicing reactions in archaea and eukarya.     

tRNA ligase catalyzes the GTP-dependent ligation of RNA with 3'-phosphate and 5'-hydroxyl termini

The RNA ligase RtcB is conserved in all domains of life and is essential for tRNA maturation in archaea and metazoa. Here we show that bacterial and archaeal RtcB catalyze the GTP-dependent ligation of RNA with 3'-phosphate and 5'-hydroxyl termini. Reactions with analogues of RNA and GTP suggest a mechanism in which RtcB heals the 3'-phosphate terminus by forming a 2',3'-cyclic phosphate before joining it to the 5'-hydroxyl group of a second RNA strand. Thus, RtcB can ligate RNA cleaved by RNA endonucleases, which generate 2',3'-cyclic phosphate and then 3'-phosphate termini on one strand, and a 5'-hydroxyl terminus on another strand.     

RNA 3'-terminal phosphate cyclase activity and RNA ligation in HeLa cell extract.

HeLa cell extract contains RNA ligase activity that converts linear polyribonucleotides to covalently closed circles. RNA substrates containing 2',3'-cyclic phosphate and 5'-hydroxyl termini are circularized by formation of a normal 3',5' phosphodiester bond. This activity differs from a previously described wheat germ RNA ligase which circularizes molecules with 2',3'-cyclic and 5' phosphate ends by a 2'-phosphomonester, 3',5'-phosphodiester linkage (Konarska et al., Nature 293, 112-116, 1981; Proc. Natl. Acad. Sci. USA 79, 1474-1478, 1982). The HeLa cell ligase can also utilize molecules with 3'-phosphate ends. However, in this case ligation is preceded by an ATP-dependent conversion of the 3'-terminal phosphate to the 2',3' cyclic form by a novel activity, RNA 3'-terminal phosphate cyclase. Both RNA ligase and RNA 3'-terminal phosphate cyclase activities are also present in extract of Xenopus oocyte nuclei, consistent with a role in RNA processing.     

Non-enzymatic excision of pre-tRNA introns?

We used human tRNA(Tyr) precursor as a substrate to study self-excision of a pre-tRNA intron. This RNA was synthesized in vitro in a HeLa cell extract. It contains a 5' leader, an intron of 20 nucleotides and a 3' trailer. Self-cleavage of pre-tRNA(Tyr) occurs in 100 mM NH4OAc at a pH ranging from 6 to 8.5 in the presence of spermine, MgCl2 and Triton X-100 under conditions very similar to enzymatic intron excision. The reaction is temperature-dependent, relatively fast as compared to the enzyme-catalysed reaction and leads to fragments which resist further degradation. The detailed structure of all major and minor cleavage products was established by fingerprint analyses. Non-enzymatic cleavage occurs predominantly at the 3' splice site and to a minor extent at the 5' splice site. Other minor cleavage sites are located within the intron and in the 3' trailer. Putative 5' and 3' tRNA halves resulting from pre-tRNA(Tyr) self-cleavage are substrates for wheat germ RNA ligase, suggesting that the cleavage reaction yields 2',3'-cyclic phosphate and 5'-hydroxyl termini. Pre-tRNA splicing endonuclease is believed to cleave both the 5' and the 3' splice site. However, on the basis of our results we propose that this enzyme may support the formation of a pre-tRNA tertiary structure favourable for autocatalytic intron excision and impair unspecific self-cleavage.     

RNA repair: an antidote to cytotoxic eukaryal RNA damage

RNA healing and sealing enzymes drive informational and stress response pathways entailing repair of programmed 2',3' cyclic PO(4)/5'-OH breaks. Fungal, plant, and phage tRNA ligases use different strategies to discriminate the purposefully broken ends of the anticodon loop. Whereas phage ligase recognizes the tRNA fold, yeast and plant ligases do not and are instead hardwired to seal only the tRNA 3'-OH, 2'-PO(4) ends formed by healing of a cyclic phosphate. tRNA anticodon damage inflicted by secreted ribotoxins such as fungal gamma-toxin underlies a rudimentary innate immune system. Yeast cells are susceptible to gamma-toxin because the sealing domain of yeast tRNA ligase is unable to rectify a break at the modified wobble base of tRNA(Glu(UUC)). Plant andphage tRNA repair enzymes protect yeast from gamma-toxin because they are able to reverse the damage. Our studies underscore how a ribotoxin exploits an Achilles' heel in the target cell's tRNA repair system.     

Reactivity of modified ribose moieties of guanosine: new cleavage reactions mediated by the IVS of Tetrahymena precursor rRNA.

An RNA molecule consisting of the 5' exon and intervening sequence (IVS) of Tetrahymena precursor rRNA was oxidized with sodium periodate to convert the ribose moiety of the 3' terminal guanosine into a dialdehyde form. The modified RNA undergoes a specific cleavage reaction at the 5' splice site, but has no apparent cyclization activity. This novel reaction mediated by the IVS RNA is pH dependent over the range 6.5-8.5 and leaves a 5' phosphate and a 3'-OH at the newly created termini. The dialdehyde form of monomer guanosine is also capable of causing a specific cleavage reaction at the 5' splice site although the nucleotide is not covalently attached to the IVS RNA in the final product. These and other findings described in this report suggest that the cis diol of the intact ribose moiety of guanosine is not an absolute requirement for the IVS-mediated reactions.     

Enzymatic incorporation into oligonucleotides of modified nucleosides

Behaviour of modified nucleosides, tRNA components, and their analogues has been studied in the internucleotide bond formation catalysed by ribonucleases of various substrate specificity, polynucleotide phosphorylases, and T4 RNA ligase and the results are summarised in this paper. Pseudouridine, dihydrouridine, ribothymidine, 5-methylcytidine, inosine, and 6-methyladenosine can participate in the reaction of internucleotide bond formation the presence of most ribonucleases used, viz. Pb2, Pcl2, Pb1, Pch1, C2, T1, pancreatic RNase. 3-Methylcytidine and 4-acetylcytidine form internucleotide bond (as phosphate acceptors) usually by means of guanyl-specific ribonucleases, whereas 1-methylandenosine is incorporated with ribonuclease Pel2. 7-Methylguanosine and 1-methylguynosine 2',3'-cyclophosphates can be used as phosphate donors in the presence of ribonuclease Pb2; in the similar enzymatic reaction 6-isopentenyladenosine is an uneffective acceptor.     

Novel mechanism of RNA repair by RtcB via sequential 2',3'-cyclic phosphodiesterase and 3'-Phosphate/5'-hydroxyl ligation reactions

RtcB enzymes are a newly discovered family of RNA ligases, implicated in tRNA splicing and other RNA repair reactions, that seal broken RNAs with 2',3'-cyclic phosphate and 5'-OH ends. Parsimony and energetics would suggest a one-step mechanism for RtcB sealing via attack by the O5' nucleophile on the cyclic phosphate, with expulsion of the ribose O2' and generation of a 3',5'-phosphodiester at the splice junction. Yet we find that RtcB violates Occam's razor, insofar as (i) it is adept at ligating 3'-monophosphate and 5'-OH ends; (ii) it has an intrinsic 2',3'-cyclic phosphodiesterase activity. The 2',3'-cyclic phosphodiesterase and ligase reactions both require manganese and are abolished by mutation of the RtcB active site. Thus, RtcB executes a unique two-step pathway of strand joining whereby the 2',3'-cyclic phosphodiester end is hydrolyzed to a 3'-monophosphate, which is then linked to the 5'-OH end to form the splice junction. The energy for the 3'-phosphate ligase activity is provided by GTP, which reacts with RtcB in the presence of manganese to form a covalent RtcB-guanylate adduct. This adduct is sensitive to acid and hydroxylamine but resistant to alkali, consistent with a phosphoramidate bond.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Polynucleotide kinase from a T4 mutant which lacks the 3'' phosphatase activity.

Polynucleotide kinase from E. coli infected with the PseT 1 mutant of bacteriophage T4 has been isolated. The PseT 1 enzyme purifies similarly to normal polynucleotide kinase and effectively transfers the gamma phosphate of ATP to the 5' terminal hydroxyl of DNA and RNA. The PseT 1 and normal enzymes require similar magnesium ion concentrations, have the same pH optima and are both inhibited by inorganic phosphate. However, the PseT 1 enzyme is totally lacking the 3' phosphatase activity associated with normal polynucleotide kinase. The PseT 1 enzyme is a useful tool for the preparation of oligonucleotides with 3' and 5' terminal phosphates for use as susbstrates for RNA ligase.     

Conversion of mammalian tRNA 3' processing endoribonuclease to four-base-recognizing RNA cutters.

The spermidine-dependent, sequence-specific endoribonuclease (RNase 65) activities in mammalian cell extracts require both protein and 3' truncated tRNA, species of which direct their substrate sequence specificity. Computer analysis for searching possible base pairing between substrate RNAs and their corresponding 3' truncated tRNA, suggested a unified model for substrate recognition mechanism, in which a four-nucleotide (nt) sequence in the target tRNAs 1 nt upstream of their cleavage site, base pairs with the 5' terminal 4 nt sequence of their corresponding 3' truncated tRNA. This model was supported by experiments with several RNA substrates containing a substituted nucleotide in the target 4 nt sequence. In this model, the tRNA substrates and their corresponding 3' truncated tRNA form a complex resembling a 5' processed tRNA precursor containing a 3' trailer, suggesting that the protein component of RNase 65 is identical to tRNA 3' processing endoribonuclease (3' tRNase). Actually, 3' tRNase purified from pig liver cleaved the target RNAs at the expected sites only in the presence of their corresponding 3' truncated tRNA. These results show that the 3' tRNase can be converted to 4 nt specific RNA cutters using the 3' truncated tRNAs.     

RtcB, a novel RNA ligase, can catalyze tRNA splicing and HAC1 mRNA splicing in vivo

RtcB enzymes are novel RNA ligases that join 2',3'-cyclic phosphate and 5'-OH ends. The phylogenetic distribution of RtcB points to its candidacy as a tRNA splicing/repair enzyme. Here we show that Escherichia coli RtcB is competent and sufficient for tRNA splicing in vivo by virtue of its ability to complement growth of yeast cells that lack the endogenous "healing/sealing-type" tRNA ligase Trl1. RtcB also protects yeast trl1Δ cells against a fungal ribotoxin that incises the anticodon loop of cellular tRNAs. Moreover, RtcB can replace Trl1 as the catalyst of HAC1 mRNA splicing during the unfolded protein response. Thus, RtcB is a bona fide RNA repair enzyme with broad physiological actions. Biochemical analysis of RtcB highlights the uniqueness of its active site and catalytic mechanism. Our findings draw attention to tRNA ligase as a promising drug target.     

Binding interactions between yeast tRNA ligase and a precursor transfer ribonucleic acid containing two photoreactive uridine analogues

Yeast tRNA ligase, from Saccharomyces cerevisiae, is one of the protein components that is involved in the splicing reaction of intron-containing yeast precursor tRNAs. It is an unusual protein because it has three distinct catalytic activities. It functions as a polynucleotide kinase, as a cyclic phosphodiesterase, and as an RNA ligase. We have studied the binding interactions between ligase and precursor tRNAs containing two photoreactive uridine analogues, 4-thiouridine and 5-bromouridine. When irradiated with long ultraviolet light, RNA containing these analogues can form specific covalent bonds with associated proteins. In this paper, we show that 4-thiouridine triphosphate and 5-bromouridine triphosphate were readily incorporated into a precursor tRNA(Phe) that was synthesized, in vitro, with bacteriophage T7 RNA polymerase. The analogue-containing precursor tRNAs were authentic substrates for the two splicing enzymes that were tested (endonuclease and ligase), and they formed specific covalent bonds with ligase when they were irradiated with long-wavelength ultraviolet light. We have determined the position of three major cross-links and one minor cross-link on precursor tRNA(Phe) that were located within the intron and near the 3' splice site. On the basis of these data, we present a model for the in vivo splicing reaction of yeast precursor tRNAs.     

The enzymatic conversion of 3'-phosphate terminated RNA chains to 2',3'-cyclic phosphate derivatives

The enzyme, RNA cyclase, has been purified from cell-free extracts of HeLa cells approximately 6000-fold. The enzyme catalyzes the conversion of 3'-phosphate ends of RNA chains to the 2',3'-cyclic phosphate derivative in the presence of ATP or adenosine 5'-(gamma-thio)triphosphate (ATP gamma S) and Mg2+. The formation of 1 mol of 2',3'-cyclic phosphate ends is associated with the disappearance of 1 mol of 3'-phosphate termini and the hydrolysis of 1 mol of ATP gamma S to AMP and thiopyrophosphate. No other nucleotides could substitute for ATP or ATP gamma S in the reaction. The reaction catalyzed by RNA cyclase was not reversible and exchange reactions between [32P]pyrophosphate and ATP were not detected. However, an enzyme-AMP intermediate could be identified that was hydrolyzed by the addition of inorganic pyrophosphate or 3'-phosphate terminated RNA chains but not by 3'-OH terminated chains or inorganic phosphate. 3'-[32P](Up)10Gp* could be converted to a form that yielded, (Formula: see text) after degradation with nuclease P1, by the addition of wheat germ RNA ligase, 5'-hydroxylpolynucleotide kinase, RNA cyclase, and ATP. This indicates that the RNA cyclase had catalyzed the formation of the 2',3'-cyclic phosphate derivative, the kinase had phosphorylated the 5'-hydroxyl end of the RNA, and the wheat germ RNA ligase had catalyzed the formation of a 3',5'-phosphodiester linkage concomitant with the conversion of the 2',3'-cyclic end to a 2'-phosphate terminated residue.