共查询到20条相似文献,搜索用时 15 毫秒
1.
Molecular phylogeny of Zeacarpa (Ralfsiales,Phaeophyceae) proposing a new family Zeacarpaceae and its transfer to Nemodermatales
下载免费PDF全文
![点击此处可从《Journal of phycology》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Zeacarpa leiomorpha is a crustose brown alga endemic to South Africa. The species has been tentatively placed in Ralfsiaceae, but its ordinal assignment has been uncertain. The molecular phylogeny of brown algae based on concatenated DNA sequences of seven chloroplast and mitochondrial gene sequences (atpB, psaA, psaB, psbA, psbC, rbcL, and cox1) of taxa covering most of the orders revealed the most related phylogenetic relationship of Z. leiomorpha to Nemoderma tingitanum (Nemodermatales) rather than Ralfsiaceae (Ralfsiales). Morphologically, Zeacarpa and Nemoderma share crustose thallus structure and multiple discoidal chloroplasts without pyrenoids in each cell, however, the formation of lateral unilocular zoidangia in tufts in loose upright filaments in Zeacarpa is distinctive in brown algae. Considering the relatively distant genetic divergence between the two taxa, comparable to that among families or orders in representative brown algae, in addition to the above‐mentioned unique morphological features, we propose the classification of Zeacarpa in a new family Zeacarpaceae in the order Nemodermatales. 相似文献
2.
Molecular phylogenetic analysis of the conjugating green algae (Class Zygnemophyceae) using nuclear (SSU rDNA) and chloroplast (rbcL) gene sequences has resolved hypotheses of relationship at the class, order, and family levels, but several key questions will require data from additional genes. Based on SSU and rbcL sequences, the Zygnemophyceae and Desmidiales are monophyletic, and families of placoderm desmids are distinct clades (Desmidiaceae, Peniaceae, Closteriaceae, and Gonatozygaceae). In contrast, the Zygnemataceae and Mesotaeniaceae are paraphyletic, although whether these two traditional families constitute a clade is uncertain. In addition, relationships of genera within families have proven resistant to resolution with these two oft‐used genes. We have sequenced the coxIII gene from the mitochondrial genome to address some of these ambiguous portions of the phylogeny of conjugating green algae. The coxIII gene is more variable than rbcL or SSU rDNA and offers greater resolving power for relationships of genera. We present preliminary analyses of coxIII sequences from each of the traditional families of Zygnemophyceae and contrast the resulting topologies with those derived from nuclear and chloroplast genes. 相似文献
3.
4.
The psaB gene codes for one of two highly conserved P700 chlorophyll a apoproteins of photosystem I. This gene was cloned from the brown alga, Pylaiella littoralis (L.) Kjellm., and its primary sequence was determined. The inferred amino acid sequence of the P. littoralis protein was compared to homologous sequences from land plants, green algae, and a cyanobacterium. The psaB protein sequence is very conserved in all the examined taxa, and an unrooted phylogenetic tree, generated from a distance matrix, shows that the P. littoralis gene is closer to that of the cyanobacterium Synechocossus sp. PCC 7002 than are those of green algae, land plants, and Euglena gracilis. 相似文献
5.
The nucleotide sequence and the 5 flanking region of the rbcL gene coding for the large subunit of ribulose bisphosphate-1,5-carboxylase/oxygenase of Pylaiella littoralis, a brown alga, has been determined and the deduced amino-acid sequence has been compared to those of various photosynthetic and chemoautotrophic Eubacteria, of a red alga and of green plastids (Euglena gracilis, green algae and higher plants). Unlike the rbcL genes of green plastids which are more closely related to those of cyanobacteria the P. littoralis rbcL gene is more closely related to that of a -purple bacterium, as was found for the rbcS gene of another chromophytic alga [Boczar et al., Proc Natl Acad Sci USA 86: 4996–4999, 1989]. Matrix data of homology between the rbcL gene of P. littoralis and the same gene of other organisms are presented. Based on our previous report, the gene coding for the 16S rRNA from P. littoralis is closely related to that of E. gracilis (Markowicz et al., Curr Genet 14: 599–608, 1988). We suggest that the large plastid DNA molecule of P. littoralis is a phylogenetically composite genome which probably resulted from mixed endosymbiosis events, or from a horizontal transfer of DNA. 相似文献
6.
7.
In the unicellular green alga, Chlamydomonas reinhardtii, cytochrome oxidase subunit 2 (cox2) and 3 (cox3) genes are missing from the mitochondrial genome. We isolated and sequenced a BAC clone that carries the whole cox3 gene and its corresponding cDNA. Almost the entire cox2 gene and its cDNA were also determined. Comparison of the genomic and the corresponding cDNA sequences revealed that the
cox3 gene contains as many as nine spliceosomal introns and that cox2 bears six introns. Putative mitochondria targeting signals were predicted at each N terminal of the cox genes. These spliceosomal introns were typical GT–AG-type introns, which are very common not only in Chlamydomonas nuclear genes but also in diverse eukaryotic taxa. We found no particular distinguishing features in the cox introns. Comparative analysis of these genes with the various mitochondrial genes showed that 8 of the 15 introns were interrupting
the conserved mature protein coding segments, while the other 7 introns were located in the N-terminal target peptide regions.
Phylogenetic analysis of the evolutionary position of C. reinhardtii in Chlorophyta was carried out and the existence of the cox2 and cox3 genes in the mitochondrial genome was superimposed in the tree. This analysis clearly shows that these cox genes were relocated during the evolution of Chlorophyceae. It is apparent that long before the estimated period of relocation
of these mitochondrial genes, the cytosol had lost the splicing ability for group II introns. Therefore, at least eight introns
located in the mature protein coding region cannot be the direct descendant of group II introns. Here, we conclude that the
presence of these introns is due to the invasion of spliceosomal introns, which occurred during the evolution of Chlorophyceae.
This finding provides concrete evidence supporting the ``intron-late' model, which rests largely on the mobility of spliceosomal
introns.
Received: 22 August 2000 / Accepted: 28 February 2001 相似文献
8.
Claire M.M. Gachon Martina Strittmatter Yacine Badis Kyle I. Fletcher Pieter Van West Dieter G. Müller 《欧洲藻类学杂志》2017,52(2):133-148
Using laboratory cultures, we have documented the life cycle of Anisolpidium ectocarpii, a pathogen of Ectocarpus and other filamentous brown algae, and presented preliminary observations on Anisolpidium rosenvingei, a pathogen of Pylaiella littoralis. Consistent with earlier reports, the zoospores of both species have a single anterior flagellum, which justified the placement of Anisolpidium amongst the Hyphochytriales (Hyphochytridiomycota). We have also shown that A. ectocarpii can complete its infection cycle in a broad selection of species from various brown algal orders, whereas A. rosenvingei seemingly exhibits a strict specificity for unilocular sporangia of P. littoralis. Unexpectedly, nuclear (18S rRNA) and mitochondrial (cox1, cox2) markers regroup A. ectocarpii and A. rosenvingei, into a hitherto unrecognized monophyletic clade within the oomycetes (Oomycota), most closely related to the Olpidiopsidales. The Anisolpidium genus is therefore entirely distinct from the Hyphochytridiomycota and represents the first confirmed instance of an anteriorly uniciliate oomycete. Finally, we suggest that a valid morphological criterion to separate true hyphochytrids from oomycetes is the timing of zoospore cleavage. Given the evidence, we propose to transfer the Anisolpidiales from the Hyphochytriales to the Oomycetes. 相似文献
9.
Holocarpic oomycetes have been neglected over several decades, until interest in these organisms has recently resurged. One of the most widespread genera of holocarpic oomycetes is Pontisma, parasitic to red seaweeds throughout all oceans. Recently, the genus Sirolpidium (parasitic to green algae) was found to be congeneric with Pontisma. This hinted at a high pathogenic versatility and prompted the screening of other macroalgae on the coastline of Iceland. During this survey a parasite of the brown algae Pylaiella littoralis was found, which formed anisolpidium-like thalli, but produced biflagellate zoospores. Phylogenetic investigations revealed that the parasite was placed in the genus Pontisma. In reconstructions based on partial nrSSU sequences, it grouped with some sequences of parasitoids of the diatom genus Licmophora, but the more variable mitochondrial cox2 sequences were divergent. Based on phylogenetic evidence and the unique parasitism of brown algae, the parasitoid is described as Pontisma blauvikense in this study. Pontisma blauvikense is the fourth oomycete species parasitic to Pylaiella, which is also parasitised by Euychasma dicksonii and two Anisolpidium species. For a better understanding of the ecology and evolution of holocarpic oomycetes, further research is necessary to investigate the host spectrum of Pontisma in general and Pontisma blauvikense in particular. 相似文献
10.
11.
ANNETTE W. COLEMAN WILLIAM F. THOMPSON LYNDA J. COFF 《The Journal of eukaryotic microbiology》1991,38(2):129-135
ABSTRACT. Analysis of total DNA isolated from the Chrysophyte alga Ochromonas danica revealed, in addition to nuclear DNA, two genomes present as numerous copies per cell. The larger genome (?120 kilobase pairs or kbp) is the plastid DNA, which is identified by its hybridization to plasmids containing sequences for the photosynthesis genes rbcL, psbA, and psbC. The smaller genome (40 kbp) is the mitochondrial genome as identified by its hybridization with plasmids containing gene sequences of plant cytochrome oxidase subunits I and II. Both the 120- and 40-kbp genomes contain genes for the small and large subunits of rDNA. The mitochondrial genome is linear with terminal inverted repeats of about 1.6 kbp. Two other morphologically similar species were examined, Ochromonas minuta and Poteriochromonas malhamensis. All three species have linear mitochondrial DNA of 40 kbp. Comparisons of endonuclease restriction-fragment patterns of the mitochondrial and chloroplast DNAs as well as those of their nuclear rDNA repeats failed to reveal any fragment shared by any two of the species. Likewise, no common fragment size was detected by hybridization with plasmids containing heterologous DNA or with total mitochondrial DNA of O. danica; these observations support the taxonomic assignment of these three organisms to different species. The Ochromonas mitochondrial genomes are the first identified in the chlorophyll a/c group of algae. Combining these results with electron microscopic observations of putative mitochondrial genomes reported for other chromophytes and published molecular studies of other algal groups suggests that all classes of eukaryote algae may have mitochondrial genomes < 100 kbp in size, more like other protistans than land plants. 相似文献
12.
The DNA segment situated between the 16S and 23S rRNA genes belonging to the plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm. has been sequenced. This small region (322 bp) contains two unsplit tRNA genes separated by 3 bp. A comparison with similar regions from different plants shows that this region has evolved in two different ways according to the place of plants in evolution. In the primitive group, this region is reduced in size when compared to prokaryotes. In the other groups, it is considerably enlarged by insertion of repetitive sequences, open reading frames and introns. 相似文献
13.
Eileen M. Denovan-Wright David Sankoff David F. Spencer Robert W. Lee 《Journal of molecular evolution》1996,42(4):382-391
The fragmented mitochondrial ribosomal RNAs (rRNAs) of the green algaeChlamydomonas eugametos andChlamydomonas reinhardtii are discontinuously encoded in subgenic modules that are scrambled in order and interspersed with protein coding and tRNA
genes. The mitochondrial rRNA genes of these two algae differ, however, in both the distribution and organization of rRNA
coding information within their respective genomes. The objectives of this study were (1) to examine the phylogenetic relationships
between the mitochondrial rRNA gene sequences ofC. eugametos andC. reinhardtii and those of the conventional mitochondrial rRNA genes of the green alga,Prototheca wickerhamii, and land plants and (2) to attempt to deduce the evolutionary pathways that gave rise to the unusual mitochondrial rRNA
gene structures in the genusChlamydomonas. Although phylogenetic analysis revealed an affiliation between the mitochondrial rRNA gene sequences of the twoChlamydomonas taxa to the exclusion of all other mitochondrial rRNA gene sequences tested, no specific affiliation was noted between theChlamydomonas sequences andP. wickerhamii or land plants. Calculations of the minimal number of transpositions required to convert hypothetical ancestral rRNA gene
organizations to the arrangements observed forC. eugametos andC. reinhardtii mitochondrial rRNA genes, as well as a limited survey of the size of mitochondrial rRNAs in other members of the genus, lead
us to propose that the last common ancestor ofChlamydomonas algae contained fragmented mitochondrial rRNA genes that were nearly co-linear with conventional rRNA genes. 相似文献
14.
Sze-Wan Poong Phaik-Eem Lim Siew-Moi Phang H. Sunarpi John A. West Hiroshi Kawai 《Journal of applied phycology》2014,26(2):1231-1242
Studies on the crustose brown algae are relatively few despite a long history of studies conducted since the 1800s, with temperate species forming the bulk of these studies. There is a need for more focus on crustose brown algae particularly in the tropics as they are generally different from those in the temperate regions. Taxonomic confusion arising from morphological simplicity largely dependent on the reproductive structures and overlap in morpho-anatomical features among species necessitates the use of molecular techniques. This study is dedicated to a better understanding of the diversity of these understudied algae in the Indo–Malay region. Specimens collected from Peninsular Malaysia, Sabah (Borneo) and Lombok Island in Indonesia were identified using molecular markers from the plastid rubisco large subunit (rbcL) and mitochondrial cytochrome c oxidase subunit 1 (cox1) genes in tandem with morphology and anatomy. Three Mesospora spp., two putative Diplura spp. and the cosmopolitan Neoralfsia expansa were identified in this study, including a new record of Mesospora negrosensis for Malaysia. Despite their morpho-anatomical similarities, Mesospora and Diplura occur in widely divergent clades within the brown algae, the former in the Mesosporaceae in the Ralfsiales, the latter in an unclassified clade sister to the Ishigeales. All six species occurred both in Malaysia and Lombok Island except for M. elongata and M. negrosensis, respectively. The rbcL marker performed better in the elucidation of phylogeny among the brown algal orders, whereas cox1-5′ is more suited as a barcoding marker for species level identification. 相似文献
15.
The gene for the small subunit of ribulose-1,5-bisphosphate carboxylase (Rubisco) is located in the large single-copy region of the plastid genome of the chlorophyll c-containing alga Cryptomonas . The coding sequence is 417 base pairs long, encoding a protein of 139 amino acids, considerably longer than most other small subunit proteins. It is found 83 base pairs downstream from the gene for the large subunit and is cotranscribed with it. An 18 base pair perfect inverted repeat is located 8 base pairs beyond the termination codon. Sequence analysis shows the gene to be more closely related to cyanobacterial and cyanelle small-subunit genes than to those of green algae or land plants. This is the first reported sequence of a Rubisco small-subunit gene which is plastid-encoded and it exhibits a number of unique features. The derived amino acid sequence shows extensive similarity to a partial amino acid sequence from a brown alga, indicating that this gene will be of major interest as a probe for the small subunit genes in other algae and for determining possible evolutionary ancestors of algal plastids. 相似文献
16.
S. Yu. Sorokina B. V. Andrianov V. G. Mitrofanov 《Moscow University Biological Sciences Bulletin》2010,65(4):224-226
An analysis of the complete sequence of the mitochondrial genome (mt-genome) of D. littoralis is presented. Its basic characteristics, such as size, nucleotide composition, gene order, and the degree of purifying selection
pressure on different parts of the genome are given. The details of the structure of proteinencoding genes and tRNA genes
are discussed. The structure of nonencoding regions (control region and intergenic spacers) of mtDNA of the virilis group is given. Fragments of the mt-genes atp6 and cox3 were found in the nuclear genome of D. virilis. The evolutionary history of the mitochondrial and nuclear sequences of these genes indicates that the process of formation
of mt-pseudogenes is currently taking place and is associated with the activity of retrotransposons. 相似文献
17.
Su Yeon Kim Antonio Manghisi Marina Morabito Eun Chan Yang Hwan Su Yoon Kathy Ann Miller Sung Min Boo 《Journal of phycology》2014,50(5):885-896
The red alga Pachymeniopsis lanceolata, formerly known as Grateloupia lanceolata, is a component of the native algal flora of northeast Asia and has been introduced to European and North American waters. It has been confused with a cryptic species collected from Korea and Italy. Our analyses of rbcL, cox3 and ITS from P. lanceolata and this cryptic species has revealed two distinct entities, forming a clade, which were clearly separated from its congeners and positioned with other Asian species. Here, we describe the cryptic species as P. gargiuli sp. nov., a species that differs from others by molecular sequence and subtle anatomical characters. We hypothesize that P. gargiuli may have been recently dispersed by anthropogenic vectors, possibly at or near the same time as was P. lanceolata. Our cox3 data set revealed that one haplotype of P. gargiuli, shared between Korea and Italy, and two haplotypes of P. lanceolata, commonly occurring in Korea and USA, are invasive haplotypes. This is the first report of the utility of the mitochondrial coding cox3 sequences in red algae. 相似文献
18.
Stephen J. Traphagen Michael J. Dimarco Margaret E. Silliker 《RNA (New York, N.Y.)》2010,16(4):828-838
Regions of the Didymium iridis mitochondrial genome were identified with similarity to typical mitochondrial genes; however, these regions contained numerous stop codons. We used RT-PCR and DNA sequencing to determine whether, through RNA editing, these regions were transcribed into mRNAs that could encode functional proteins. Ten putative gene regions were examined: atp1, atp6, atp8, atp9, cox1, cox2, cytb, nad4L, nad6, and nad7. The cDNA sequences of each gene could encode a functional mitochondrial protein that was highly conserved compared with homologous genes. The type of editing events and editing sequence features were very similar to those observed in the homologous genes of Physarum polycephalum, though the actual editing locations showed a variable degree of conservation. Edited sites were compared with encoded sites in D. iridis and P. polycephalum for all 10 genes. Edited sequence for a portion of the cox1 gene was available for six myxomycetes, which, when compared, showed a high degree of conservation at the protein level. Different types of editing events showed varying degrees of site conservation with C-to-U base changes being the least conserved. Several aspects of single C insertion editing events led to the preferential creation of hydrophobic amino acid codons that may help to minimize adverse effects on the resulting protein structure. 相似文献
19.
Land plants possess some of the most unusual mitochondrial genomes among eukaryotes. However, in early land plants these genomes
resemble those of green and red algae or early eukaryotes. The question of when during land plant evolution the dramatic change
in mtDNAs occurred remains unanswered. Here we report the first completely sequenced mitochondrial genome of the hornwort,
Megaceros aenigmaticus, a member of the sister group of vascular plants. It is a circular molecule of 184,908 base pairs, with 32 protein genes,
3 rRNA genes, 17 tRNA genes, and 30 group II introns. The genome contains many genes arranged in the same order as in those
of a liverwort, a moss, several green and red algae, and Reclinomonas americana, an early-branching eukaryote with the most ancestral form of mtDNA. In particular, the gene order between mtDNAs of the
hornwort and Physcomitrella patens (moss) differs by only 8 inversions and translocations. However, the hornwort mtDNA possesses 4 derived features relative
to green alga mtDNAs—increased genome size, RNA editing, intron gains, and gene losses—which were all likely acquired during
the origin and early evolution of land plants. Overall, this genome and those of other 2 bryophytes show that mitochondrial
genomes in early land plants, unlike their seed plant counterparts, exhibit a mixed mode of conservative yet dynamic evolution.
Electronic supplementary material The online version of this article (doi:) contains supplementary material, which is available to authorized users.
Libo Li and Bin Wang contributed equally to this work. 相似文献
20.
Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër 相似文献