Importance of introns in the growth regulation of mRNA levels of the proliferating cell nuclear antigen gene.

The steady-state mRNA levels of the proliferating cell nuclear antigen (PCNA) gene are growth regulated. We have begun to identify the elements in the human PCNA gene that participate in its growth regulation by transfecting appropriate constructs in BALB/c3T3 cells. The results can be summarized as follows. (i) The 400 base pairs of the 5'-flanking sequence of the human PCNA gene upstream of the preferred cap site are sufficient for directing expression of a heterologous cDNA (S. Travali, D.-H. Ku, M. G. Rizzo, L. Ottavio, R. Baserga, and B. Calabretta, J. Biol. Chem. 264:7466-7472, 1989). (ii) Intron 4 is necessary for the proper regulation of PCNA mRNA levels in G0 cells. Removal of intron 4 leads to abnormally high levels of PCNA mRNA in serum-deprived cells, although the shortened PCNA gene with its own promoter is still responsive to serum stimulation. (iii) The presence of introns also increases the steady-state levels of PCNA mRNA in proliferating cells. These results are especially interesting for two reasons: (i) because of the extensive sequence similarities among introns and between introns and exons of the human PCNA gene, and (ii) because, usually, the presence of introns leads to increased expression, whereas in this case, removal of intron 4 caused an increase in mRNA levels, and this occurred only in quiescent cells.     

Characterization of the human porin isoform 1 (HVDAC1) gene by amplification on the whole human genome: A tool for porin deficiency analysis

The deficiency of porin isoform 1 (HVDAC1) in human skeletal muscle has been associated with a pathological phenotype related to defects in the bioenergetic metabolism. In the best studied case, porin deficiency was not apparent in cultured fibroblasts: this observation raised the conclusion that no molecular defect was in the cDNA sequence coding for the protein. To get more insight in the pathogenetic mechanism that is involved in porin isoform 1 deficiency, we have determined the whole structure of the corresponding human gene. On the basis of the corresponding mouse gene structure and the human cDNA sequence, we designed long extension PCR amplifications using the whole genomic DNA as a template. Exonic/intronic regions were isolated and the exons and surrounding introns sequenced. The 5' and 3' extremities of the gene were determined by genome walking. The porin isoform 1 human gene is made up of 9 exons and spans about 33 kbp. A whole panel of PCR parameters was set and is now ready to be used for specific amplification upon patients' genomic DNA. The analysis of the putative promoter sequence was performed. It revealed the presence of a sterol Repressor element (SRE), an SRY, the testis-determining factor, and a nuclear respiratory factor 2 (NRF-2) binding site. These sites, according to results from literature, could be involved in the functional modulation of the gene expression.     

Structure of the human cytochrome c oxidase subunit Vb gene and chromosomal mapping of the coding gene and of seven pseudogenes.

Subunit Vb of mammalian cytochrome c oxidase (COX; EC 1.9.3.1) is encoded by a nuclear gene and assembled with the other 12 COX subunits encoded in both mitochondrial and nuclear DNA. We have cloned the gene for human COX subunit Vb (COX5B) and determined the exon-intron structure by both hybridization analysis and DNA sequencing. The gene contains five exons and four introns; the four coding exons span a region of approximately 2.4 kb. The 5' end of the COX5B gene is GC-rich and contains many HpaII sites. Genomic Southern blot analysis of human DNA probed with the human COX Vb cDNA identified eight restriction fragments containing COX Vb-related sequences that were mapped to different chromosomes with panels of human x Chinese hamster somatic cell hybrids. Because only one of these fragments hybridized with a 210-bp probe from intron 4, we conclude that there is a single expressed gene for COX subunit Vb in the human genome. We have mapped this gene to chromosome 2, region cen-q13.     

Nucleotide sequence of the gene for human prothrombin

A human genomic DNA library was screened for the gene coding for human prothrombin with a cDNA coding for the human protein. Eighty-one positive lambda phage were identified, and three were chosen for further characterization. These three phage hybridized with 5' and/or 3' probes prepared from the prothrombin cDNA. The complete DNA sequence of 21 kilobases of the human prothrombin gene was determined and included a 4.9-kilobase region that was previously sequenced. The gene for human prothrombin contains 14 exons separated by 13 intervening sequences. The exons range in size from 25 to 315 base pairs, while the introns range from 84 to 9447 base pairs. Ninety percent of the gene is composed of intervening sequence. All the intron splice junctions are consistent with sequences found in other eukaryotic genes, except for the presence of GC rather than GT on the 5' end of intervening sequence L. Thirty copies of Alu repetitive DNA and two copies of partial KpnI repeats were identified in clusters within several of the intervening sequences, and these repeats represent 40% of the DNA sequence of the gene. The size, distribution, and sequence homology of the introns within the gene were then compared to those of the genes for the other vitamin K dependent proteins and several other serine proteases.     

Characterization of the human cyclophilin gene and of related processed pseudogenes

The human cyclophilin gene was isolated from a genomic library derived from leucocyte DNA and sequenced. The gene contains five exons and four introns. The amino acid sequence deduced from the exons matches perfectly the one previously determined from the T-cell cyclophilin cDNA. A TATA box is visible in the promoter region and putative Sp1 binding sites are also found there as well as in the first intron. Six members of the middle repetitive Alu gene family are present in one or other orientation in the non-coding regions of the cyclophilin gene. Hybridisation of genomic DNA to probes derived from the promoter region or the first intron indicates that the cyclophilin gene is present as a single copy in the human haploid genome. Seven other cyclophilin-related DNA clones isolated from the same library were also characterized. They show a high degree of similarity to the cyclophilin cDNA and are colinear to it. However, multiple genetic lesions, often including deletion and/or insertion events which modify the reading frame, are found in these clones which are therefore likely to represent processed pseudogenes.     

Partial structure of the gene for chicken cartilage proteoglycan core protein

A genomic DNA fragment (gCORE-1), encoding a portion of the cartilage proteoglycan core protein, has been isolated from a phage library using cDNA as a probe. The genomic insert is about 17 kilobase pairs; two BamHI fragments of the insert (1.3 and 4.8 kilobase pairs) contain most of the hybridizable sequences found in the cDNA. Sequence analysis of these fragments shows that they contain a total of five exons that encompass 216 amino acid residues, all of which are identical to those of the corresponding cDNA sequence. Three of the exons, which are adjacent to one another, are very similar to the corresponding exons in the gene of a rat hepatic lectin as well as to an exon in the gene of human pulmonary surfactant-associated protein. There is a strong degree of conservation of amino acid sequences encoded in the three genes, although there is no similarity between their introns. The sizes of the five exons in gCORE-1, except for one (which is indeterminate because only a partial cDNA sequence is available), are less than 184 base pairs, whereas the sizes of the introns range from 218 to greater than 2629 base pairs. Four of the introns interrupt an exon codon at either their donor or acceptor sites, between the first and second nucleotides. Only one intron does not split a codon. Intron and exon boundary sites are in agreement with known consensus sequences for introns. The dispersed distribution and relatively small size of the exons, if representative of the entire gene, suggest that the complete gene which codes for the core protein may be quite sizable.     

Exons of the human pancreatic polypeptide gene define functional domains of the precursor

Pancreatic polypeptide is a 36-amino acid peptide which inhibits pancreatic exocrine function. We have previously determined from the nucleotide sequence of a cDNA that pancreatic polypeptide is derived from a 95-amino acid precursor, prepropancreatic polypeptide. Pulse-chase studies have suggested that the precursor is cleaved to produce three peptides: pancreatic polypeptide, an icosapeptide, and a smaller peptide. In the present study, we have used the cloned cDNA as a hybridization probe to isolate the pancreatic polypeptide gene from a human bacteriophage genomic library. The nucleotide sequence of 2.8 kilobases of DNA representing the entire human pancreatic polypeptide gene was determined. The gene contains four exons and three introns. Exon 1 encodes the 5'-untranslated region of the mRNA, exon 2 encodes the signal sequence and the sequence of pancreatic polypeptide, exon 3 encodes the icosapeptide, and exon 4 encodes a carboxyl-terminal heptapeptide and the 3'-untranslated region of the mRNA. By Southern blot analysis, the gene detected in a pancreatic polypeptide-producing islet cell tumor was indistinguishable from that in normal human leukocytes. The structure of the human pancreatic polypeptide gene is consistent with the hypothesis that prepropancreatic polypeptide generates three distinct peptides, each encoded by a separate exon. Increased expression of pancreatic polypeptide in the islet cell tumor does not appear to be correlated with major alterations in pancreatic polypeptide gene structure.     

Molecular cloning of cDNA coding for rat proliferating cell nuclear antigen (PCNA)/cyclin.

The 'proliferating cell nuclear antigen' (PCNA), also known as cyclin, appears at the G1/S boundary in the cell cycle. Because of its possible relationship with cell proliferation, PCNA/cyclin has been receiving attention. PCNA/cyclin is a non-histone acidic nuclear protein with an apparent mol. wt of 33000-36000. The amino acid composition and the sequence of the first 25 amino acids of rabbit PCNA/cyclin are known. Using an oligonucleotide probe corresponding to the sequence of the first five amino acids, a cDNA clone for PCNA/cyclin was isolated from rat thymocyte cDNA library. The cDNA (1195 bases) contains an open reading frame of 813 nucleotides coding for 261 amino acids. The 3'-non-coding region is 312 nucleotides long and contains three putative polyadenylation signals. The mol. wt of rat PCNA/cyclin was calculated to be 28 748. The deduced amino acid sequence and composition of rat PCNA/cyclin are in excellent agreement with the published data. Using the cDNA probe, two species of mRNA (1.1 and 0.98 kb) were detected in rat thymocyte RNA. Southern blot analysis of total human genomic DNA suggests that there is a single gene coding for PCNA/cyclin. The deduced amino acid sequence of rat PCNA/cyclin has a similarity with that of herpes simplex virus type-1 DNA binding protein.     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Mitochondrial sequence migrated downstream to a nuclear V-ATPase B gene is transcribed but non-functional.

A promiscuous nuclear sequence containing a mitochondrial DNA fragment was isolated from rice. Nucleotide sequence analysis reveals that the cDNA clone #21 carries a mitochondrial sequence homologous to the 3' portion of the rps19 gene followed by the 5' portion of the rps3 gene. The mitochondrial sequence is present in an antisense orientation. Sequence comparison of the #21 cDNA with the original mitochondrial sequence shows 99% similarity, suggesting a recent transfer event. Moreover, evidence for a lack of an RNA editing event and retaining of the group II intron sequence strongly suggests that the sequence was transferred from mitochondrion to the nucleus via DNA rather than RNA as an intermediate. The upstream region to the mitochondria-derived sequence shows homology to part of the vacuolar H(+)-ATPase B subunit (V-ATPase B) gene. Isolation of a functional V-ATPase B cDNA and its comparison with the #21 cDNA reveal a number of nucleotide substitutions resulting in many translational stop codons in the #21 cDNA. This indicates that the #21 cDNA sequence is not functional. Analysis of genomic sequences shows the presence of five intron sequences in the #21 cDNA, whereas the functional V-ATPase B gene has 14 introns. Of these, three exons and their internal two introns are homologous to each other, suggesting a duplication event of V-ATPase B genomic DNA. The results of this investigation strongly suggest that the mitochondrial sequence was integrated in an antisense orientation into the pre-existing V-ATPase B pseudogene that can be transcribed and spliced. This represents a case of unsuccessful gene transfer from mitochondrion to the nucleus.     

Nucleotide sequence and organization of the human S-protein gene: repeating peptide motifs in the "pexin" family and a model for their evolution

The S-protein/vitronectin gene was isolated from a human genomic DNA library, and its sequence of about 5.3 kilobases including the adjacent 5' and 3' flanking regions was established. Alignment of the genomic DNA nucleotide sequence and the cDNA sequence indicated that the gene consisted of eight exons and seven introns. The intron positions in the S-protein gene and their phase type were compared to those in the hemopexin gene which shares amino acid sequence homologies with transin and the S-protein. Three introns have been found at equivalent positions; two other introns are very close to these positions and are interpreted as cases of intron sliding. Introns 3-7 occur at a conserved glycine residue within repeating peptide segments, whereas introns 1 and 2 are at the boundaries of the Somatomedin B domain of S-protein. The analysis of the exon structure in relation to repeating peptide motifs within the S-protein strongly suggests that it contains only seven repeats, one less than the hemopexin molecule. A very similar repeat pattern like that in hemopexin is shown to be present also in two other related proteins, transin and interstitial collagenase. An evolutionary model for the generation of the repeat pattern in the S-protein and the other members of this novel "pexin" gene family is proposed, and the sequence modifications for some of the repeats during divergent evolution are discussed in relation to known unique functional properties of hemopexin and S-protein.     

Gene expression of rat glutathione S-transferases. Evidence for gene conversion in the evolution of the Yb multigene family

We have characterized a cDNA with complete coding sequence for the rat liver glutathione S-transferase subunit 4 (Yb2) isolated from a constructed lambda gt10 cDNA library. Functional expression of the cDNA sequence has resulted in the purification to homogeneity of an enzymatically active anionic glutathione S-transferase. In addition to three previously described Yb-type subunits (Yb1, Yb2, Yb3), we now report characterization of a fourth Yb subunit sequence in the form of a genomic DNA clone lambda GTR15-2. The Yb4 gene has no apparent defect, and the deduced Yb4 polypeptide sequence differs from the other three Ybs by 40 to 53 amino acids. The Yb4 gene organization is similar to that of the Yb2 gene in having a minimum of eight exons. Three out of the seven introns between the two genes are conserved to the extent of more than 88% nucleotide identity. We propose that gene conversion may have played a role in the evolution of these Yb genes.