Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.     

The structural basis for molecular recognition by the vitamin B 12 RNA aptamer

Previous solution structures of ligand-binding RNA aptamers have shown that molecular recognition is achieved by the folding of an initially unstructured RNA around its cognate ligand, coupling the processes of RNA folding and binding. The 3 A crystal structure of the cyanocobalamin (vitamin B12) aptamer reported here suggests a different approach to molecular recognition in which elements of RNA secondary structure combine to create a solvent-accessible docking surface for a large, complex ligand. Central to this structure is a locally folding RNA triplex, stabilized by a novel three-stranded zipper. Perpendicular stacking of a duplex on this triplex creates a cleft that functions as the vitamin B12 binding site. Complementary packing of hydrophobic surfaces, direct hydrogen bonding and dipolar interactions between the ligand and the RNA appear to contribute to binding. The nature of the interactions that stabilize complex formation and the possible uncoupling of folding and binding for this RNA suggest a strong mechanistic similarity to typical protein-ligand complexes.     

A procedure for RNA pseudoknot prediction

The RNA pseudoknot has been proposed as a significant structuralmotif in a wide range of biological processes of RNAs. A pseudoknotinvolves intramolecular pairing of bases in a hairpin loop withbases outside the stem of the loop to form a second stem andloop region. In this study, we propose a method for searchingand predicting pseudoknots that are likely to have functionalmeaning. In our procedure, the orthodox hairpin structure involvedin the pseudoknot is required to be both statistically significantand relatively stable to the others in the sequence. The basesoutside the stem of the hairpin loop in the predicted pseudoknotare not entangled with any formation of a highly stable secondarystructure in the sequence. Also, the predicted pseudoknot issignificantly more stable than those that can be formed froma large set of scrambled sequences under the assumption thatthe energy contribution from a pseudoknot is proportional tothe size of second loop region and planar energy contributionfrom second stem region. A number of functional pseudoknotsthat have been reported before can be identified and predictedfrom their sequences by our method.     

Crystal structure of a luteoviral RNA pseudoknot and model for a minimal ribosomal frameshifting motif

To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter. Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.     

Mutational analysis of the pseudoknot in the tRNA-like structure of turnip yellow mosaic virus RNA. Aminoacylation efficiency and RNA pseudoknot stability.

Site-directed mutations were introduced in the connecting loops and one of the two stem regions of the RNA pseudoknot in the tRNA-like structure of turnip yellow mosaic virus RNA. The kinetic parameters of valylation for each mutated RNA were determined in a cell-free extract from wheat germ. Structure mapping was performed on most mutants with enzymic probes, like RNase T1, nuclease S1 and cobra venom ribonuclease. An insertion of four A residues in the four-membered connecting loop L1 that crosses the deep groove of the pseudoknot reduces aminoacylation efficiency. Deletions up to three nucleotides do not affect aminoacylation or RNA pseudoknot formation. Deletion of the entire loop abolishes aminoacylation. Although elimination of the pseudoknot is presumed, this could not be demonstrated. Unlike the mutations in loop L1, all mutations in the three-membered connecting loop L2 that crosses the shallow groove of the RNA pseudoknot decrease the aminoacylation efficiency considerably. Nonetheless, the RNA pseudoknot is still present in most mutated RNAs. These results indicate that a number of mutations can be introduced in both loops without abolishing aminoacylation. Results obtained with the introduction of mismatches and A.U base-pairs in stem S1 of the pseudoknot, containing three G.C base-pairs in wild-type RNA, indicate that the pseudoknot is only marginally stable. Our estimation of the gain of free energy due to the pseudoknot formation is at most 2.0 kcal/mol. The pseudoknot structure can, however, be stabilized upon binding the valyl-tRNA synthetase.     

The 1.3 A crystal structure of the flavoprotein YqjM reveals a novel class of Old Yellow Enzymes

Here we report the crystal structure of YqjM, a homolog of Old Yellow Enzyme (OYE) that is involved in the oxidative stress response of Bacillus subtilis. In addition to the oxidized and reduced enzyme form, the structures of complexes with p-hydroxybenzaldehyde and p-nitrophenol, respectively, were solved. As for other OYE family members, YqjM folds into a (alpha/beta)8-barrel and has one molecule of flavin mononucleotide bound non-covalently at the COOH termini of the beta-sheet. Most of the interactions that control the electronic properties of the flavin mononucleotide cofactor are conserved within the OYE family. However, in contrast to all members of the OYE family characterized to date, YqjM exhibits several unique structural features. For example, the enzyme exists as a homotetramer that is assembled as a dimer of catalytically dependent dimers. Moreover, the protein displays a shared active site architecture where an arginine finger (Arg336) at the COOH terminus of one monomer extends into the active site of the adjacent monomer and is directly involved in substrate recognition. Another remarkable difference in the binding of the ligand in YqjM is represented by the contribution of the NH2-terminal Tyr28 instead of a COOH-terminal tyrosine in OYE and its homologs. The structural information led to a specific data base search from which a new class of OYE oxidoreductases was identified that exhibits a strict conservation of active site residues, which are critical for this subfamily, most notably Cys26, Tyr28, Lys109, and Arg336. Therefore, YqjM is the first representative of a new bacterial subfamily of OYE homologs.     

Energetics of a strongly pH dependent RNA tertiary structure in a frameshifting pseudoknot

Retroviruses employ -1 translational frameshifting to regulate the relative concentrations of structural and non-structural proteins critical to the viral life cycle. The 1.6 A crystal structure of the -1 frameshifting pseudoknot from beet western yellows virus reveals, in addition to Watson-Crick base-pairing, many loop-stem RNA tertiary structural interactions and a bound Na(+). Investigation of the thermodynamics of unfolding of the beet western yellows virus pseudoknot reveals strongly pH-dependent loop-stem tertiary structural interactions which stabilize the molecule, contributing a net of DeltaH approximately -30 kcal mol(-1) and DeltaG degrees (37) of -3.3 kcal mol(-1) to a total DeltaH and DeltaG degrees (37) of -121 and -16 kcal mol(-1), respectively, at pH 6.0, 0.5 M K(+) by DSC. Characterization of mutant RNAs supports the presence of a C8(+).G12-C26 loop 1-stem 2 base-triple (pK(a)=6.8), protonation of which contributes nearly -3.5 kcal mol(-1) in net stability in the presence of a wild-type loop 2. Substitution of the nucleotides in loop 2 with uridine bases, which would eliminate the minor groove triplex, destroys pseudoknot formation. An examination of the dependence of the monovalent ion and type on melting profiles suggests that tertiary structure unfolding occurs in a manner quantitatively consistent with previous studies on the stabilizing effects of K(+), NH(4)(+) and Na(+) on other simple duplex and pseudoknotted RNAs.     

The crystal structure of the globular head of complement protein C1q provides a basis for its versatile recognition properties

C1q is a versatile recognition protein that binds to an amazing variety of immune and non-immune ligands and triggers activation of the classical pathway of complement. The crystal structure of the C1q globular domain responsible for its recognition properties has now been solved and refined to 1.9 A of resolution. The structure reveals a compact, almost spherical heterotrimeric assembly held together mainly by non-polar interactions, with a Ca2+ ion bound at the top. The heterotrimeric assembly of the C1q globular domain appears to be a key factor of the versatile recognition properties of this protein. Plausible three-dimensional models of the C1q globular domain in complex with two of its physiological ligands, C-reactive protein and IgG, are proposed, highlighting two of the possible recognition modes of C1q. The C1q/human IgG1 model suggests a critical role for the hinge region of IgG and for the relative orientation of its Fab domain in C1q binding.     

Analysis of an RNA pseudoknot structure by CD spectroscopy.

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.     

The crystal structure of Thermotoga maritima maltosyltransferase and its implications for the molecular basis of the novel transfer specificity.

Maltosyltransferase (MTase) from the hyperthermophile Thermotoga maritima represents a novel maltodextrin glycosyltransferase acting on starch and malto-oligosaccharides. It catalyzes the transfer of maltosyl units from alpha-1,4-linked glucans or malto-oligosaccharides to other alpha-1,4-linked glucans, malto-oligosaccharides or glucose. It belongs to the glycoside hydrolase family 13, which represents a large group of (beta/alpha)(8) barrel proteins sharing a similar active site structure. The crystal structures of MTase and its complex with maltose have been determined at 2.4 A and 2.1 A resolution, respectively. MTase is a homodimer, each subunit of which consists of four domains, two of which are structurally homologous to those of other family 13 enzymes. The catalytic core domain has the (beta/alpha)(8) barrel fold with the active-site cleft formed at the C-terminal end of the barrel. Substrate binding experiments have led to the location of two distinct maltose-binding sites; one lies in the active-site cleft, covering subsites -2 and -1; the other is located in a pocket adjacent to the active-site cleft. The structure of MTase, together with the conservation of active-site residues among family 13 glycoside hydrolases, are consistent with a common double-displacement catalytic mechanism for this enzyme. Analysis of maltose binding in the active site reveals that the transfer of dextrinyl residues longer than a maltosyl unit is prevented by termination of the active-site cleft after the -2 subsite by the side-chain of Lys151 and the stretch of residues 314-317, providing an explanation for the strict transfer specificity of MTase.     

The block spectrum of RNA pseudoknot structures

Journal of Mathematical Biology - In this paper we analyze the length-spectrum of blocks in $$gamma $$ -structures. $$gamma $$ -structures are a class of RNA pseudoknot structures that play a key...     

Genetic analysis of the structure and function of transfer messenger RNA pseudoknot 1

tmRNA rescues stalled ribosomes in eubacteria by forcing the ribosome to abandon its mRNA template and resume translation with tmRNA itself as a template. Pseudoknot 1 (pk1), immediately upstream of this coding region in tmRNA, is a structural element that is considered essential for tmRNA function based on the analysis of pk1 mutants in vitro. pk1 binds near the ribosomal decoding site and may make base-specific contacts with tmRNA ligands. To study pk1 structure and function in vivo, we have developed a genetic selection that ties the life of Escherichia coli cells to tmRNA activity. Mutation of pk1 at 20% per base and selection for tmRNA activity yielded sequences that retain the same pseudoknot fold. In contrast, selection of active mutants from 10(6) completely random sequences identified hairpin structures that functionally replace pk1. Rational design of a hairpin with increased stability using an unrelated sequence yielded a tmRNA mutant with nearly wild-type activity. We conclude that the role of pk1 in tmRNA function is purely structural and that it can be replaced with a variety of hairpin structures. Our results demonstrate that in the study of functional RNAs, the inactivity of a mutant designed to destroy a given structure should not be interpreted as proof that the structure is necessary for RNA function. Such mutations may only destabilize a global fold that could be formed equally well by an entirely different, stable structure.     

The crystal and molecular structure of the alpha-helical nonapeptide antibiotic leucinostatin A

The crystal and molecular structure of the nonapeptide antibiotic leucinostatin A, containing some uncommon amino acids and three Aib residues, has been determined by x-ray diffraction analysis. The molecule crystallizes in the orthorhombic space group P2(1)2(1)2(1), a = 10.924, b = 17.810, c = 40.50 A, C62H111N11O13, HCl.H2O, Z = 4. The peptide backbone folds in a regular right-handed alpha-helix conformation, with six intramolecular i----(i + 4) hydrogen bonds, forming C13 rings. The nonapeptide chain includes at the C end an unusual beta-Ala residue, which also adopts the helical structure of the other eight residues. In the crystal the helices are linked head to tail by electrostatic and hydrogen-bond interactions, forming continuous helical rods. The crystal packing is formed by adjacent parallel and antiparallel helical rods. Between adjacent parallel helical columns there are only van der Waals contacts, while between adjacent antiparallel helical columns hydrogen-bond interactions are formed.     

A proposal for the secondary structure of a variable area of eukaryotic small ribosomal subunit RNA involving the existence of a pseudoknot.

Eukaryotic small ribosomal subunit RNAs contain an area of variable structure, V4, which comprises about 250 nucleotides in most species, whereas the corresponding area in bacterial small ribosomal subunit RNAs consists of about 64 nucleotides folded into a single hairpin. There is no consensus on the secondary structure of area V4 in eukaryotes, about 10 different models having been proposed. The prediction of a model on a comparative basis poses special problems because, due to the variability of the area in length as well as sequence, a dependable alignment is very difficult to achieve. A new model was derived by systematic examination of all combinations of helices that have been hitherto proposed, plus some new ones. The following properties of the helices were examined: transposability to all presently known sequences, presence of compensating substitutions, and thermodynamic stability. A model was selected by ranking all possible combinations of transposable helices according to the number of compensating substitutions scored. The optimal model comprises a pseudoknot and four hairpin structures. Certain species contain additional hairpins inserted between these structural elements, while in others the structure is partially or entirely deleted.     

A pseudoknot ribozyme structure is active in vivo and required for hepatitis delta virus RNA replication.

The ribozymes of hepatitis delta virus (HDV) have so far been studied primarily in vitro. Several structural models for HDV ribozymes based on truncated HDV RNA fragments, which are different from the hammerhead or the hairpin/paperclip ribozyme model proposed for plant viroid or virusoid RNAs, have been proposed. Whether these structures actually exist in vivo and whether ribozymes actually function in the HDV replication cycle have not been demonstrated. We have now developed an in vivo ribozyme self-cleavage assay capable of detecting self-cleavage of dimer or trimer HDV RNA in vivo. By site-directed mutagenesis and compensatory mutations to disrupt and restore potential base pairing in the ribozyme domain of the full-length HDV RNA according to the various structural models, a close correlation between the detected in vivo and the predicted in vitro ribozyme activities of various mutant RNAs was demonstrated. These results suggest that the proposed in vitro ribozyme structure likely exists and functions during the HDV replication cycle in vivo. Furthermore, the pseudoknot model most likely represents the structure responsible for the ribozyme activity in vivo. All of the mutants that had lost the ribozyme activity could not replicate, indicating that the ribozyme activities are indeed required for HDV RNA replication. However, some of the compensatory mutants which have restored both the cleavage and ligation activities could not replicate, suggesting that the ribozyme domains are also involved in other unidentified functions or in the formation of an alternative structure that is required for HDV RNA replication. This study thus established that the ribozyme has important biological functions in the HDV life cycle.     

The crystal structure of a 26-nucleotide RNA containing a hook-turn

A crystal structure has been obtained for a 26-nucleotide RNA that contains the loop E sequence from Chromatium minutissimum. Rather than having a loop E-like conformation, it consists of an A-form helix that splits into two separate strands following a sheared A-G base pair. The backbone of the strand containing the G of the A-G pair makes a turn of almost 180 degrees in the space of two nucleotides, and then interacts with the minor groove of the helix from which it originates. Similar structures, which we call hook-turns, occur in 16S and 23S rRNAs. They are found at places where the two strands of a helix separate at an A/G juxtaposition to interact with other sequences.     

A long-range pseudoknot in Qbeta RNA is essential for replication

A puzzling aspect of replication of bacteriophage Qbeta RNA has always been that replicase binds at an internal segment, the M-site, some 1450 nt away from the 3' end. Here, we report on the existence of a long-range pseudoknot, base-pairing eight nt in the loop of the 3' terminal hairpin to a single-stranded interdomain sequence located about 1200 nt upstream, close to the internal replicase binding site. Introduction of a single mismatch into this pseudoknot is sufficient to abolish replication, but the inhibition is fully reversed by a second-site substitution that restores the pairing. The pseudoknot is part of an elaborate structure that seems to hold the 3' end in a fixed position vis a vis the replicase binding site. Our results imply that the shape of the RNA confers the functonality. We discuss the possible relevance of our findings for replication of other viral RNAs.