共查询到20条相似文献,搜索用时 31 毫秒
1.
The structure of 5'-d(ACATC(AFB)GATCT)-3'.5'-d(AGATCAATGT)-3', containing the C(5).A(16) mismatch at the base pair 5' to the modified (AFB)G(6), was determined by NMR. The characteristic 5'-intercalation of the AFB(1) moiety was maintained. The mismatched C(5).A(16) pair existed in the wobble conformation, with the C(5) imino nitrogen hydrogen bonded to the A(16) exocyclic amino group. The wobble pair existed as a mixture of protonated and nonprotonated species. The pK(a) for protonation at the A(16) imino nitrogen was similar to that of the C(5).A(16) wobble pair in the corresponding duplex not adducted with AFB(1). Overall, the presence of AFB(1) did not interfere with wobble pair formation at the mismatched site. Molecular dynamics calculations restrained by distances derived from NOE data and torsion angles derived from (1)H (3)J couplings were carried out for both the protonated and nonprotonated wobble pairs at C(5).A(16). Both sets of calculations predicted the A(16) amino group was within 3 A of the C(5) imino nitrogen. The calculations suggested that protonation of the C(5).A(16) wobble pair should shift C(5) toward the major groove and shift A(16) toward the minor groove. The NMR data showed evidence for the presence of a minor conformation characterized by unusual NOEs between T(4) and (AFB)G(6). T(4) is two nucleotides in the 5'-direction from the modified base. These NOEs suggested that in the minor conformation nucleotide T(4) was in closer proximity to (AFB)G(6) than would be expected for duplex DNA. Modeling studies examined the possibility that T(4) transiently paired with the mismatched A(16), allowing it to come within NOE distance of (AFB)G(6). This model structure was consistent with the unusual NOEs associated with the minor conformation. The structural studies are discussed in relationship to nontargeted C --> T transitions observed 5' to the modified (AFB)G in site-specific mutagenesis experiments [Bailey, E. A., Iyer, R. S., Stone, M. P., Harris, T. M., and Essigmann, J. M. (1996) Proc. Natl. Acad. Sci. U.S.A. 93, 1535-1539]. 相似文献
2.
Z Gu A Gorin R Krishnasamy B E Hingerty A K Basu S Broyde D J Patel 《Biochemistry》1999,38(33):10843-10854
Solution structural studies have been undertaken on the aminopyrene-C(8)-dG ([AP]dG) adduct in the d(C5-[AP]G6-C7). d(G16-A17-G18) sequence context in an 11-mer duplex with dA opposite [AP]dG, using proton-proton distance and intensity restraints derived from NMR data in combination with distance-restrained molecular mechanics and intensity-restrained relaxation matrix refinement calculations. The exchangeable and nonexchangeable protons of the aminopyrene and the nucleic acid were assigned following analysis of two-dimensional NMR data sets on the [AP]dG.dA 11-mer duplex in H2O and D2O solution. The broadening of several resonances within the d(G16-A17-G18) segment positioned opposite the [AP]dG6 lesion site resulted in weaker NOEs, involving these protons in the adduct duplex. Both proton and carbon NMR data are consistent with a syn glycosidic torsion angle for the [AP]dG6 residue in the adduct duplex. The aminopyrene ring of [AP]dG6 is intercalated into the DNA helix between intact Watson-Crick dC5.dG18 and dC7.dG16 base pairs and is in contact with dC5, dC7, dG16, dA17, and dG18 residues that form a hydrophobic pocket around it. The intercalated AP ring of [AP]dG6 stacks over the purine ring of dG16 and, to a lesser extent dG18, while the looped out deoxyguanosine ring of [AP]dG6 stacks over dC5 in the solution structure of the adduct duplex. The dA17 base opposite the adduct site is not looped out of the helix but rather participates in an in-plane platform with adjacent dG18 in some of the refined structures of the adduct duplex. The solution structures are quite different for the [AP]dG.dA 11-mer duplex containing the larger aminopyrene ring (reported in this study) relative to the previously published [AF]dG.dA 11-mer duplex containing the smaller aminofluorene ring (Norman et al., Biochemistry 28, 7462-7476, 1989) in the same sequence context. Both the modified syn guanine and the dA positioned opposite it are stacked into the helix with the aminofluorene chromophore displaced into the minor groove in the latter adduct duplex. By contrast, the aminopyrenyl ring participates in an intercalated base-displaced structure in the present study of the [AP]dG.dA 11-mer duplex and in a previously published study of the [AP]dG.dC 11-mer duplex (Mao et al., Biochemistry 35, 12659-12670, 1996). Such intercalated base-displaced structures without hydrogen bonding between the [AP]dG adduct and dC or mismatched dA residues positioned opposite it, if present at a replication fork, may cause polymerase stalling and formation of a slipped intermediate that could produce frameshift mutations, the most dominant mutagenic consequence of the [AP]dG lesion. 相似文献
3.
Volk DE Rice JS Luxon BA Yeh HJ Liang C Xie G Sayer JM Jerina DM Gorenstein DG 《Biochemistry》2000,39(46):14040-14053
2D NMR has been used to examine the structure and dynamics of a 12-mer DNA duplex, d(T(1)A(2)G(3)T(4)C(5)A(6)A(7)G(8)G(9)G(10)C(11)A(12))-d(T(13)G(14)C( 15)C(16)C(17)T(18)T(19)G(20)A(21)C(22)T(23)A(24)), containing a 10R adduct at dA(7) that corresponds to trans addition of the N(6)-amino group of dA(7) to (-)-(7S,8R,9R,10S)-7,8-dihydroxy-9, 10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene [(-)-(S,R,R,S)-BP DE-2]. This DNA duplex contains the base sequence for the major dA mutational hot spot in the HPRT gene when Chinese hamster V79 cells are given low doses of the highly carcinogenic (+)-(R,S,S,R)-BP DE-2 enantiomer. NOE data indicate that the hydrocarbon is intercalated on the 5'-side of the modified base as has been seen previously for other oligonucleotides containing BP DE-2 (10R)-dA adducts. 2D chemical exchange-only experiments indicate dynamic behavior near the intercalation site especially at the 10R adducted dA, such that this base interconverts between the normal anti conformation and a less populated syn conformation. Ab initio molecular orbital chemical shift calculations of nucleotide and dinucleotide fragments in the syn and anti conformations support these conclusions. Although this DNA duplex containing a 10R dA adduct exhibits conformational flexibility as described, it is nevertheless more conformationally stable than the corresponding 10S adducted duplex corresponding to trans opening of the carcinogenic isomer (+)-(R,S,S, R)-BP DE-2, which was too dynamic to permit NMR structure determination. UV and imino proton NMR spectral observations indicated pronounced differences between these two diastereomeric 12-mer duplexes, consistent with conformational disorder at the adduct site and/or an equilibrium with a nonintercalated orientation of the hydrocarbon in the duplex containing the 10S adduct. The existence of conformational flexibility around adducts may be related to the occurrence of multiple mutagenic outcomes resulting from a single DE adduct. 相似文献
4.
Two-dimensional proton NMR studies are reported on the complementary d(C-A-T-G-T-G-T-A-C).d(G-T-A-C-epsilon A-C-A-T-G) nonanucleotide duplex (designated epsilon dA.dT 9-mer duplex) containing 1,N6-ethenodeoxyadenosine (epsilon dA), a carcinogen-DNA adduct, positioned opposite thymidine in the center of the helix. Our NMR studies have focused on the conformation of the epsilon dA.dT 9-mer duplex at neutral pH with emphasis on defining the alignment at the dT5.epsilon dA14 lesion site. The through-space NOE distance connectivities establish that both dT5 and epsilon dA14 adopt anti glycosidic torsion angles, are directed into the interior of the helix, and stack with flanking Watson-Crick dG4.dC15 and dG6.dC13 pairs. Furthermore, the d(G4-T5-G6).d(C13-epsilon A14-C15) trinucleotide segment centered about the dT5.epsilon dA14 lesion site adopts a right-handed helical conformation in solution. Energy minimization computations were undertaken starting from six different alignments of dT5(anti) and epsilon dA14(anti) at the lesion site and were guided by distance constraints defined by lower and upper bounds estimated from NOESY data sets on the epsilon dA.dT 9-mer duplex. Two families of energy-minimized structures were identified with the dT5 displaced toward either the flanking dG4.dC15 or the dG6.dC13 base pair. These structures can be differentiated on the basis of the observed NOEs from the imino proton of dT5 to the imino proton of dG4 but not dG6 and to the amino protons of dC15 but not dC13 that were not included in the constraints data set used in energy minimization. Our NMR data are consistent with a nonplanar alignment of epsilon dA14(anti) and dT5(anti) with dT5 displaced toward the flanking dG4.dC15 base pair within the d(G4-T5-G6).d(C13-epsilon A14-C15) segment of the epsilon dA.dT 9-mer duplex. 相似文献
5.
S L Painter I S Zegar P J Tamura S Bluhm C M Harris T M Harris M P Stone 《Biochemistry》1999,38(27):8635-8646
Conformational studies of R- and S-alpha-(N6-adenyl)styrene oxide adducts mismatched with deoxycytosine at position X6 in d(CGGACXAGAAG).d(CTTCTCGTCCG), incorporating codons 60, 61 (underlined), and 62 of the human N-ras protooncogene, are described. These were the R- and S(61,2)C adducts. The S(61,2)C adduct afforded a stable solution structure, while the R(61,2)C adduct resulted in a disordered structure. Distance restraints for the S(61, 2)C adduct were calculated from NOE data using relaxation matrix analysis. These were incorporated as effective potentials into the total energy equation. The structures were refined using restrained molecular dynamics calculations which incorporated a simulated annealing protocol. The accuracy of the emergent structures was evaluated by complete relaxation matrix methods. The structures refined to an average rms difference of 1.07 A, determined by pairwise analysis. The experimentally determined structure was compared to NOE intensity data using complete relaxation matrix back-calculations, yielding an R1x value of 11.2 x 10(-)2. The phenyl ring of the styrene in the S(61,2)C adduct was in the major groove and remained oriented in the 3'-direction as observed for the corresponding S(61,2) adduct paired with thymine [Feng, B., Zhou, L., Pasarelli, M., Harris, C. M., Harris, T. M., and Stone, M. P. (1995) Biochemistry 34, 14021-14036]. A shift of the modified adenine toward the minor groove resulted in the styrenyl ring stacking with nucleotide C5 on the 5'-side of the lesion, which shifted toward the major groove. Unlike the unmodified A.C mismatch, neither the S(61,2)C nor the R(61,2)C adduct formed protonated wobble A.C hydrogen bonds. This suggests that protonated wobble A.C pairing need not be prerequisite to low levels of alpha-SO-induced A --> G mutations. The shift of the modified adenine toward the minor groove in the S(61,2)C structure may play a more important role in the genesis of A --> G mutations. The disordered structure of the R(61,2)C adduct provides a potential explanation as to why that adduct does not induce A --> G mutations. 相似文献
6.
A solution structural study has been undertaken on the aminofluorene-C8-dG ([AF]dG) adduct located at a single-strand-double-strand d(A1-A2-C3-[AF]G4-C5-T6-A7-C8-C9-A10-T11-C12-C13). d(G14-G15-A16-T17-G18-G19-T20- A21-G22-N23) 13/10-mer junction (N = C or A) using proton-proton distance restraints derived from NMR data in combination with intensity-based relaxation matrix refinement computations. This single-strand-double-strand junction models one arm of a replication fork composed of a 13-mer template strand which contains the [AF]dG modification site and a 10-mer primer strand which has been elongated up to the modified guanine with either its complementary dC partner or a dA mismatch. The solution structures establish that the duplex segment retains a minimally perturbed B-DNA conformation with Watson-Crick hydrogen-bonding retained up to the dC5.dG22 base pair. The guanine ring of the [AF]dG4 adduct adopts a syn glycosidic torsion angle and is displaced into the major groove when positioned opposite dC or dA residues. This base displacement of the modified guanine is accompanied by stacking of one face of the aminofluorene ring of [AF]dG4 with the dC5.dG22 base pair, while the other face of the aminofluorene ring is stacked with the purine ring of the nonadjacent dA2 residue. By contrast, the dC and dA residues opposite the junctional [AF]dG4 adduct site adopt distinctly different alignments. The dC23 residue positioned opposite the adduct site is looped out into the minor groove by the aminofluorene ring. The syn displaced orientation of the modified dG with stacking of the aminofluorene and the looped out position of the partner dC could be envisioned to cause polymerase stalling associated with subsequent misalignment leading to frameshift mutations in appropriate sequences. The dA23 residue positioned opposite the adduct site is positioned in the major groove with its purine ring aligned face down over the van der Waals surface of the major groove and its amino group directed toward the T6.A21 base pair. The Hoogsteen edge of the modified guanine of [AF]dG4 and the Watson-Crick edge of dA23 positioned opposite it are approximately coplanar and directed toward each other but are separated by twice the hydrogen-bonding distance required for pairing. This structure of [AF]dG opposite dA at a model template-primer junctional site can be compared with a previous structure of [AF]dG opposite dA within a fully paired duplex [Norman, D., Abuaf, P., Hingerty, B. E., Live, D. , Grunberger, D., Broyde, S., and Patel, D. J. (1989) Biochemistry 28, 7462-7476]. The alignment of the Hoogsteen edge of [AF]dG (syn) positioned opposite the Watson-Crick edge of dA (anti) has been observed for both systems with the separation greater in the case of the junctional alignment in the model template-primer system. However, the aminofluorene ring is positioned in the minor groove in the fully paired duplex while it stacks over the junctional base pair in the template-primer system. This suggests that the syn [AF]dG opposite dA junctional alignment can be readily incorporated within a duplex by a translation of this entity toward the minor groove. 相似文献
7.
The trans-8,9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B(1) cationic guanine N7 adduct of aflatoxin B(1) thermally stabilizes the DNA duplex, as reflected in increased T(m) values upon adduction. The magnitude of the increased T(m) value is characteristically 2-3 degrees C. The major rotamer of the neutral guanine N7 adduct trans-8,9-dihydro-8-(2,6-diamino-4-oxo-3,4-dihydropyrimid-5-yl-formamido)-9-hydroxy aflatoxin B(1) (the FAPY major adduct) exhibits a 15 degrees C increase in T(m) in 5'-d(CTAT(FAPY)GATTCA)-3'-5'-d(TGAATCATAG)-3'. Site-specific mutagenesis experiments reveal the FAPY major adduct induces G-->T mutations in Escherichia coli at a frequency six times higher than that of the cationic adduct (Smela, M. E.; Hamm, M. L.; Henderson, P. T.; Harris, C. M.; Harris, T. M.; Essigmann, J. M. Proc Natl Acad Sci USA, 99, 6655-6660). Thus, the FAPY major lesion may account substantially for the genotoxicity of AFB(1). Structural studies for cationic and FAPY adducts of aflatoxin B(1) suggest both adducts intercalate above the 5'-face of the modified deoxyguanosine and that in each instance the aflatoxin moiety spans the DNA helix. Intercalation of the aflatoxin moiety, accompanied by favorable stacking with the neighboring base pairs, is thought to account for the increased thermal stability of the aflatoxin cationic guanine N7 and the FAPY major adducts. However, the structural basis for the large increase in thermal stability of the FAPY major adduct in comparison to the cationic guanine N7 adduct of aflatoxin B(1) is not well understood. In light of the site-specific mutagenesis studies, it is of considerable interest. For both adducts, the intercalation structures are similar, although improved stacking with neighboring base pairs is observed for the FAPY major adduct. In addition, the presence of the formamido group in the aflatoxin B(1) FAPY major adduct may enhance duplex stability, perhaps via intrastrand sequence-specific hydrogen bonding interactions within the duplex. 相似文献
8.
C de los Santos M Kouchakdjian K Yarema A Basu J Essigmann D J Patel 《Biochemistry》1991,30(7):1828-1835
Proton NMR studies are reported on the complementary d(C-A-T-G-G-G-T-A-C).d(G-T-A-C-epsilon A-C-A-T-G) nonanucleotide duplex (designated epsilon dA.dG 9-mer duplex), which contains exocyclic adduct 1,N6-ethenodeoxyadenosine positioned opposite deoxyguanosine in the center of the helix. The present study focuses on the alignment of dG5 and epsilon dA14 at the lesion site in the epsilon dA.dG 9-mer duplex at neutral pH. This alignment has been characterized by monitoring the NOEs originating from the NH1 proton of dG5 and the H2, H5, and H7/H8 protons of epsilon dA14 in the central d(G4-G5-G6).d(C13-epsilon A14-C15) trinucleotide segment of the epsilon dA.dG 9-mer duplex. These NOE patterns establish that epsilon dA14 adopts a syn glycosidic torsion angle that positions the exocyclic ring toward the major groove edge while all the other bases including dG5 adopt anti glycosidic torsion angles. We detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(G4-G5-G6).d(C13-epsilon A14-C15) trinucleotide segment which establish formation of right-handed helical conformations on both strands and stacking of the dG5(anti).epsilon dA14(syn) pair between stable dG4.dC15 and dG6.dC13 pairs. The energy-minimized conformation of the central d(G4-G5-G6).d(C13-epsilon A14-C15) segment establishes that the dG5(anti).epsilon dA14(syn) alignment is stabilized by two hydrogen bonds from the NH1 and NH2-2 of dG5(anti) to N9 and N1 of epsilon dA14(syn), respectively.(ABSTRACT TRUNCATED AT 250 WORDS) 相似文献
9.
Two-dimensional NMR was used to determine the solution structure of an undecanucleotide duplex, d(CGGTCACGAGG).d(CCTCGTGACCG), in which (+)-(7S,8R,9S,10R)-7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene is covalently bonded to the exocyclic N(6)() amino group of the central deoxyadenosine, dA(6), through trans addition at C10 of the epoxide (to give a 10S adduct). The present study represents the first NMR structure of a benzo[a]pyrene (10S)-dA adduct in DNA with a complementary T opposite the modified dA. Exchangeable and nonexchangeable protons of the modified duplex were assigned by the use of TOCSY (in D(2)O) and NOESY spectra (in H(2)O and D(2)O). Sequential NOEs expected for a B-type DNA conformation with typical Watson-Crick base pairing are observed along the duplex, except at the lesion site. We observed a strong intraresidue NOE cross-peak between H1' and H8 of the modified dA(6). The sugar H2' and H2' ' of dC(5) lacked NOE cross-peaks with H8 of dA(6) but showed weak interactions with H2 of dA(6) instead. In addition, the chemical shift of the H8 proton (7.51 ppm) of dA(6) appears at a higher field than that of H2 (8.48 ppm). These NOE and chemical shift data for the dA(6) base protons are typical of a syn glycosidic bond at the modified base. Restrained molecular dynamics/energy minimization calculations show that the hydrocarbon is intercalated from the major groove on the 3'-side of the modified base between base pairs A(6)-T(17) and C(7)-G(16) and confirm the syn glycosidic angle (58 degrees ) of the modified dA(6). In the syn structure, a weak A-T hydrogen bond is possible between the N3-H proton of T(17) and N7 of dA(6) (at a distance of 3.11 A), whereas N1, the usual hydrogen bonding partner for N3-H of T when dA is in the anti conformation, is 6.31 A away from this proton. The 10(S)-dA modified DNA duplex remains in a right-handed helix, which bends in the direction of the aliphatic ring of BaP at about 42 degrees from the helical axis. ROESY experiments provided evidence for interconversion between the major, syn conformer and a minor, possibly anti, conformer. 相似文献
10.
Proton NMR studies were conducted on the complementary 15-mer duplex d(5'-TACTCTTCTTGACCT).(5'-AGGTCAAGAAGAGTA) (designated as unmodified 15-mer duplex) spanning a portion of the mouse c-Ha-ras protooncogene centered around codon 61. Identical studies were carried out on the same sequence, after specific modification with a reactive derivative of the carcinogen 4-aminobiphenyl (ABP), which resulted in incorporation of a single N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP) adduct in the noncoding strand (designated as ABP-modified 15-mer duplex). The adduct was located at the position corresponding to the first base of codon 61. The NMR data for the unmodified 15-mer duplex were fully consistent with a standard right-handed B-type DNA duplex conformation, with the possible exception of the frayed terminal base pairs. The ABP-modified 15-mer duplex was found to adopt one major conformation, although at least one additional conformation could be detected especially near room temperature. The major form, which exhibited strikingly similar NOE patterns as to those of the parent oligomer, both in H2O and D2O spectra, assumed a standard Watson-Crick base pairing throughout the entire length of the duplex, including the modification site and its flanking base pairs. Although some local perturbation of the helix could be detected in the vicinity of the modified guanosine, the NOE distance constraints established that the helix was globally right-handed and that the glycosidic torsion angles had the normal anti orientation, both at the modified base and its partner cytidine. Furthermore, the absence of strong NOE interactions between protons in the ABP moiety, which was rapidly rotating, and the nucleic acid protons was consistent with positioning of the arylamine moiety in the major groove of a weakly distorted double-helical structure. Although insufficient data prevented a detailed characterization of the minor conformer(s), the observation of significant shieldings for all the arylamine protons indicated a different orientation at the modified site in the minor contributor(s), possibly with extensive stacking between the ABP fragment and the neighboring bases. 相似文献
11.
M Kouchakdjian V Bodepudi S Shibutani M Eisenberg F Johnson A P Grollman D J Patel 《Biochemistry》1991,30(5):1403-1412
Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12).d(G13-G14-T15- G16-A17-A18-T19- A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG.dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. We have assigned the exchangeable NH1, NH7, and NH2-2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG.dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H2O solution. The observed NOEs derived from the NH7 proton of 8-oxo-7H-dG7 to the H2 and NH2-6 protons of dA18 establish an 8-oxo-7H-dG7(syn).dA 18(anti) alignment at the lesion site in the 8-oxo-7H-dG.dA 12-mer duplex in solution. This alignment, which places the 8-oxo group in the minor groove, was further characterized by an analysis of the NOESY spectrum of the 8-oxo-7H-dG.dA 12-mer duplex in D2O solution. We were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8).d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn).dA(anti) pair between stable Watson-Crick dA6.dT19 and dT8.dA17 base pairs with minimal perturbation of the helix. Thus, both strands of the 8-oxo-7H-dG.dA 12-mer duplex adopt right-handed conformations at and adjacent to the lesion site, the unmodified bases adopt anti glycosidic torsion angles, and the bases are stacked into the helix. The energy-minimized conformation of the central d(A6-oxo-G7-T8).d(A17-A18-T19) segment requires that the 8-oxo-7H-dG7(syn).dA18(anti) alignment be stabilized by two hydrogen bonds from NH7 and O6 of 8-oxo-7H-dG7(syn) to N1 and NH2-6 of dA18(anti), respectively, at the lesion site.(ABSTRACT TRUNCATED AT 400 WORDS) 相似文献
12.
We have used 31P and 1H NMR spectroscopy and circular dichroism to define the solution conformation of d(GTGAACTT)2 which contains tandem G.A mismatched base pairs and 3'-overhanging TT ends. Measurements of coupling constants and NOE intensities show that the sugar puckers of the nucleotides are predominantly in the south domain (i.e., near C2'-endo) and that the glycosidic torsion angles are anti. The sequential NOE intensities indicate the presence of a right-handed helix. Analysis of the 31P and 1H NMR spectra of the duplex shows that the tandem mismatch forms a block in which there are unusual backbone torsion angles (i.e., in the BII state), within an otherwise B-like structure. The chemical shift of the N1H of the mismatched guanosine and NOEs between the mismatched base pairs and their nearest neighbors are inconsistent with the imino pairing present in single A.G mismatches or in the X-ray structure of a tandem mismatch [Privé, G. G., et al. (1987) Science 238, 498-503] but the data are consistent with the amino pairing found by Li et al. (1991) [Li, Y., et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 26-30]. The strong base-base stacking both within the tandem G.A block and between the G.A mismatches and their other nearest neighbors offsets the intrinsic destabilizing effects of the mismatch. Further, the 3'-TT overhangs stack onto the ends of the helix and stabilize the duplex against fraying, which accounts for the observed increase in the melting temperature compared with the flush-ended duplex. 相似文献
13.
The mechanism of frame shift mutagenesis induced by N-(deoxyguanosin-8-yl)-1-aminopyrene, the major DNA adduct formed by the carcinogen 1-nitropyrene, was investigated by thermal melting studies of a 13-mer in which the adduct was flanked by a 5' and a 3' C. Compared to the unmodified 13-mer, the adduct destabilized the duplex by 4-5 kcal/mol, and the DeltaDeltaG value remained approximately the same regardless of which base was placed opposite the adduct. In contrast, deletion of the base opposite the adduct stabilized the duplex by nearly 4 kcal/mol. The adduct in the same sequence context was inserted into a bacteriophage M13 DNA containing the simian virus 40 origin of replication. The constructed DNA template was replicated in vitro with extracts from normal human fibroblasts. The adduct was not removed from the progeny DNA following bidirectional semiconservative replication, which suggests that it had been bypassed, rather than repaired, by the cell extract. When newly replicated bacteriophage was evaluated for mutations in the region of the modified G, most contained a G at the adduct site, indicating error-free replication. A small number of mutants ( approximately 2 x 10(-3)) were detected, all of which contained a targeted G.C base pair deletion. This suggests a relationship between the thermodynamic stability of the adduct in DNA and the errors that occurred during replicative bypass by the human DNA polymerases. 相似文献
14.
Sterigmatocystin and aflatoxin are potent mutagens that contaminate foodstuffs stored under conditions that permit fungal growth. These food mycotoxins can be metabolically activated to their epoxides, which subsequently form covalent adducts with DNA and can eventually induce tumor development. We have generated the sterigmatocystin-d(A1-A2-T3-G4-C5-A6-T7-T8) covalent adduct (two sterigmatocystins per duplex) by reacting sterigmatocystin-1,2-epoxide with the self-complementary d(A-A-T-G-C-A-T-T) duplex and determined its solution structure by the combined application of two-dimensional NMR experiments and molecular dynamics calculations. The self-complementary duplex retains its 2-fold symmetry following covalent adduct formation of sterigmatocystin at the N7 position of G4 residues on each strand of the duplex. The H8 proton of [ST]G4 exchanges rapidly with water and resonates at 9.58 ppm due to the presence of the positive charge on the guanine ring following adduct formation. We have assigned the exchangeable and nonexchangeable proton resonances of sterigmatocystin and the duplex in the covalent adduct and identified the intermolecular proton-proton NOEs that define the orientation and mode of binding of the mutagen to duplex DNA. The analysis was aided by intermolecular NOEs between the sterigmatocystin protons with both the major groove and minor groove protons of the DNA. The molecular dynamics calculations were aided by 180 intramolecular nucleic acid constraints, 16 intramolecular sterigmatocystin constraints, and 56 intermolecular distance constraints between sterigmatocystin and the nucleic acid protons in the adduct. The sterigmatocystin chromophore intercalates between the [ST]G4.C5 and T3.A6 base pairs and stacks predominantly over the modified guanine ring in the adduct duplex. The overall conformation of the DNA remains right-handed on adduct formation with unwinding of the helix, as well as widening of the minor groove. Parallel NMR studies on the sterigmatocystin-d(A1-A2-A3-G4-C5-T6-T7-T8) covalent adduct (two sterigmatocystins per duplex) provide supportive evidence that the mutagen covalently adducts the N7 position of G4 and its chromophore intercalates to the 5' side of the guanine and stacks over it. The present NMR-molecular dynamics studies that define a detailed structure for the sterigmatocystin-DNA adduct support key structural conclusions proposed previously on the basis of a qualitative analysis of NMR parameters for the adduct formed by the related food mutagen aflatoxin B1 and DNA [Gopalakrishnan, S., Harris, T. M., & Stone, M. P. (1990) Biochemistry 29, 10438-10448]. 相似文献
15.
The conformation of the trans-anti-(1S,2R,3S,4R)-N(2)-[1-(1,2,3,4-tetrahydro-2,3,4-trihydroxybenz[a]anthracenyl)]-2'-deoxyguanosyl adduct in d(G(1)G(2)C(3)A(4)G(5)X(6)T(7)G(8)G(9)T(10)G(11)).d(C(12)A(13)C(14)C(15)A(16)C(17)C(18)T(19)G(20)C(21)C(22)), bearing codon 12 of the human N-ras protooncogene (underlined), was determined. This adduct had S stereochemistry at the benzylic carbon. Its occurrence in DNA is a consequence of trans opening by the deoxyguanosine amino group of (1R,2S,3S,4R)-1,2-epoxy-1,2,3,4-tetrahydrobenz[a]anthracenyl-3,4-diol. The resonance frequencies, relative to the unmodified DNA, of the X(6) H1' and H6 protons were shifted downfield, whereas those of the C(18) and T(19) H1', H2', H2' ', and H3' deoxyribose protons were shifted upfield. The imino and amino resonances exhibited the expected sequential connectivities, suggesting no interruption of Watson-Crick pairing. A total of 426 interproton distances, including nine uniquely assigned BA-DNA distances, were used in the restrained molecular dynamics calculations. The refined structure showed that the benz[a]anthracene moiety bound in the minor groove, in the 5'-direction from the modified site. This was similar to the (+)-trans-anti-benzo[a]pyrene-N(2)-dG adduct having S stereochemistry at the benzylic carbon [Cosman, M., De Los Santos, C., Fiala, R., Hingerty, B. E., Singh, S. B., Ibanez, V., Margulis, L. A., Live, D., Geacintov, N. E., Broyde, S., and Patel, D. J. (1992) Proc. Natl. Acad. Sci. U.S.A. 89, 1914-1918]. It differed from the (-)-trans-anti-benzo[c]phenanthrene-N(2)-dG adduct having S stereochemistry at the benzylic carbon, which intercalated in the 5'-direction [Lin, C. H., Huang, X., Kolbanovskii, A., Hingerty, B. E., Amin, S., Broyde, S., Geacintov, N. E., and Patel, D. J. (2001) J. Mol. Biol. 306, 1059-1080]. The results provided insight into how PAH molecular topology modulates adduct structure in duplex DNA. 相似文献
16.
NMR evidence of the stabilisation by the carcinogen N-2-acetylaminofluorene of a frameshift mutagenesis intermediate. 总被引:1,自引:0,他引:1
下载免费PDF全文
![点击此处可从《Nucleic acids research》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Two heteroduplexes d(C1A2C3T4C5G6C7A8C9A10C11)-d (G12T13G14T15G16G17A18G19T20G21) containing a bulged guanine either unmodified or modified with the carcinogen N-2-acetylaminofluorene (AAF) have been studied by nuclear magnetic resonance (NMR) as models of slipped mutagenic intermediates (SMI). Conformational equilibria are observed in both the unmodified and the AAF-modified heteroduplexes. The major conformation of the unmodified duplex is one where the extra guanine is stacked in the helix and the major conformation of the AAF-modified heteroduplex is one where the AAF is external to the helix. Unusual sugar proton chemical shifts of C5- and G6-AAF indicate that the AAF ring is pointing out in the 5' direction. A strong increase in the modified heteroduplex melting temperature (+15 degrees C) is observed. Moreover, in contrast to the unmodified heteroduplex, which shows extensive melting in the vicinity of the bulged guanine, the base pairs around the bulge in the AAF-modified heteroduplex remain paired at temperatures up to 30 degrees C. This exceptional stability of the site around the bulged modified guanine is suggested to be responsible for the high rate of -1 mutation induced by AAF at repetitive sequences. 相似文献
17.
The refined solution structure for the ring-opened N2-(3-oxo-1-propenyl)-dG derivative of the malondialdehyde deoxyguanosine adduct M(1)G [3-(2'-deoxy-beta-D-erythro-pentofuranosyl)pyrimido[1, 2-a]purin-10(3H)-one] in d(ATCGCXCGGCATG) x d(CATGCCGCGCGAT) [X being N(2)-(3-oxo-1-propenyl)-dG], containing the d(CpG)(3) frameshift hotspot of the Salmonella typhimurium hisD3052 gene, is presented. When inserted into this duplex, M(1)G underwent spontaneous ring opening to N2-(3-oxo-1-propenyl)-dG. NMR analysis revealed that N2-(3-oxo-1-propenyl)-dG induced minor structural perturbations in the hisD3052 oligodeoxynucleotide. However, the stability of the duplex DNA was reduced; the N2-(3-oxo-1-propenyl)-dG-modified hisD3052 oligodeoxynucleotide exhibited a 14 degrees C decrease in T(m) relative to that of the native oligodeoxynucleotide. The modified guanine maintained stacking interactions with neighboring bases but was not Watson-Crick hydrogen bonded. A total of 13 NOEs were observed from the 3-oxo-1-propenyl moiety protons of N2-(3-oxo-1-propenyl)-dG to DNA protons. Molecular dynamics calculations, restrained by 602 distance restraints derived from experimental NOE measurements and 23 empirical distance restraints, converged with pairwise rmsd differences of <0.90 A. The sixth-root residual factor with the NMR data was 9.1 x 10(-2). The cytosine complementary to N2-(3-oxo-1-propenyl)-dG was pushed toward the major groove but maintained partial stacking interactions with its neighboring bases. The modified guanine remained in the anti conformation, while the 3-oxo-1-propenyl moiety was positioned in the minor groove of the duplex. Possible correlations between the relatively small structural perturbations induced in this DNA duplex by N2-(3-oxo-1-propenyl)-dG and the mutagenic spectrum of M(1)G are discussed. 相似文献
18.
Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.
下载免费PDF全文
![点击此处可从《Nucleic acids research》网站下载免费的PDF全文](/ch/ext_images/free.gif)
The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. 相似文献
19.
Scholdberg TA Merritt WK Dean SM Kowalcyzk A Harris CM Harris TM Rizzo CJ Lloyd RS Stone MP 《Biochemistry》2005,44(9):3327-3337
The solution structure of the N1-(1-hydroxy-3-buten-2(S)-yl)-2'-deoxyinosine adduct arising from the alkylation of adenine N1 by butadiene epoxide (BDO), followed by deamination to deoxyinosine, was determined, in the oligodeoxynucleotide d(CGGACXAGAAG).d(CTTCTCGTCCG). This oligodeoxynucleotide contained the BDO adduct at the second position of codon 61 of the human N-ras protooncogene, and was named the ras61 S-N1-BDO-(61,2) adduct. (1)H NMR revealed a weak C(5) H1' to X(6) H8 NOE, followed by an intense X(6) H8 to X(6) H1' NOE. Simultaneously, the X(6) H8 to X(6) H3' NOE was weak. The resonance arising from the T(17) imino proton was not observed. (1)H NOEs between the butadiene moiety and the DNA positioned the adduct in the major groove. Structural refinement based upon a total of 364 NOE-derived distance restraints yielded a structure in which the modified deoxyinosine was in the high syn conformation about the glycosyl bond, and T(17), the complementary nucleotide, was stacked into the helix, but not hydrogen bonded with the adducted inosine. The refined structure provided a plausible hypothesis as to why this N1 deoxyinosine adduct strongly coded for the incorporation of dCTP during trans lesion DNA replication, both in Escherichia coli [Rodriguez, D. A., Kowalczyk, A., Ward, J. B. J., Harris, C. M., Harris, T. M., and Lloyd, R. S. (2001) Environ. Mol. Mutagen. 38, 292-296], and in mammalian cells [Kanuri, M., Nechev, L. N., Tamura, P. J., Harris, C. M., Harris, T. M., and Lloyd, R. S. (2002) Chem. Res. Toxicol. 15, 1572-1580]. Rotation of the N1 deoxyinosine adduct into the high syn conformation may facilitate incorporation of dCTP via Hoogsteen-type templating with deoxyinosine, thus generating A-to-G mutations. 相似文献
20.
A viral genome containing an unstable aflatoxin B1-N7-guanine DNA adduct situated at a unique site. 总被引:2,自引:0,他引:2
下载免费PDF全文
![点击此处可从《Nucleic acids research》网站下载免费的PDF全文](/ch/ext_images/free.gif)
A problem that has hindered the study of the biological properties of certain DNA adducts, such as those that form at the N7 atoms of purines, is their extreme chemical lability. Conditions are described for the construction of a single-stranded genome containing the chemically and thermally labile 8,9-dihydro-8- (N7-guanyl)-9-hydroxyaflatoxin B1 (AFB1-N7-Gua) adduct, the major DNA adduct of the potent liver carcinogen aflatoxin B1 (AFB1). A 13mer oligonucleotide, d(CCTCTTCGAACTC), was allowed to react with the exo-8,9-epoxide of AFB1 to form an oligonucleotide containing a single AFB1-N7-Gua (at the underlined guanine). This modified 13mer was 5'-phosphorylated and ligated into a gap in an M13 bacteriophage genome generated by annealing a 53mer uracil-containing scaffold to M13mp7L2 linearized by EcoRI. Following ligation, the scaffold was enzymatically removed with uracil DNA glycosylase and exonuclease III. The entire genome construction was complete within 3 h and was carried out at 16 degrees C, pH 6.6, conditions determined to be optimal for AFB1-N7-Gua stability. Characterization procedures indicated that the AFB1-N7-Gua genome was approximately 95% pure with a small (5%) contamination by unmodified genome. This construction scheme should be applicable to other chemically or thermally unstable DNA adducts. 相似文献