17O and 14N n.m.r. studies of the Co (II) interaction with cyclo(Ala*-Ala) in aqueous solution

The complexation of cyclo(Ala*-Ala) with the cobaltous ions in aqueous solution was investigated by 17O and 14N n.m.r. spectroscopy. The 17O and 14N transverse relaxation time (T2p) and chemical shift (delta omega a) of cyclo(Ala*-Ala) were measured as a function of the temperature at pH = 7.03 +/- 0.02, and pH = 6.45 +/- 0.02, and as a function of pH at room temperature. No effects of pH on the transverse relaxation time and chemical shift were observed. Complementary 17O studies of the solvent water molecules were also carried out. The hyperfine coupling constant and the entropy and enthalpy of activation for the exchange of cyclo(Ala*-Ala) and water molecules between the coordinated and noncoordinated states were determined by least-square fit of theoretical equation for the chemical shift delta omega a to experimental data. The hyperfine coupling constant of the peptide bound oxygen was determined to be (-1.6 +/- 0.1) X 10(5) Hz and the entropy and enthalpy (32.0 +/- 3.0) kJ/mol and (-12.0 +/- 1.0) e.u, respectively. Information obtained from 17O n.m.r. study allows some inferences concerning the probable coordination sphere of the cobaltous ion. There are three types of complexes: Co(H2O)6(2+), CoL X 5H2O and CoL2 X 4H2O, with relative concentrations 19.9%, 2.9%, and 77.2%, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)     

17O, 14N and 15N n.m.r. studies of the Co2+ complexes of cyclo(Pro17O-Gly15N) and cyclo(Gly17O-Pro) in aqueous solution

The complexation of cyclo(Pro17O-Gly15N) and cyclo(Gly17O-Pro) with Co2+ ions has been studied by 17O, 14N and 15N n.m.r. spectroscopy in aqueous solution. 17O, 14N and 15N transverse relaxation times and chemical shifts were measured as a function of temperature. The 17O n.m.r. studies unequivocally demonstrate that the cobaltous ion binds to the peptide oxygen of both compounds. The hyperfine coupling constant and the peptide residence times were found to be A = -0.165 MHz and -0.145 MHz, tau m = 16, and 92 microseconds for cyclo(Pro17O-Gly15N) and cyclo(Gly17O-Pro), respectively. The 14N and 15N studies of labeled cyclo(Pro17O-Gly15N) do not indicate binding at either the Gly15N or the Pro14N site.     

The formation constants of dimethylthallium(III)-glutathione complexes in aqueous solution

The complexes formed in the dimethylthallium(III) (Me₂Tl⁺), glutathionate (EGC³⁻) and hydrogen ion system in aqueous solution at 37 °C and I = 150 mmol dm⁻³ (NaCl) have been characterised by means of glass-electrode potentiometry. Glutathione protonation constants were found to be 9.123 ± 0.007, 17.42 ± 0.01, 20.78 ± 0.02, and 22.93 ± 0.02. Formation constants for the complexes [(Me₂Tl)EGCH]⁻ and [(·Me₂Tl) EGC]²⁻ were found to be 11.19 ± 0.03 and 2.39 ± 0.02, respectively. Particular attention has been paid to the evaluation of the effect of possible systematic errors on the constant values determined. Reliable standard deviation estimations have been made by applying a Monte Carlo calculation technique.     

NH resonances of Ribonuclease S-peptide in aqueous solution. Low temperature n.m.r. study

A detailed study of the NH resonances of Ribonuclease-S-peptide (1-19 N-terminal fragment of Ribonuclease A) has been carried out in H2O, pH 3.0, in the temperature range 1-31 degrees, and ionic strength 0-1 M. Individual assignments of all NH amide signals have been achieved by means of extensive double resonance experiments. The folding of S-peptide at low temperature has been monitored by examination of the several NH resonance parameters: first, the nonlinearity of chemical shift vs. temperature plots; second, the selective broadening observed for signals assigned to residues 3-13; and third, the decrease of 3JHNCH coupling constants belonging to this region of the polypeptide chain. All these results are in agreement with the formation of a folded structure at low temperature, which is similar to the one found for the S-peptide in the RNase S crystal.     

N.m.r. and c.d. studies of the DNA fragments d(TATATATA) and d(TATATA) in solution

DNA fragments d(TATATATA) and d(TATATA) were studied in low-salt aqueous solutions and found to coexist in more than one conformer. 1H-n.m.r. demonstrates that single-stranded and double-stranded states are involved in the conformational coexistence. Circular dichroism spectroscopy indicates a global B-DNA stacking of bases in the fragments. 31P-n.m.r. resonances of the TpA and ApT phosphodiester bonds are substantially separated in the spectra of both d(TATATATA) and d(TATATA) duplexes to suggest an alternating architecture of their backbones. In fact, the oligonucleotide duplexes are much more alternating than the corresponding polynucleotide under the same solution conditions. The alternating character of the d(TATATATA) double helix is further enhanced in molar caesium fluoride solutions. The oligonucleotide isomerization into X-DNA is, however, accompanied by gel formation, which makes high resolution n.m.r. measurements impossible.     

Conformational study of a somatostatin analogue by high-field n.m.r. spectroscopy, in aqueous solution

The cyclic analogue of somatostatin (SRIF), D-Phe-Cys-Tyr-D-Trp-Lys-Thr-Cys-Thr-NH2 (CTC), exhibits good affinity for both opioid and SRIF receptor systems. Its conformational properties were examined in water by high-field proton n.m.r. spectroscopy and compared with results previously obtained with structurally related analogues SMS 201-995 and Sandoz 204-090 in the same solvent. The assignments were made using 2 D-n.m.r. methods, especially long-range connectivities between neighbouring alpha protons, and between beta and aromatic protons. The 3JNH-C alpha H and delta delta/delta T values are compatible with an equilibrium between two gamma turns involving residues 2, 3 and 4 and residues 3, 4, and 5, respectively.     

Calcium and praseodymium complexes in solution. 1H n.m.r. conformational study of the model tetrapeptide acetyl-aspartyl-valyl-aspartyl-alanine

The synthetic tetrapeptide acetyl-aspartyl-valyl-aspartyl-alanine (Ac-DVDA) is a model of the calcium binding site of proteins such as carp parvalbumin, thermolysin and calmodulin. 1H n.m.r. spectra of the tetrapeptide are presented and assigned for D2O and DMSO solutions to determine the conformational mobility. The resonance of the two aspartyl side chains could be completely analysed and the vicinal coupling (C alpha H-C beta H and NH-C alpha H) indicated that the free peptide has considerable conformational mobility. The Ca(II) complex generates a different 1H n.m.r. spectrum for the aspartyl resonances at neutral pH. The solution conformation of Pr(III) complex of Ac-DVDA has been investigated using induced chemical shifts. The observed trends in the magnitude of the shift ratios and the rotamer population suggest that the metal ion binds predominantly to both carboxylates of two aspartyl residues in a bidentate fashion. We discuss the consistency of the differentiated spectra for aspartyl residues in the complex with the stepwise binding of Ca2+ to the carrier.     

N.m.r. studies of the structures and bonding of some cobalt(II) and nickel(II) complexes of carboxylic acids

Some octahedral complexes of types ML₄T₂ and ML₂T₂, where M = Co^II, Ni^II, L = γ-picoline and T = C₂F₅CO₂, C₃F₇CO₂ and CHCl₂CO₂, have been studied by ¹H and ¹⁹F n.m.r. spectroscopy. The complexes exist in solution in both cis and trans isomeric forms, interconversion of the two forms being slow at ambient temperature in the case of the Ni^II complexes. The appreciable isomeric distinction shown in the ¹⁹F spectra of the acid ligands in contrast to the ¹H spectra of the γ-picoline ligands is attributed to a sizeable π-contact interaction of the acid ligands, particularly when they act as bidentate ligands.     

Formation and structure of Cu(II)-poly(L-lysine) complexes in aqueous solution.

Cu(II)-poly(L-lysine) complexes have been studied using potentiometric titrations, optical absorption and circular dichroism spectra. As in the Cu(II)-poly(L-arginine) system studied previously potentiometric and spectral data consistently show that two types of complexes are formed. The first formed below pH 7.6 contains two amine nitrogens and two oxygen from water molecules at the corners of a square in which the metal occupies the center. The second is obtained at pH above 7.6 when the oxygen atoms are replaced by two adjacent peptide nitrogens.     

Mercury(II) complex formation with glutathione in alkaline aqueous solution

The structure and speciation of the complexes formed between mercury(II) ions and glutathione (GSH = L-glutamyl-L-cysteinyl-glycine) have been studied for a series of alkaline aqueous solutions (\( C_{{{\text{Hg}}^{{2 + }}}}\,{\sim18\,{\rm{mmol}}\,{\rm{{dm^{-3}}}}}\) and C _GSH = 40–200 mmol dm^?3 at pH ～10.5) by means of extended X-ray absorption fine structure (EXAFS) and ¹⁹⁹Hg NMR spectroscopy at ambient temperature. The dominant complexes are [Hg(GS)₂]^4? and [Hg(GS)₃]^7?, with mean Hg–S bond distances of 2.32(1) and 2.42(2) Å observed in digonal and trigonal Hg–S coordination, respectively. The proportions of the Hg²⁺–glutathione complexes were evaluated by fitting linear combinations of model EXAFS oscillations representing each species to the experimental EXAFS spectra. The [Hg(GS)₄]^10? complex, with four sulfur atoms coordinated at a mean Hg–S bond distance of 2.52(2) Å, is present in minor amounts (<30%) in solutions containing a large excess of glutathione (C _GSH ≥ 160 mmol dm^?3). Comparable alkaline mercury(II) cysteine (H₂Cys) solutions were also investigated and a reduced tendency to form higher complexes was observed, because the deprotonated amino group of Cys^2? allows the stable [Hg(S,N-Cys)₂]^2? chelate to form. The effect of temperature on the distribution of the Hg²⁺–glutathione complexes was studied by comparing the EXAFS spectra at ambient temperature and at 25 K of a series of glycerol/water (33/67, v/v) frozen glasses with \( C_{{{\text{Hg}}^{{2 + }} }} \,{\sim7\,{\rm{mmol}}\,{\rm{{dm^{-3}}}}} \) and C _GSH = 16–81 mmol dm^?3. Complexes with high Hg–S coordination numbers, [Hg(GS)₃]^7? and [Hg(GS)₄]^10?, became strongly favored when just a moderate excess of glutathione (C _GSH ≥28 mmol dm^?3) was used in the glassy samples, as expected for a stepwise exothermic bond formation. Addition of glycerol had no effect on the Hg(II)–glutathione speciation, as shown by the similarity of the EXAFS spectra obtained at room temperature for two parallel series of Hg(II)-glutathione solutions with \( C_{{{\text{Hg}}^{{2 + }} }} \,{\sim7\,{\rm{mmol}}\,{\rm{{dm^{-3}}}}},\) with and without 33% glycerol. Also, the ¹⁹⁹Hg NMR chemical shifts of a series of ～18 mmol dm^?3 mercury(II) glutathione solutions with 33% glycerol were not significantly different from those of the corresponding series in aqueous solution.     

Antimony(V) complex formation with adenine nucleosides in aqueous solution

Despite the clinical use of pentavalent antimonial drugs for over half a century, their mode of action against leishmaniasis remains poorly understood. In this paper, we investigated the ability of Sb(V) to form in aqueous solution complexes with adenine nucleosides and deoxynucleosides, using circular dichroism (CD) and (1)H and (13)C NMR spectroscopies. We report that the ribonucleosides, adenosine (A) and adenosine monophosphate (AMP), form in water complexes with Sb(V), as evidenced by the changes induced in their CD spectra. On the other hand, 2'-deoxyadenosine (dA) did not show such a change. CD titration of the ribonucleosides with Sb(V) suggests the formation of 1:2 Sb(V)-nucleoside complexes. NMR analysis indicates that Sb(V) binds to the sugar moiety at the 2' position. Furthermore, the incubation of the antimonial drug, meglumine antimonate, with adenosine at 37 degrees C led to the transfer of Sb(V) from its original ligand to the nucleoside molecule, at acidic pH (pH 5), but not at neutral pH (7.2). Our data therefore suggests that the formation of such complexes may take place in vivo within the acidic cell compartments, including the phagolysosome of macrophage in which Leishmania resides.     

Thermodynamics of inclusion complexes of natural and modified cyclodextrins with propranolol in aqueous solution at 298 K

The association constant, standard Gibbs energy, enthalpy and entropy for formation of inclusion complexes of propranolol, a beta-blocker, with various natural and modified cyclodextrins have been determined by calorimetry at 298 K. Both natural and methyl-modified alpha-cyclodextrins do not form complexes, while beta- and gamma-cyclodextrins do. Complexing ability of 2-hydroxypropyl-beta-cyclodextrin depends on the average substitution degree. For gamma-cyclodextrin, hydrophobic interactions play the major role in binding the guest. The association of natural and modified beta-cyclodextrins is ruled by van der Waals interactions and hydrogen bonding because of the tighter fit of the guest into the cavity. Decreasing pH determines increasingly negative values of the association enthalpies.     

Conformation of reduced glutathione in aqueous solution by 1H and 13C n.m.r

We report on the conformation of reduced glutathione in solutions at low and physiological pH, examined with 1H and 13C n.m.r. spectroscopy. The tripeptide in 1H2O was shown to interconvert rapidly between an array of conformers; in addition, the carbon backbone of the glutamyl was more rigid than anticipated if the residue were freely mobile. This restricted motion results from interaction of the alpha-amino and alpha-carboxyl groups on the glutamyl, with the gamma-Glu-Cys peptide-carbonyl and amino, respectively. Our results support theoretical predictions of the conformation but they are at variance with previous ultraviolet spectroscopic and lower field n.m.r. studies.     

Field focusing n.m.r. (FONAR) and the formation of chemical images in man

The first proposals for n.m.r. scanning in medical diagnosis was made by Damadian (1971a; 1972) and were followed by Lauterbur (1973). Damadian's method of scanning used the principle that the forced precessions of a nuclear magnetization under radio frequency (r.f.) driving field specify the conditions for obtaining spatial resolution of the signal producing domains of a nuclear resonance sample. Sufficient coupling of the nuclear spins to the radiation field to produce a signal detectable by r.f. spectroscopy requires that the stringent Bohr frequency condition, hv = microH0/I, be met. It became possible to construct, with the aid of direct current auxiliary coils, a small volume, called the resonance aperture, inside the applied static field of the magnetic resonance experiment. The correct value of H0 for the applied frequency is restricted to this aperture. The technique (Damadian 1972) was developed to provide a method for non-surgically detecting chemical abnormalities in the diseased organs of patients (Damadian 1971a). The first n.m.r. scans of normal patients and of those with malignant disease are discussed.     

Oxovanadium(IV) complex formation by simple sugars in aqueous solution.

The binding of oxovanadium(IV) to simple sugars in neutral or basic aqueous solution, as studied by EPR and electronic absorption spectroscopy, is reported. The complexation is favored in basic media and involves the coordination of the metal ion to couples of adjacent deprotonated hydroxyls of the sugar molecule. However, only the ligands provided with cis couples can adopt this chelating ligand behavior. The ability of the cis hydroxyl couples to yield chelated complexes has been related to the structural rearrangement (decrease of the O-C-C-O torsion angle in the five-membered chelated ring) needed to permit the oxovanadium(IV) coordination by the sugar molecule.     

N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution.

A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.     

N.m.r. study on conformation of Ac-Thr(alpha-GalNAc)-Ala-Ala-OMe as a model for mucin type glycoprotein

This study report on the results of high resolution 1H n.m.r. investigations on Ac-Thr(alpha-GalNAc)-Ala-Ala-OMe 1 as a mucin type model glycopeptide of antifreeze glycoprotein (AFGP) in both dimethyl sulfoxide (DMSO) and H2O. The temperature dependence of amide proton chemical shifts strongly suggested the presence of the intramolecular hydrogen bond between the amide proton of GalNAc and the carbonyl oxygen of the Thr residues. Due to this bond, the orientation of the sugar residue of 1 appears to be fairly restricted relative to its peptide backbone. Despite the lack of the clear evidence for such intramolecular hydrogen bond in H2O, 1H coupling constant data suggested the structural similarity of 1 in DMSO and H2O, indicating the presence of the intramolecular hydrogen bond even in H2O, which may play an important role in determining the orientation of the sugar moiety with respect to the peptide backbone in glycoprotein.     

1H n.m.r. parameters of the N-terminal 19-residue S-peptide of ribonuclease in aqueous solution

The 1H n.m.r. chemical shifts and the spin-spin coupling constants of the N-terminal 19-residue S-peptide of ribonuclease A have been measured in a 10 mM solution in D2O, pD 3.0, 27 degrees, at 300 MHz. The titration parameters for end groups Lys-1 and Ala-19 and side chains Lys-1, Glu-2, Lys-7, Glu-9, Arg-10, His-12 and Asp-14 have been determined at 90 MHz. An assignment of observed signals to individual residue protons based upon characteristic shifts, spectral analysis, double resonance, titration shifts and comparison with the spectrum of C-peptide (N-terminal 13-residue) is proposed. Differences in the observed chemical shifts, pKa's and titration shifts with reference to those proposed as "random coil" parameters are not large enough to assume the existence of a significant population of secondary structure in the conditions studied. The H alpha chemical shifts differences can be accounted for by the Phe-8 phenyl ring current for an extended peptide backbone conformation and appropriate values for the torsion angles chi 1 Phe-8 and chi 2 Phe-8.