Advances of radiation sterilisation in tissue banking

Under the auspices of the IAEA tissue banking programme on “Radiation Sterilisation of Tissue Graft” conducted from 1985 to 2004, many scientists and surgeons were involved in various regional research and development (R&D) projects mainly in dealing with radiation dose selection, radiation effects on human tissues and quality system in radiation sterilisation. New findings on radiation effects, tissue processing and preservation were shared during the regional and interregional meetings and workshops. Many tissue banks started to use radiation (25 kGy) to sterilize tissue grafts for tissue safety and efficacy and still continue to use it. The IAEA Code of Practice for Radiation Sterilization of Tissues Allografts developed in 2007 offered simpler methods to conduct radiation dose setting and dose validation experiments for tissue grafts. Advances in dose selection and dose mapping are continued under the quality management system when banks need to be certified to continue their operation. The combination of good tissue processing and preservation as well as good radiation practice will ensure the tissue products are properly sterilised thus safe and of high quality. Experience in meeting challenges in using radiation sterilisation and achievements reported by the tissue bankers are shared here.     

What is a category? The case of rough-and-tumble play

The intent of this paper is to outline a process by which we redefined an ambiguous behavioral category, rough-and-tumble play (R&T), using ethological and ethnographic methods (i.e., factor analyses, motivational/functional analyses, and interviews). Results suggest that sociometrically rejected and popular elementary school children have different concepts of R&T. For the former group, R&T and aggression seem to be interrelated and serve similar functions, while for the latter group R&T is a playful, social affiliative category. Interview results suggest that a cognitive processing difference between the groups may be at the root of this difference.     

Recent advances on the GAP promoter derived expression system of <Emphasis Type="Italic">Pichia pastoris</Emphasis>

Pichia pastoris is an efficient host for the expression and secretion of heterologous proteins and the most important feature of P. pastoris is the existence of a strong and tightly regulated promoter from the alcohol oxidase I (AOX1) gene. The AOX1 promoter (pAOX1) has been used to express foreign genes and to produce a variety of recombinant proteins in P. pastoris. However, some efforts have been made to develop new alternative promoters to pAOX1 to avoid the use of methanol. The glyceraldehyde-3-phosphate dehydrogenase promoter (pGAP) has been used for constitutive expression of many heterologous proteins. The pGAP-based expression system is more suitable for large-scale production because the hazard and cost associated with the storage and delivery of large volume of methanol are eliminated. Some important developments and features of this expression system will be summarized in this review. Supported by the National High-tech R&D Program (863 program) (No.2007AA021307).     

Biotechnology for environmentally safe agriculture

Prologue Issue: In Europe some uses of biotechnology are meeting vocal opposition from certain quarters. Nevertheless, the vast amount of knowledge acquired recently in biology can be used to develop and apply biotechnology for environmentally safe agriculture. Public acceptance and a new policy impetus can serve to help the introduction of safe and competitive agricultural technologies that have a minimum environmental impact. Relevance: Increasing long-term health and environmental concerns regarding the use of standard agrochemicals (pesticides and fertilizers) is leading to increased controls and limitations on their use. This underscores the need to explore alternatives, including the use of biotechnology, and to weigh up options in a risk-assessment structure. Reprinted from TERRA (Trans-European Resource for Research and Agriculture) No. 7 & 8 (April & June) 1999; Paul Pechan, Editor, Technical University Munich. Originally published in The IPTS Report No 31, February, 1999; Dimitris Kyriakou, Chief Editor. The IAPTC&B Editors acknowledge, with thanks, the permission granted for the reprinting. For information contact Migul Vega, IPTS-European Commission, W.T.C.-Isla de la Cartuja, 41092 Seville, Spain. E-mail: miguel.vega@jrc.es     

ncRDeathDB: A comprehensive bioinformatics resource for deciphering network organization of the ncRNA-mediated cell death system

Programmed cell death (PCD) is a critical biological process involved in many important processes, and defects in PCD have been linked with numerous human diseases. In recent years, the protein architecture in different PCD subroutines has been explored, but our understanding of the global network organization of the noncoding RNA (ncRNA)-mediated cell death system is limited and ambiguous. Hence, we developed the comprehensive bioinformatics resource (ncRDeathDB, www.rna-society.org/ncrdeathdb) to archive ncRNA-associated cell death interactions. The current version of ncRDeathDB documents a total of more than 4600 ncRNA-mediated PCD entries in 12 species. ncRDeathDB provides a user-friendly interface to query, browse and manipulate these ncRNA-associated cell death interactions. Furthermore, this resource will help to visualize and navigate current knowledge of the noncoding RNA component of cell death and autophagy, to uncover the generic organizing principles of ncRNA-associated cell death systems, and to generate valuable biological hypotheses.     

The impact of the International Atomic Energy Agency (IAEA) program on radiation and tissue banking in Uruguay: development of tissues quality control and quality management system in the National Multi-Tissue Bank of Uruguay

BNOT was created and regulated in 1977 and started its operation in 1978 according to the Decree No. 86/1977. By the Decree 248/005 is transformed in the National Institute of Donation and Transplantation of Cells, Tissues and Organs (Instituto Nacional de Donación y Trasplante de Células, Tejidos y órganos—INDT). The organisation has been operating within the State University Medical School and the Public Health Secretary and it is the governmental organisation responsible for the regulation, policy and management of donation and transplantation in Uruguay. By the Decree 160/2006 is responsible for human cells and tissues regulation too. The participation of the INDT in the IAEA program facilitated the introduction of the radiation sterilisation technique for the first time in the country. The radiation sterilisation of tissues processed by INDT (ex BNOT), was initially carried out in the 60 Cobalt Industrial Plant in the National Atomic Energy Commission of Argentina and now is carried out in INDT, using a Gamma Cell 220 Excel, which was provided by the IAEA through the national project URU/7/005. The results of the implementation of tissues, quality control and quality management system, are showed.     

A low-latency,big database system and browser for storage,querying and visualization of 3D genomic data

Recent releases of genome three-dimensional (3D) structures have the potential to transform our understanding of genomes. Nonetheless, the storage technology and visualization tools need to evolve to offer to the scientific community fast and convenient access to these data. We introduce simultaneously a database system to store and query 3D genomic data (3DBG), and a 3D genome browser to visualize and explore 3D genome structures (3DGB). We benchmark 3DBG against state-of-the-art systems and demonstrate that it is faster than previous solutions, and importantly gracefully scales with the size of data. We also illustrate the usefulness of our 3D genome Web browser to explore human genome structures. The 3D genome browser is available at http://3dgb.cs.mcgill.ca/.     

MendeLIMS: a web-based laboratory information management system for clinical genome sequencing

Background

Large clinical genomics studies using next generation DNA sequencing require the ability to select and track samples from a large population of patients through many experimental steps. With the number of clinical genome sequencing studies increasing, it is critical to maintain adequate laboratory information management systems to manage the thousands of patient samples that are subject to this type of genetic analysis.

Results

To meet the needs of clinical population studies using genome sequencing, we developed a web-based laboratory information management system (LIMS) with a flexible configuration that is adaptable to continuously evolving experimental protocols of next generation DNA sequencing technologies. Our system is referred to as MendeLIMS, is easily implemented with open source tools and is also highly configurable and extensible. MendeLIMS has been invaluable in the management of our clinical genome sequencing studies.

Conclusions

We maintain a publicly available demonstration version of the application for evaluation purposes at http://mendelims.stanford.edu. MendeLIMS is programmed in Ruby on Rails (RoR) and accesses data stored in SQL-compliant relational databases. Software is freely available for non-commercial use at http://dna-discovery.stanford.edu/software/mendelims/.

Electronic supplementary material

The online version of this article (doi:10.1186/1471-2105-15-290) contains supplementary material, which is available to authorized users.     

Highly Accurate Structure-Based Prediction of HIV-1 Coreceptor Usage Suggests Intermolecular Interactions Driving Tropism

HIV-1 entry into host cells is mediated by interactions between the V3-loop of viral glycoprotein gp120 and chemokine receptor CCR5 or CXCR4, collectively known as HIV-1 coreceptors. Accurate genotypic prediction of coreceptor usage is of significant clinical interest and determination of the factors driving tropism has been the focus of extensive study. We have developed a method based on nonlinear support vector machines to elucidate the interacting residue pairs driving coreceptor usage and provide highly accurate coreceptor usage predictions. Our models utilize centroid-centroid interaction energies from computationally derived structures of the V3-loop:coreceptor complexes as primary features, while additional features based on established rules regarding V3-loop sequences are also investigated. We tested our method on 2455 V3-loop sequences of various lengths and subtypes, and produce a median area under the receiver operator curve of 0.977 based on 500 runs of 10-fold cross validation. Our study is the first to elucidate a small set of specific interacting residue pairs between the V3-loop and coreceptors capable of predicting coreceptor usage with high accuracy across major HIV-1 subtypes. The developed method has been implemented as a web tool named CRUSH, CoReceptor USage prediction for HIV-1, which is available at http://ares.tamu.edu/CRUSH/.     

Identification and classification of antiviral defence systems in bacteria and archaea with PADLOC reveals new system types

To provide protection against viral infection and limit the uptake of mobile genetic elements, bacteria and archaea have evolved many diverse defence systems. The discovery and application of CRISPR-Cas adaptive immune systems has spurred recent interest in the identification and classification of new types of defence systems. Many new defence systems have recently been reported but there is a lack of accessible tools available to identify homologs of these systems in different genomes. Here, we report the Prokaryotic Antiviral Defence LOCator (PADLOC), a flexible and scalable open-source tool for defence system identification. With PADLOC, defence system genes are identified using HMM-based homologue searches, followed by validation of system completeness using gene presence/absence and synteny criteria specified by customisable system classifications. We show that PADLOC identifies defence systems with high accuracy and sensitivity. Our modular approach to organising the HMMs and system classifications allows additional defence systems to be easily integrated into the PADLOC database. To demonstrate application of PADLOC to biological questions, we used PADLOC to identify six new subtypes of known defence systems and a putative novel defence system comprised of a helicase, methylase and ATPase. PADLOC is available as a standalone package (https://github.com/padlocbio/padloc) and as a webserver (https://padloc.otago.ac.nz).     

dbVOR: a database system for importing pedigree,phenotype and genotype data and exporting selected subsets

Background

When studying the genetics of a human trait, we typically have to manage both genome-wide and targeted genotype data. There can be overlap of both people and markers from different genotyping experiments; the overlap can introduce several kinds of problems. Most times the overlapping genotypes are the same, but sometimes they are different. Occasionally, the lab will return genotypes using a different allele labeling scheme (for example 1/2 vs A/C). Sometimes, the genotype for a person/marker index is unreliable or missing. Further, over time some markers are merged and bad samples are re-run under a different sample name. We need a consistent picture of the subset of data we have chosen to work with even though there might possibly be conflicting measurements from multiple data sources.

Results

We have developed the dbVOR database, which is designed to hold data efficiently for both genome-wide and targeted experiments. The data are indexed for fast retrieval by person and marker. In addition, we store pedigree and phenotype data for our subjects. The dbVOR database allows us to select subsets of the data by several different criteria and to merge their results into a coherent and consistent whole. Data may be filtered by: family, person, trait value, markers, chromosomes, and chromosome ranges. The results can be presented in columnar, Mega2, or PLINK format.

Conclusions

dbVOR serves our needs well. It is freely available from https://watson.hgen.pitt.edu/register. Documentation for dbVOR can be found at https://watson.hgen.pitt.edu/register/docs/dbvor.html.

Electronic supplementary material

The online version of this article (doi:10.1186/s12859-015-0505-4) contains supplementary material, which is available to authorized users.     

An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea

Reference phylogenies are crucial for providing a taxonomic framework for interpretation of marker gene and metagenomic surveys, which continue to reveal novel species at a remarkable rate. Greengenes is a dedicated full-length 16S rRNA gene database that provides users with a curated taxonomy based on de novo tree inference. We developed a ‘taxonomy to tree'' approach for transferring group names from an existing taxonomy to a tree topology, and used it to apply the Greengenes, National Center for Biotechnology Information (NCBI) and cyanoDB (Cyanobacteria only) taxonomies to a de novo tree comprising 408 315 sequences. We also incorporated explicit rank information provided by the NCBI taxonomy to group names (by prefixing rank designations) for better user orientation and classification consistency. The resulting merged taxonomy improved the classification of 75% of the sequences by one or more ranks relative to the original NCBI taxonomy with the most pronounced improvements occurring in under-classified environmental sequences. We also assessed candidate phyla (divisions) currently defined by NCBI and present recommendations for consolidation of 34 redundantly named groups. All intermediate results from the pipeline, which includes tree inference, jackknifing and transfer of a donor taxonomy to a recipient tree (tax2tree) are available for download. The improved Greengenes taxonomy should provide important infrastructure for a wide range of megasequencing projects studying ecosystems on scales ranging from our own bodies (the Human Microbiome Project) to the entire planet (the Earth Microbiome Project). The implementation of the software can be obtained from http://sourceforge.net/projects/tax2tree/.     

Investigating microRNA-Target Interaction-Supported Tissues in Human Cancer Tissues Based on miRNA and Target Gene Expression Profiling

Recent studies have revealed that a small non-coding RNA, microRNA (miRNA) down-regulates its mRNA targets. This effect is regarded as an important role in various biological processes. Many studies have been devoted to predicting miRNA-target interactions. These studies indicate that the interactions may only be functional in some specific tissues, which depend on the characteristics of an miRNA. No systematic methods have been established in the literature to investigate the correlation between miRNA-target interactions and tissue specificity through microarray data. In this study, we propose a method to investigate miRNA-target interaction-supported tissues, which is based on experimentally validated miRNA-target interactions. The tissue specificity results by our method are in accordance with the experimental results in the literature.

Availability and Implementation

Our analysis results are available at http://tsmti.mbc.nctu.edu.tw/ and http://www.stat.nctu.edu.tw/hwang/tsmti.html.     

Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides

Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.     

Immunogenicity of Novel Mumps Vaccine Candidates Generated by Genetic Modification

Mumps is a highly contagious human disease, characterized by lateral or bilateral nonsuppurative swelling of the parotid glands and neurological complications that can result in aseptic meningitis or encephalitis. A mumps vaccination program implemented since the 1960s reduced mumps incidence by more than 99% and kept the mumps case numbers as low as hundreds of cases per year in the United States before 2006. However, a large mumps outbreak occurred in vaccinated populations in 2006 and again in 2009 in the United States, raising concerns about the efficacy of the vaccination program. Previously, we have shown that clinical isolate-based recombinant mumps viruses lacking expression of either the V protein (rMuVΔV) or the SH protein (rMuVΔSH) are attenuated in a neurovirulence test using newborn rat brains (P. Xu et al., Virology 417:126–136, 2011, http://dx.doi.org/10.1016/j.virol.2011.05.003; P. Xu et al., J. Virol. 86:1768–1776, 2012, http://dx.doi.org/10.1128/JVI.06019-11) and may be good candidates for vaccine development. In this study, we examined immunity induced by rMuVΔSH and rMuVΔV in mice. Furthermore, we generated recombinant mumps viruses lacking expression of both the V protein and the SH protein (rMuVΔSHΔV). Analysis of rMuVΔSHΔV indicated that it was stable in tissue culture cell lines. Importantly, rMuVΔSHΔV was immunogenic in mice, indicating that it is a promising candidate for mumps vaccine development.