Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.     

A 1.4-Mb High-Resolution Physical Map and Contig of Chromosome Segment 11p15.5 and Genes in the LOH11A Metastasis Suppressor Region

The centromeric part of chromosome segment 11p15.5 contains a region of frequent allele loss in many adult solid malignancies. This region, called LOH11A, is lost in 75% of lung cancers and is thought to contain a gene that may function as a metastasis suppressor. Genetic complementation studies have shown suppression of the malignant phenotype including reduction of metastasis formation. We constructed a high-resolution physical map and contig over 1.4 Mb that includes the β-hemoglobin gene cluster and the gene for the large subunit of ribonucleotide reductase (RRM1). Through sequencing and computerized analysis, we determined that this region contains an unusually large number of transposable elements, which suggests that double-stranded DNA breaks occur frequently here. Twenty-two putative genes were identified. Because of its location at the site of maximal allele loss in the 650-kb LOH11A region and previous functional studies, RRM1 is the most likely candidate gene with metastasis suppressor function. The malignant phenotype, in this case, results from a relative loss of function rather than a complete loss.     

Refined physical mapping and genomic structure of the EXTL1 gene

Recently, the EXTL1 gene, a member of the EXT tumor suppressor gene family, has been mapped to 1p36, a chromosome region which is frequently implicated in a wide variety of malignancies, including breast carcinoma, colorectal cancer and neuroblastoma. In this study, we show that the EXTL1 gene is located between the genetic markers D1S511 and D1S234 within 200 kb of the LAP18 gene on chromosome 1p36. 1, a region which has been proposed to harbor a tumor suppressor gene implicated in MYCN-amplified neuroblastomas. In addition, we determined the genomic structure of the EXTL1 gene, revealing that the EXTL1 coding sequence spans 11 exons within a 50-kb region.     

Cloning a calcium channel alpha2delta-3 subunit gene from a putative tumor suppressor gene region at chromosome 3p21.1 in conventional renal cell carcinoma

We have identified loss of heterozygosity (LOH) of approx. 1 cM region around locus D3S1289 at chromosome 3p21.1 in a conventional renal cell carcinoma (RCC). During construction of a YAC/BAC contig for this region and shotgun sequencing of BACs 277p5, 55m24 and 428i24, we detected four new microsatellites. We narrowed down the target region by analysing these new loci to less than 100 kb within the BAC 55m24 and subsequently cloned a human calcium channel alpha2delta-3 subunit gene. This gene is widely expressed in fetal tissues and different types of adult tumors. The exons of the alpha2delta-3 subunit gene are distributed along approx. 500 kb DNA sequences. As the LOH involved exclusively intronic sequences and sequencing the entire coding region did not reveal any mutation, the alpha2delta-3 subunit gene is probably not a tumor suppressor gene.     

Inactivation of both alleles of the DPC4/SMAD4 gene in advanced colorectal cancers: identification of seven novel somatic mutations in tumors from Japanese patients.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4/SMAD4 gene, lying in close proximity to the DCC gene at 18q21.1, was recently identified as a candidate tumor suppressor for the genesis of pancreatic cancer as well as a predisposing gene for Juvenile Polyposis Syndrome (JPS). The gene product functions as a cytoplasmic mediator in the signaling pathway of transforming growth factor beta (TGF-beta). To investigate the potential role of DPC4/SMAD4 gene in colorectal cancers, we examined 73 tumors of clinical stages II or III from Japanese patients, for LOH at 18q21 and also for subtle mutations anywhere within the coding region of DPC4/SMAD4. LOH was identified in 50 (78%) of the 64 tumors that were informative for polymorphic markers in the region. Somatic mutations were identified in seven of those tumors: two frameshift mutations, a 1-bp deletion (326 del T) in exon 8 and a 1-bp insertion (50-51 ins A) in exon 1; two nonsense mutations, Arg445Ter in exon 10 and Glu538Ter in exon 11; and three missense mutations, Asn129Lys in exon 2, Tyr95Asn in exon 2, and Asp355Glu in exon 8. Three of the seven mutations were observed in the mad homology 1 (MH1) domain encoded by exons 1 and 2. In all of the tumors carrying intragenic mutations of one allele, LOH analysis had shown that the other allele was missing. The results demonstrated that inactivation of both alleles of the DPC4/SMAD4 gene occurs in a substantial proportion of advanced colorectal cancers, and that the DPC4/SMAD4 gene probably exerts a tumor-suppressor effect for colorectal carcinogenesis that fulfills the criterion of the two-hit concept proposed by Knudson [A.G. Knudson, Hereditary cancer, oncogenes, and anti-oncogenes, Cancer Res. 45 (1985) 1437-1443.].     

Loss of heterozygosity on chromosome 11 in sporadic gastrinomas

Summary Gastrinomas are pancreatic endocrine neoplasms that arise either sporadically or are inherited as part of the multiple endocrine neoplasia type I syndrome (MEN I). Loss of heterozygosity (LOH) in the region flanking the MEN I gene at chromosome 11q13 has been documented in a few sporadic and familial pancreatic endocrine tumors, but not previously in sporadic gastrinomas. It has therefore been suggested that gastrinomas develop by a mechanism different from other tumors associated with the MENI syndsrome. We report LOH on chromosome 11 in 5 of 11 sporadic gastrinomas. Four of these tumors have LOH for markers flanking the MEN I region. Molecular evaluation of segments of chromosomes 3, 13, and 17 known to contain cloned or putative tumor suppressor genes fail to show LOH except at one locus in one tumor. These data suggest that a tumor suppressor DNA segment exists at 11q13 that may be involved in the development of sporadic gastrinomas.     

A new hereditary cylindromatosis family associated with CYLD1 on chromosome 16

Hereditary cylindromatosis (HC; MIM 132700) is an autosomal dominant condition characterized by benign skin appendage tumors most commonly on the scalp and face. Previously, the HC gene (CYLD1) was linked to chromosome 16q12–13, and tumors showed loss of heterozygosity (LOH), suggesting that CYLD1 is a tumor suppressor gene. Here we report a new multi-generation cylindromatosis family whose condition maps to that region, with 7/13 tumors showing LOH on 16q. Electronic Publication     

Infrequent but significant p21/WAF1/CIP1 gene alteration in synchronous or metachronous transitional cell carcinoma

p53 inducible cyclin dependent kinase inhibitor, p21/WAF1/CIP1(p21), played a pivotal role for G1 arrest when cells received genotoxic stimuli. p21 could be a putative tumor suppressor gene, since its dysfunction may lead to accumulation of genomic alteration. We investigated the p21 and p53 status using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and immunohistochemical analyses, in eight patients who had synchronous or metachronous urothelial tumors. Loss of heterozygosity (LOH) of p21 gene was detected in one coincidental tumor in one case. p21 positive cells were detected by immuno-histochemical staining in all tumors in one case, and in one coincidental tumor in two cases. Among p21 positive cells in these three cases, no p53 mutations were detected, whereas no p21 positive cells were detected in other cases with a p53 mutation. These findings suggested that in transitional cell carcinoma (TCC) p21 gene mutation is infrequent like the p53 gene mutation, but that LOH might be important in the inactivation of p21.     

Loss-of-heterozygosity analysis of small-cell lung carcinomas using single-nucleotide polymorphism arrays

Human cancers arise by a combination of discrete mutations and chromosomal alterations. Loss of heterozygosity (LOH) of chromosomal regions bearing mutated tumor suppressor genes is a key event in the evolution of epithelial and mesenchymal tumors. Global patterns of LOH can be understood through allelotyping of tumors with polymorphic genetic markers. Simple sequence length polymorphisms (SSLPs, or microsatellites) are reliable genetic markers for studying LOH, but only a modest number of SSLPs are used in LOH studies because the genotyping procedure is rather tedious. Here, we report the use of a highly parallel approach to genotype large numbers of single-nucleotide polymorphisms (SNPs) for LOH, in which samples are genotyped for nearly 1,500 loci by performing 24 polymerase chain reactions (PCR), pooling the resulting amplification products and hybridizing the mixture to a high-density oligonucleotide array. We characterize the results of LOH analyses on human small-cell lung cancer (SCLC) and control DNA samples by hybridization. We show that the patterns of LOH are consistent with those obtained by analysis with both SSLPs and comparative genomic hybridization (CGH), whereas amplifications rarely are detected by the SNP array. The results validate the use of SNP array hybridization for tumor studies.     

Radiation-associated loss of heterozygosity at the Znfn1a1 (Ikaros) locus on chromosome 11 in murine thymic lymphomas

Although information on the molecular pathways in radiation carcinogenesis is accumulating, the data are still relatively scanty. To find the tumor suppressor locus associated with radiation carcinogenesis, we determined the frequency and distribution of loss of heterozygosity (LOH) of X-ray-induced thymic lymphomas of B6C3F(1) mice using 58 microsatellite markers and compared the results with those for spontaneous lymphomas and N-ethylnitrosourea (ENU)-induced lymphomas. Based on the results, we describe a unique locus with frequent LOH in the centromeric region of chromosome 11 of X-ray-induced lymphomas. This locus has never been observed to be altered similarly in either ENU-induced or spontaneous lymphomas, suggesting radiation-specific molecular alteration. The LOH patterns of individual thymic lymphomas indicated that the common region of LOH was located within 1.6 cM between D11Mit62 and D11Mit204, a region syntenic to human chromosome 7p13. Linkage analysis revealed that the markers of the common LOH region were genetically linked to Ikaros (now known as Znfn1a1), a master gene of lymphopoiesis. Although the presence of radiation-associated LOH in other loci cannot be ruled out, these results suggest a novel molecular pathway in induction of thymic lymphomas by ionizing radiation.     

Differential loss of heterozygosity in familial, sporadic, and uremic hyperparathyroidism

Various genetic loci harboring oncogenes, tumor suppressor genes, and genes for calcium receptors have been implicated in the development of parathyroid tumors. We have carried out loss of heterozygosity (LOH) studies in chromosomes 1p, 1q, 3q, 6q, 11q, 13q, 15q, and X in a total of 89 benign parathyroid tumors. Of these, 28 were sporadic parathyroid adenomas from patients with no family history of the disease, 41 were secondary parathyroid tumors, 5 were from patients with a history of previous irradiation to the neck, 12 were from patients with a family history of hyperparathyroidism, and 3 were parathyroid tumors related to multiple endocrine neoplasia type 1 (MEN1). In addition, we determined the chromosomal localization of a second putative calcium-sensing receptor, CaS, for inclusion in the LOH studies. Based on analysis of somatic cell hybrids and fluorescent in situ hybridization to metaphase chromsomes, the gene for CaS was mapped to chromosomal region 2q21-q22. The following results were obtained from the LOH studies: (1) out of the 24 tumors that showed LOH, only 4 had more than one chromosomal region involved, (2) in the tumours from uremic patients, LOH of chromosome 3q was detected in a subset of the tumors, (3) LOH of the MEN1 region at 11q13 was the most common abnormality found in both MEN1-related and sporadic parathyroid tumours but was not a feature of the other forms of parathyroid tumors, (4) LOH in 1p and 6q was not as frequent as previously reported, and (5) tumor suppressor genes in 1q and X might have played a role, particularly on the X chromosome, in the case of familial parathyroid adenomas. We therefore conclude that the tumorigenesis of familial, sporadic, and uremic hyperparathyroidism involves different genetic triggers in a non-progressive pattern. Received: 28 October 1996 / Revised: 16 November 1996     

PCR-based RFLP analysis allows genotyping of the short arm of chromosome 3 in small biopsies from patients with lung cancer.

The tumors of patients with lung cancers often show loss of heterozygosity (LOH) at polymorphic loci on the short arm of chromosome 3. Most examples of small-cell lung carcinoma (SCLC) cannot be examined since they are infrequently resected. Small biopsies are, however, usually available from patients with this disease. We have used the polymerase chain reaction (PCR) to study lung tumor biopsies obtained by fiberoptic bronchoscopy and assign the genotype at 11 RFLPs in 7 well-established loci on 3p. We have demonstrated LOH in some and found that biopsy samples need to contain approximately 60% content of tumor cells if LOH is to be reliably detected. One SCLC tumor that we examined has an interstitial 3p deletion proximal to the locus D3F15S2 and thus provides information useful in mapping the position of the tumor suppressor gene on 3p.