Carcinogen-nucleic acid interactions: equilibrium binding studies of aflatoxins B1 and B2 with DNA and the oligodeoxynucleotide d(ATGCAT)2

Equilibrium binding is believed to play an important role in directing the subsequent covalent attachment of many carcinogens to DNA. We have utilized UV spectroscopy to examine the non-covalent interactions of aflatoxin B1 and B2 with calf thymus DNA, poly(dAdT):poly(dAdT), and poly(dGdC):poly(dGdC), and have utilized NMR spectroscopy to examine non-covalent interactions of aflatoxin B2 with the oligodeoxynucleotide d(ATGCAT)2. UV-VIS binding isotherms suggest a greater binding affinity for calf thymus DNA and poly(dAdT):poly(dAdT) than for poly(dGdC):poly(dGdC). Scatchard analysis of aflatoxin B1 binding to calf thymus DNA in 0.1 M NaCl buffer indicates that binding of the carcinogen at levels of bound aflatoxin less than 1 carcinogen per 200 base pairs occurs with positive cooperativity. The cooperative binding effect is dependent on the ionic strength of the medium; when the NaCl concentration is reduced to 0.01 M, positive cooperativity is observed at carcinogen levels less than 1 carcinogen per 500 base pairs. The Scatchard data may be fit using a "two-site" binding model [L.S. Rosenberg, M.J. Carvlin, and T.R. Krugh, Biochemistry 25, 1002-1008 (1986)]. This model assumes two independent sets of binding sites on the DNA lattice, one a high affinity site which binds the carcinogen with positive cooperativity, the second consisting of lower affinity binding sites to which non-specific binding occurs. NMR analysis of aflatoxin B2 binding to d(ATGCAT)2 indicates that the aflatoxin B2/oligodeoxynucleotide complex is in fast exchange on the NMR time scale. Upfield chemical shifts of 0.1-0.5 ppm are observed for the aflatoxin B2 4-OCH3, H5, and H6a protons. Much smaller chemical shift changes (less than or equal to 0.06 ppm) are observed for the oligodeoxynucleotide protons. The greatest effect for the oligodeoxynucleotide protons is observed for the adenine H2 protons, located in the minor groove. Nonselective T1 experiments demonstrate a 15-25% decrease in the relaxation time for the adenine H2 protons when aflatoxin B2 is added to the solution. This result suggests that aflatoxin B2 protons in the bound state may be in close proximity to these protons, providing a source of dipolar relaxation. Further experiments are in progress to probe the nature of the aflatoxin B1 and B2 complexes with polymeric DNA and oligodeoxynucleotides, and to establish the relationship between the non-covalent DNA-carcinogen complexes observed in these experiments, and covalent aflatoxin B1-guanine N7 DNA adducts.     

Carcinogen-nucleic acid interactions: equilibrium binding studies of aflatoxin B1 with the oligodeoxynucleotide d(ATGCAT)2 and with plasmid pBR322 support intercalative association with the B-DNA helix

Equilibrium binding of aflatoxin B1 (AFB1) to the oligodeoxynucleotide d(ATGCAT)2 was examined by using 1H NMR. AFB1 binds to double-stranded d(ATGCAT)2 with an apparent binding constant of 3.7 x 10(3) M-1. The equilibrium is rapid on the NMR time scale; the observed 1H NMR spectrum represents the population-weighted average of the chemical shifts arising from the free and bound states of the oligodeoxynucleotide and the AFB1. The spectrum of d(ATGCAT)2 exhibits exchange broadening in the presence of AFB1, manifested as decreases in apparent T2 relaxation times for the d(ATGCAT)2 base protons. Upon binding to d(ATGCAT)2, the AFB1 signals are shifted upfield, indicative of increased shielding. The adenine H2 protons are also shifted upfield in the presence of the carcinogen. Small changes in chemical shift are observed for other d(ATGCAT)2 protons. A substantial decrease in the nonselective T1 relaxation time is observed for the adenine H2 protons in the presence of AFB1. Competition binding experiments in which the competing ligands actinomycin D, ethidium bromide, and spermidine were individually added to an AFB1-d(ATGCAT)2 equilibrium mixture showed that addition of 1 equiv of actinomycin D or 4 equiv of ethidium bromide was sufficient to displace bound AFB1 from d(ATGCAT)2. In contrast, the addition of spermidine did not result in the displacement of bound AFB1 molecules and may have slightly enhanced binding, presumably due to stabilization of the DNA duplex. 1H NOESY experiments confirmed that the overall conformation for the d(ATGCAT)2 duplex was right-handed both in the absence and in the presence of AFB1. Equilibrium binding of AFB1 to d(ATGCAT)2 is greatly diminished at higher temperatures at which the oligodeoxynucleotide is single-stranded.(ABSTRACT TRUNCATED AT 250 WORDS)     

Thermal stabilization of the DNA duplex by adducts of aflatoxin B1

The trans-8,9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B(1) cationic guanine N7 adduct of aflatoxin B(1) thermally stabilizes the DNA duplex, as reflected in increased T(m) values upon adduction. The magnitude of the increased T(m) value is characteristically 2-3 degrees C. The major rotamer of the neutral guanine N7 adduct trans-8,9-dihydro-8-(2,6-diamino-4-oxo-3,4-dihydropyrimid-5-yl-formamido)-9-hydroxy aflatoxin B(1) (the FAPY major adduct) exhibits a 15 degrees C increase in T(m) in 5'-d(CTAT(FAPY)GATTCA)-3'-5'-d(TGAATCATAG)-3'. Site-specific mutagenesis experiments reveal the FAPY major adduct induces G-->T mutations in Escherichia coli at a frequency six times higher than that of the cationic adduct (Smela, M. E.; Hamm, M. L.; Henderson, P. T.; Harris, C. M.; Harris, T. M.; Essigmann, J. M. Proc Natl Acad Sci USA, 99, 6655-6660). Thus, the FAPY major lesion may account substantially for the genotoxicity of AFB(1). Structural studies for cationic and FAPY adducts of aflatoxin B(1) suggest both adducts intercalate above the 5'-face of the modified deoxyguanosine and that in each instance the aflatoxin moiety spans the DNA helix. Intercalation of the aflatoxin moiety, accompanied by favorable stacking with the neighboring base pairs, is thought to account for the increased thermal stability of the aflatoxin cationic guanine N7 and the FAPY major adducts. However, the structural basis for the large increase in thermal stability of the FAPY major adduct in comparison to the cationic guanine N7 adduct of aflatoxin B(1) is not well understood. In light of the site-specific mutagenesis studies, it is of considerable interest. For both adducts, the intercalation structures are similar, although improved stacking with neighboring base pairs is observed for the FAPY major adduct. In addition, the presence of the formamido group in the aflatoxin B(1) FAPY major adduct may enhance duplex stability, perhaps via intrastrand sequence-specific hydrogen bonding interactions within the duplex.     

Carcinogen-Nucleic Acid Interactions: Equilibrium Binding Studies of Aflatoxins B1 and B2 with DNA and the Oligodeoxynucleotide d(ATGCAT)2

Abstract

Equilibrium binding is believed to play an important role in directing the subsequent covalent attachment of many carcinogens to DNA. We have utilized UV spectroscopy to examine the non-covalent interactions of aflatoxin B₁ and B₂ with calf thymus DNA, poly(dAdT):poly(dAdT), and poly(dGdC):poly(dGdC), and have utilized NMR spectroscopy to examine non-covalent interactions of aflatoxin B₂ with the oligodeoxynucleotide d(ATGCAT)₂. UV-VIS binding isotherms suggest a greater binding affinity for calf thymus DNA and poly(dAdT):poly(dAdT) than for poly(dGdC):poly(dGdC). Scatchard analysis of aflatoxin B₁ binding to calf thymus DNA in 0.1 M NaCl buffer indicates that binding of the carcinogen at levels of bound aflatoxin ? 1 carcinogen per 200 base pairs occurs with positive cooperativity. The cooperative binding effect is dependent on the ionic strength of the medium; when the NaCl concentration is reduced to 0.01 M, positive cooperativity is observed at carcinogen levels ? 1 carcinogen per 500 base pairs. The Scatchard data may be fit using a “two-site” binding model [L.S. Rosenberg, M J. Carvlin, and T.R. Krugh, Biochemistry 25, 1002–1008 (1986)]. This model assumes two independent sets of binding sites on the DNA lattice, one a high affinity site which binds the carcinogen with positive cooperativity, the second consisting of lower affinity binding sites to which non-specific binding occurs. NMR analysis of aflatoxin B₂ binding to d(ATGCAT)₂ indicates that the aflatoxin B₂/oligodeoxynucleotide complex is in fast exchange on the NMR time scale. Upfield chemical shifts of 0.1–0.5 ppm are observed for the aflatoxin B₂ 4-OCH₃, H5, and H6a protons. Much smaller chemical shift changes ? 0.06 ppm) are observed for the oligodeoxynucleotide protons. The greatest effect for the oligodeoxynucleotide protons is observed for the adenine H2 protons, located in the minor groove. Nonselective T₁ experiments demonstrate a 15–25 % decrease in the relaxation time for the adenine H2 protons when aflatoxin B₂ is added to the solution. This result suggests that aflatoxin B₂ protons in the bound state may be in close proximity to these protons, providing a source of dipolar relaxation. Further experiments are in progress to probe the nature of the aflatoxin B₁ and B₂ complexes with polymeric DNA and oligodeoxynucleotides, and to establish the relationship between the non-covalent DNA-carcinogen complexes observed in these experiments, and covalent aflatoxin B₁,-guanine N7 DNA adducts.     

Two-dimensional NMR studies on the anthramycin-d(ATGCAT)2 adduct

Two-dimensional NMR experiments were performed on the adduct of anthramycin with d(ATGCAT)2 to obtain the assignments of the nucleotide base and sugar protons as well as the anthramycin protons. Anthramycin is covalently attached to a guanine 2-amino group, forming the d(ATamGCAT).d(ATGCAT) modified duplex. The anthramycin protons in the minor groove exhibit NOEs to several nucleotide protons. The network of anthramycin-nucleotide NOEs and the measurement of the 10-Hz coupling constant between the anthramycin H11 and H11a protons shows that anthramycin is covalently attached as the S stereoisomer at the anthramycin C11 position with the side chain of anthramycin oriented toward the 5' end of the modified strand. The NOE data show that the anthramycin-modified duplex is in a right-handed conformation with all bases in an anti conformation. Analysis of the J1'-2' coupling constants for the resolved H1' resonances shows that the S-type conformation of the sugars is highly preferred.     

Binding of actinomycin D to [d(ATCGAT)]2: NMR evidence of multiple complexes

Actinomycin D (actD) binds to the oligonucleotide [d(ATCGAT)]2 with a hypochromatic and red-shifted visible absorbance band compared to free drug and a CD spectrum with double negative bands at 460 and 385 nm. These spectral features are similar to those of the actD-[d(ATGCAT)]2 complex, while actD-[d(AT)5]2 gives spectra similar to those of free drug. Upon dilution or raising the temperature, the spectral characteristics accompanying complex formation disappear in the actD-[(ATCGAT)]2 sample but remain in the actD-[d(ATGCAT)]2 complex under the same experimental conditions. These results suggest that (a) sequence-specific binding of actD occurs with [d(ATCGAT)]2 but not with [d(AT)5]2, (b) the binding is not as strong as with [d(ATGCAT)]2, and (c) actD binds [d(ATCGAT)]2 with the same mechanism as it binds [d(ATGCAT)]2, i.e., by intercalation. From NMR spectra of the actD-[d(ATCGAT)]2 complex, three types of signals can be detected below 20 degrees C, one major and two minor ones. At higher temperatures, exchange between the two minor ones becomes fast enough that only one type of minor signal was seen. Partial resonance assignments were made by using 2D nuclear Overhauser effect (NOE) and 2D homonuclear Hartmann-Hahn (HOHAHA) experiments. Proton chemical shift changes of the major complex are consistent with actD chromophore ring intercalation between hexamer base pairs. Data from NOE-detected dipolar interactions between actD and [d(ATCGAT)]2 protons were interpreted in terms of a major complex with the actD chromophore ring system intercalated at the CG position and minor complexes with the drug intercalated off center at the GA positions.(ABSTRACT TRUNCATED AT 250 WORDS)     

Effects of adduct formation derived from ethylene dibromide on DNA conformation.

Spectral properties of DNA oligomers containing the single modified guanine, S-[2-(N7-guanyl)ethyl]-glutathione, the major adduct derived from 1,2-dibromoethane, were investigated using UV, CD, and NMR. Two palindromic hexamers, d(ATGCAT) and d(ATCGAT), did not form a duplex with guanine bases modified. When the non self-complementary heptamer, d(CATGCCT), was modified at the single guanine, it formed a duplex with its normal complement d(AGGCATG), although the melting temperature was lowered. However, no duplex formation was observed when a non complementary base other than cytosine was placed in d(AGGXATG), suggesting that non Watson-Crick type base pairs are not stabilized by formation of this adduct.     

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.     

A viral genome containing an unstable aflatoxin B1-N7-guanine DNA adduct situated at a unique site.

A problem that has hindered the study of the biological properties of certain DNA adducts, such as those that form at the N7 atoms of purines, is their extreme chemical lability. Conditions are described for the construction of a single-stranded genome containing the chemically and thermally labile 8,9-dihydro-8- (N7-guanyl)-9-hydroxyaflatoxin B1 (AFB1-N7-Gua) adduct, the major DNA adduct of the potent liver carcinogen aflatoxin B1 (AFB1). A 13mer oligonucleotide, d(CCTCTTCGAACTC), was allowed to react with the exo-8,9-epoxide of AFB1 to form an oligonucleotide containing a single AFB1-N7-Gua (at the underlined guanine). This modified 13mer was 5'-phosphorylated and ligated into a gap in an M13 bacteriophage genome generated by annealing a 53mer uracil-containing scaffold to M13mp7L2 linearized by EcoRI. Following ligation, the scaffold was enzymatically removed with uracil DNA glycosylase and exonuclease III. The entire genome construction was complete within 3 h and was carried out at 16 degrees C, pH 6.6, conditions determined to be optimal for AFB1-N7-Gua stability. Characterization procedures indicated that the AFB1-N7-Gua genome was approximately 95% pure with a small (5%) contamination by unmodified genome. This construction scheme should be applicable to other chemically or thermally unstable DNA adducts.     

Structure of the anthramycin-d(ATGCAT)2 adduct from one- and two-dimensional proton NMR experiments in solution

One- and two-dimensional 400-MHz proton NMR experiments are used to examine the solution structure of the covalent adduct formed by the interaction of anthramycin methyl ether with the self-complementary deoxyoligonucleotide d(ATGCAT)2. The concentration dependence of chemical shifts and nuclear Overhauser enhancement (NOE) experiments are utilized to assign the adenine H2 protons within the minor groove for both free d(ATGCAT)2 and the adduct. These studies demonstrate that one of the four adenine H2 protons is in close proximity to the bound anthramycin and this results in its upfield shift of 0.3 ppm compared to the adenine H2 protons of the free duplex. Effects of the covalent attachment of anthramycin to the d(ATGCAT)2 duplex result in an increased shielding of selected deoxyribose protons located within the minor groove of the adduct, as demonstrated by two-dimensional autocorrelated (COSY) NMR techniques. Interactions between the protons of the covalently attached anthramycin and the d(ATGCAT)2 duplex are determined by utilizing two-dimensional NOE (NOESY) techniques. Analysis of these data reveals NOE cross-peaks between the anthramycin methyl, H6, and H7 protons with specific deoxyoligonucleotide protons within the minor groove, thus allowing the orientation of the drug within the minor groove to be determined. Nonselective inversion recovery (T1) relaxation experiments are used to probe the structural and dynamic properties of the anthramycin-d(ATGCAT)2 adduct. These data suggest that the binding of anthramycin alters the correlation time of the d(ATGCAT)2 duplex and stabilizes both of the internal A X T base pairs with respect to solvent exchange.(ABSTRACT TRUNCATED AT 250 WORDS)     

Mutagenic activity and DNA adduct formation by 1, 2-epoxy-3-(p-nitrophenoxy)propane, an HIV-1 protease inhibitor and GST substrate.

Acid protease inhibitor 1,2-epoxy-3-(p-nitrophenoxy)propane (ENPP) is commonly used in research as a substrate for glutathione-S-transferase activity (GST) and recently was found to inhibit human immunodeficiency virus 1 (HIV-1) protease. The question of DNA-adduct formation and mutagenicity was investigated and found that ENPP causes DNA damage and acts directly to induce mutagenicity in Salmonella. Using HPLC analysis, ENPP was shown to bind covalently to guanine residues. The Salmonella mutagenicity assay indicated that ENPP enhanced the mutation frequencies in the base-substitution strain TA00 by more than 20 times above the background. Its mutagenic potency was comparable to that of well-known carcinogens, N-methyl-N-nitrosourea (MNU) and aflatoxin B(1)-8,9-epoxide (AFB(1)-8,9-epoxide). The results suggest that ENPP should be classified as a mutagenic compound and a potential carcinogen.     

Solution structure of an oligodeoxynucleotide containing the malondialdehyde deoxyguanosine adduct N2-(3-oxo-1-propenyl)-dG (ring-opened M1G) positioned in a (CpG)3 frameshift hotspot of the Salmonella typhimurium hisD3052 gene.

The refined solution structure for the ring-opened N2-(3-oxo-1-propenyl)-dG derivative of the malondialdehyde deoxyguanosine adduct M(1)G [3-(2'-deoxy-beta-D-erythro-pentofuranosyl)pyrimido[1, 2-a]purin-10(3H)-one] in d(ATCGCXCGGCATG) x d(CATGCCGCGCGAT) [X being N(2)-(3-oxo-1-propenyl)-dG], containing the d(CpG)(3) frameshift hotspot of the Salmonella typhimurium hisD3052 gene, is presented. When inserted into this duplex, M(1)G underwent spontaneous ring opening to N2-(3-oxo-1-propenyl)-dG. NMR analysis revealed that N2-(3-oxo-1-propenyl)-dG induced minor structural perturbations in the hisD3052 oligodeoxynucleotide. However, the stability of the duplex DNA was reduced; the N2-(3-oxo-1-propenyl)-dG-modified hisD3052 oligodeoxynucleotide exhibited a 14 degrees C decrease in T(m) relative to that of the native oligodeoxynucleotide. The modified guanine maintained stacking interactions with neighboring bases but was not Watson-Crick hydrogen bonded. A total of 13 NOEs were observed from the 3-oxo-1-propenyl moiety protons of N2-(3-oxo-1-propenyl)-dG to DNA protons. Molecular dynamics calculations, restrained by 602 distance restraints derived from experimental NOE measurements and 23 empirical distance restraints, converged with pairwise rmsd differences of <0.90 A. The sixth-root residual factor with the NMR data was 9.1 x 10(-2). The cytosine complementary to N2-(3-oxo-1-propenyl)-dG was pushed toward the major groove but maintained partial stacking interactions with its neighboring bases. The modified guanine remained in the anti conformation, while the 3-oxo-1-propenyl moiety was positioned in the minor groove of the duplex. Possible correlations between the relatively small structural perturbations induced in this DNA duplex by N2-(3-oxo-1-propenyl)-dG and the mutagenic spectrum of M(1)G are discussed.     

Solution structure of the covalent sterigmatocystin-DNA adduct.

Sterigmatocystin and aflatoxin are potent mutagens that contaminate foodstuffs stored under conditions that permit fungal growth. These food mycotoxins can be metabolically activated to their epoxides, which subsequently form covalent adducts with DNA and can eventually induce tumor development. We have generated the sterigmatocystin-d(A1-A2-T3-G4-C5-A6-T7-T8) covalent adduct (two sterigmatocystins per duplex) by reacting sterigmatocystin-1,2-epoxide with the self-complementary d(A-A-T-G-C-A-T-T) duplex and determined its solution structure by the combined application of two-dimensional NMR experiments and molecular dynamics calculations. The self-complementary duplex retains its 2-fold symmetry following covalent adduct formation of sterigmatocystin at the N7 position of G4 residues on each strand of the duplex. The H8 proton of [ST]G4 exchanges rapidly with water and resonates at 9.58 ppm due to the presence of the positive charge on the guanine ring following adduct formation. We have assigned the exchangeable and nonexchangeable proton resonances of sterigmatocystin and the duplex in the covalent adduct and identified the intermolecular proton-proton NOEs that define the orientation and mode of binding of the mutagen to duplex DNA. The analysis was aided by intermolecular NOEs between the sterigmatocystin protons with both the major groove and minor groove protons of the DNA. The molecular dynamics calculations were aided by 180 intramolecular nucleic acid constraints, 16 intramolecular sterigmatocystin constraints, and 56 intermolecular distance constraints between sterigmatocystin and the nucleic acid protons in the adduct. The sterigmatocystin chromophore intercalates between the [ST]G4.C5 and T3.A6 base pairs and stacks predominantly over the modified guanine ring in the adduct duplex. The overall conformation of the DNA remains right-handed on adduct formation with unwinding of the helix, as well as widening of the minor groove. Parallel NMR studies on the sterigmatocystin-d(A1-A2-A3-G4-C5-T6-T7-T8) covalent adduct (two sterigmatocystins per duplex) provide supportive evidence that the mutagen covalently adducts the N7 position of G4 and its chromophore intercalates to the 5' side of the guanine and stacks over it. The present NMR-molecular dynamics studies that define a detailed structure for the sterigmatocystin-DNA adduct support key structural conclusions proposed previously on the basis of a qualitative analysis of NMR parameters for the adduct formed by the related food mutagen aflatoxin B1 and DNA [Gopalakrishnan, S., Harris, T. M., & Stone, M. P. (1990) Biochemistry 29, 10438-10448].     

NMR investigation of mithramycin A binding to d(ATGCAT)2: a comparative study with chromomycin A3

The binding of mithramycin A to the d(A1T2G3C4A5T6) duplex was investigated by 1H NMR and found to be similar to that of its analogue chromomycin A3. In the presence of Mg2+, mithramycin binds strongly to d(ATGCAT)2. On the basis of the two-dimensional NOESY spectrum, the complex formed possesses C2 symmetry at a stoichiometry of two drugs per duplex (2:1) and is in slow chemical exchange on the NMR time scale. NOESY experiments reveal contacts from the E-pyranose of mithramycin to the terminal and nonterminal adenine H2 proton of DNA and from the drug hydroxyl proton to both G3NH2 protons, C4H1' proton, and A5H1' proton. These data place the drug chromophore and E pyranose on the minor groove side of d(ATGCAT)2. NOE contacts from the A-, B-, C-, and D-pyranoses of mithramycin to several deoxyribose protons suggest that the A- and B-rings are oriented along the sugar-phosphate backbone of G3-C4, while the C- and D-rings are located along the sugar-phosphate backbone of A5-T6. These drug-DNA contacts are very similar to those found for chromomycin binding to d(ATGCAT)2. Unlike chromomycin, the NOESY spectrum of mithramycin at the molar ratio of one drug per duplex reveals several chemical exchange cross-peaks corresponding to the drug-free and drug-bound proton resonances. From the intensity of these cross-peaks and the corresponding diagonal peaks, the off-rate constant was estimated to be 0.4 s-1. These data suggest that the exchange rate of mithramycin binding to d(ATGCAT)2 is faster than that of chromomycin.     

Metabolic basis of the species difference to aflatoxin B1 induced hepatotoxicity

Primary metabolism of aflatoxin B1 by the liver microsomal enzymes from a range of animal species showed both quantitative and qualitative differences. Quail was shown to have the most rapid metabolism of aflatoxin B1. The major product of metabolism in this case was found to be aflatoxin B1-8,9-dihydrodiol suggesting that the quail microsomes produced high levels of the proposed reactive intermediate aflatoxin B1-8,9-epoxide. Using this system to generate the epoxide, the ability of the cytosol prepared from each species to conjugate epoxide with reduced glutathione was investigated. Large differences in ability to conjugate were observed ranging from 0 to 72% for quail and mouse respectively. Differences in both primary and secondary metabolism of AFB1 were noted between male and female Fischer 344 rats.     

Preparation and characterization of oligonucleotides containing S-[2-(N7-guanyl)ethyl]glutathione.

S-[2-(N7-Guanyl)ethyl]glutathione is the major adduct derived from modification of DNA with 1,2-dibromoethane in biological systems and is postulated to be a mutagenic lesion [Humphreys, W. G., Kim, D.-H., Cmarik, J. L., Shimada, T., & Guengerich, F. P. (1990) Biochemistry 29, 10342-10350]. Oligonucleotides containing this modified base were prepared by treatment of oligonucleotides with S-(2-chloroethyl)glutathione and purified by chromatography. The self-complementary oligonucleotide d(ATGCAT), when thus modified at the single guanine, appeared to associate with itself as judged by UV measurements, but CD and NMR measurements indicated a lack of hybridization, with a decrease in the melting temperature of greater than 10 degrees C. The same lack of self-association was noted when d(ATGCAT) was modified to contain an N-acetyl-S-[2-(N7-guanyl)ethyl]cysteine methyl ester moiety. The oligomer d-(C1A2T3G4C5C6T7) was modified to contain a single S-[2-(N7-guanyl)ethyl]glutathione moiety at the central position, and UV, CD, and 1H NMR studies indicated that this oligomer hybridized to its normal complement d(A8G9G10C11A12T13G14), although the binding was considerably weakened by adduction (imino proton NMR spectroscopy in the presence of H2O indicated that the hydrogen bond signals seen in the oligomer were all broadened upon modification). All proton resonances were identified using two-dimensional 1H NMR spectroscopy. Adduct formation affected the chemical shifts of the base and 1', 2', and 2" protons of T3 and C5, the 2" proton of C6, and the 8 and 1' protons of C11, while little effect was observed on other protons. No cross-peaks were detected between the glutathione and oligomer moieties in two-dimensional nuclear Overhauser enhanced NMR studies. These results suggest that a rather local structural perturbation occurs in the DNA oligomer upon modification and that the glutathione moiety appears to be relatively unperturbed by its placement in the duplex. When the cytosine in the normal d(AGGCATG) complement to d-(CATGCCT) was changed to each of the other three potential bases at the central position, no hybridization with the oligomer d(CATGCCT) containing S-[2-(N7-guanyl)ethyl]glutathione was detected. We conclude that these N7-guanyl derivatives destabilize hybridization and that bases other than cytosine do not appear to show preferential thermodynamic bonding to these adducts, at least in the sequences examined to date.(ABSTRACT TRUNCATED AT 400 WORDS)     

Mispairing of the 8,9-dihydro-8-(N7-guanyl)-9-hydroxy-aflatoxin B1 adduct with deoxyadenosine results in extrusion of the mismatched dA toward the major groove

The G --> T transversion is the dominant mutation induced by the cationic trans-8,9-dihydro-8-(N7-guanyl)-9-hydroxy-aflatoxin B(1) adduct. The structure of d(ACATC(AFB)GATCT).d(AGATAGATGT), in which the cationic adduct was mismatched with deoxyadenosine, was refined using molecular dynamics calculations restrained by NOE data and dihedral restraints obtained from NMR spectroscopy. Restrained molecular dynamics calculations refined structures with pairwise rmsd <1 A and a sixth root R1x factor between the refined structure and NOE data of 10.5 x 10-2. The mismatched duplex existed in a single conformation at neutral pH. The aflatoxin moiety intercalated above the 5' face of the modified (AFB)G. The mismatched dA was in the anti conformation about the glycosyl bond. It extruded toward the major groove and did not participate in hydrogen bonding with (AFB)G. The structure was compared with that of d(ACATCGATCT).d(AGATAGATGT) containing the corresponding unmodified G.A mismatch and with d(ACATC(AFB)GATCT).d(AGATCGATGT) containing the aflatoxin lesion in the correctly paired (AFB)G.C context. The correctly paired oligodeoxynucleotide exhibited Watson-Crick-type geometry at the (AFB)G.C pair. It melted at higher temperature than the mismatched (AFB)G.A duplex. The unmodified mismatched G.A duplex exhibited spectral line broadening at neutral pH, suggesting a mixture of conformations. It exhibited a lower melting temperature than did the mismatched (AFB)G.A duplex. These differences correlated with replication bypass experiments performed in vitro utilizing DNA polymerase I exo- [Johnston, D. S., and Stone, M. P. (2000) Chem. Res. Toxicol. 13, 1158-1164]. Those experiments showed that correct insertion of dC opposite (AFB)G blocked replication by the enzyme, whereas incorrect insertion of dA opposite (AFB)G allowed full-length replication of the adducted template strand.     

Characterization of a unique tomaymycin-d(CICGAATTCICG)2 adduct containing two drug molecules per duplex by NMR, fluorescence, and molecular modeling studies

Tomaymycin is a member of the pyrrolo[1,4]benzodiazepine [P(1,4)B] antitumor antibiotic group. This antibiotic is proposed to react with the exocyclic 2-amino group (N2) of guanine to form a covalent adduct that lies snugly within the minor groove of DNA. While DNA-footprinting experiments using methidiumpropyl-EDTA have revealed the favored bonding sequences for tomaymycin and related drugs on DNA, the stereochemistry at the covalent bonding site (C-11) and orientation in the minor groove were not established by these experiments. In previous studies using a combined fluorescence, high-field NMR, and molecular modeling approach, we have shown that for tomaymycin there are two diastereomeric species (11R and 11S) on both calf thymus DNA and d(ATGCAT)2. Although we were able to infer the identity (stereochemistry at C-11 and orientation in the minor groove) of the two species on d(ATGCAT)2 by high-field NMR and fluorescence studies, in combination with molecular mechanics calculations, definitive experimental evidence was lacking. We have designed and synthesized a self-complementary 12-mer [d(CICGAATTCICG)2] based on the Dickerson dodecamer [d(CGCGAATTCGCG)2] that bonds identically two tomaymycin molecules, each having a defined orientation and stereochemistry. Thus the bis(tomaymycin)-12-mer adduct maintains the self-complementarity of the original duplex molecule. Two-dimensional proton J-correlated spectroscopy (COSY) of the bis(tomaymycin)-d(CICGAATTCICG)2 adduct (I = inosine) unequivocally shows that C-11 of tomaymycin covalently bonds through N2 of guanine with an 11S stereochemistry in the sequence 5'-CGA-3'.(ABSTRACT TRUNCATED AT 250 WORDS)     

Intercalation of the (1R,2S,3R,4S)-N6-[1-(1,2,3,4-tetrahydro-2,3,4-trihydroxybenz[a]anthracenyl)]-2'-deoxyadenosyl adduct in the N-ras codon 61 sequence: DNA sequence effects

The structure of the bay region (1R,2S,3R,4S)-N6-[1-(1,2,3,4-tetrahydro-2,3,4-trihydroxybenz[a]anthracenyl)]-2'-deoxyadenosyl adduct at X(7) of 5'-d(CGGACAXGAAG)-3'.5'-d(CTTCTTGTCCG)-3', incorporating codons 60, 61 (underlined), and 62 of the human N-ras protooncogene, was determined by NMR. This was the bay region benz[a]anthracene RSRS (61,3) adduct. The BA moiety intercalated above the 5'-face of the modified base pair. NOE connectivities between imino protons were disrupted at T16 and T17. Large chemical shifts at the lesion site were consistent with ring current shielding arising from the BA moiety. A large chemical shift dispersion was observed for the BA aromatic protons. An increased rise of 8.17 A was observed between base pairs A6 x T17 and X7 x T(16). The PAH moiety stacked with the purine ring of A6, the 5'-neighbor nucleotide. This resulted in buckling of the 5'-neighbor A6 x T17 base pair, evidenced by exchange broadening for the T17 imino resonance. It also interrupted sequential NOE connectivities between nucleotides C5 and A6. The A6 deoxyribose ring showed an increased percentage of the C3'-endo conformation. This differed from the bay region BA RSRS (61,2) adduct, in which the lesion was located at position X6 [Li, Z., Mao, H., Kim, H.-Y., Tamura, P. J., Harris, C. M., Harris, T. M., and Stone, M. P. (1999) Biochemistry 38, 2969-2981], but was similar to the benzo[a]pyrene BP SRSR (61,3) adduct [Zegar I. S., Chary, P., Jabil, R. J., Tamura, P. J., Johansen, T. N., Lloyd, R. S., Harris, C. M., Harris, T. M., and Stone, M. P. (1998) Biochemistry 37, 16516-16528]. The altered sugar pseudorotation at A6 appears to be common to both bay region BA RSRS (61,3) and BP SRSR (61,3) adducts. It could not be discerned if the C3'-endo conformation at A6 in the BA RSRS (61,3) adduct altered base pairing geometry at X7 x T16, as compared to the C2'-endo conformation. The structural studies suggest that the mutational spectrum of this adduct may be more complex than that of the BA RSRS (61,2) adduct.     

Sequence-dependent recognition of DNA duplexes. Netropsin complexation to the AATT site of the d(G-G-A-A-T-T-C-C) duplex in aqueous solution

We have investigated intermolecular interactions and conformational features of the netropsin X d(G-G-A-A-T-T-C-C) complex by one- and two-dimensional NMR studies in aqueous solution. Netropsin removes the 2-fold symmetry of the d(G-G-A-A-T-T-C-C) duplex at the AATT binding site and to a lesser extent at adjacent dG X dC base pairs resulting in doubling of resonances for specific positions in the spectrum of the complex at 25 degrees C. We have assigned the amide, pyrrole, and CH2 protons of netropsin, and the base and sugar H1' protons of the nucleic acid from an analysis of the nuclear Overhauser effect (NOESY) and correlated (COSY) spectra of the complex at 25 degrees C. We observe intermolecular nuclear Overhauser effects (NOE) between all three amide and both pyrrole protons on the concave face of the antibiotic and the minor groove adenosine H2 proton of the two central A4 X T5 base pairs of the d(G1-G2-A3-A4-T5-T6-C7-C8) duplex. Weaker intermolecular NOEs are also observed between the pyrrole concave face protons and the sugar H1' protons of residues T5 and T6 in the AATT minor groove of the duplex. We also detect intermolecular NOEs between the guanidino CH2 protons at one end of netropsin and adenosine H2 proton of the two flanking A3 X T6 base pairs of the octanucleotide duplex. These studies establish a set of intermolecular contacts between the concave face of the antibiotic and the minor groove AATT segment of the d(G-G-A-A-T-T-C-C) duplex in solution. The magnitude of the NOEs require that there be no intervening water molecules sandwiched between the antibiotic and the DNA so that release of the minor groove spine of hydration is a prerequisite for netropsin complex formation.