Mitogen-independent phosphorylation of S6K1 and decreased ribosomal S6 phosphorylation in senescent human fibroblasts

The p70 ribosomal S6 kinase (S6K1) is rapidly activated following growth factor stimulation of quiescent fibroblasts and inhibition of this enzyme results in a G(1) arrest. Phosphorylation of the ribosomal S6 protein by S6K1 regulates the translation of both ribosomal proteins and initiation factors, leading to an increase in protein synthesis. We have examined the activation of S6K1 in human fibroblasts following mitogen stimulation. In early passage fibroblasts S6K1 is activated following serum stimulation as evidenced by increased kinase activity and site-specific phosphorylation. In contrast, site-specific phosphorylation of S6K1 at Thr421/Ser424 is diminished in senescent fibroblast cultures. A second phosphorylation site within S6K1 (Ser411) is phosphorylated even in the absence of serum stimulation and the enzyme shows increased phosphorylation as judged by decreased electrophoretic mobility. Inhibitor studies indicate that this phosphorylation is dependent upon the mammalian target of rapamycin, PI 3-kinase, and the MAPK pathway. In order to understand the consequences of the altered phosphorylation of the S6K1, we examined the phosphorylation state of the ribosomal S6 protein. In early passage fibroblasts the ribosomal S6 protein is phosphorylated upon serum stimulation while the phosphorylation of the ribosomal S6 protein is drastically reduced in senescent fibroblasts. These results suggest that the intracellular regulators of S6K1 are altered during replicative senescence leading to a deregulation of the enzyme and a loss of ribosomal S6 phosphorylation.     

Ribosomal protein S1 induces a conformational change of the 30S ribosomal subunit

A comparative study of the 30S ribosomal subunit in the complex with protein S1 and the subunit depleted of this protein has been carried out by the hot tritium bombardment method. Differences in exposure of some ribosomal proteins within the 30S subunit depleted of S1 and within the 30S–S1 complex were found. It was concluded that protein S1 binds in the region of the neck of the 30S ribosomal subunit inducing a conformational change of its structure.     

Three-dimensional localization of the NH2- and carboxyl-terminal domain of ribosomal protein S1 on the surface of the 30 S subunit from Escherichia coli.

Antibodies were raised against Escherichia coli ribosomal protein S1 and its NH2- and COOH-terminal fragments, and their specificity was demonstrated by a variety of immunological techniques. These antibodies were then used to investigate the location of protein S1 and its NH2- and COOH-terminal domains on the surface of the 30 S ribosomal subunit by immunoelectron microscopy. In order to prevent dissociation of the protein during the experiments, S1 was cross-linked to 30 S subunits with dithiobis(succinimidyl-propionate); cross-linking yield was 100%. Epitopes of the NH2-terminal domain of S1 were localized at the large lobe of the 30 S ribosomal subunit, close to the one-third/two-thirds partition on the side which in the 70 S ribosome faces the cytoplasm. Experiments with monovalent Fab fragments specific for the COOH-terminal part of S1 provide evidence that the COOH-terminal domain forms an elongated structure extending at least 10 nm from the large lobe of the small subunit into the cytoplasmic space.     

RNA-binding characteristics of the chloroplast S1-like ribosomal protein CS1

The chloroplast ribosomal protein CS1, the homolog of the bacterial ribosomal protein S1, is believed to be involved in the process of ribosome binding to mRNA during translation. Since translation control is an important step in chloroplast gene expression, and in order to study initiation complex formation, we studied the RNA-binding properties of CS1 protein. We found that most of the CS1 protein in spinach chloroplast co-purified with the 30S ribosomal subunit. The relative binding affinity of RNA to CS1 was determined using the UV-crosslinking competition assay. CS1 protein binds the ribohomopolymer poly(U) with a relatively high binding affinity. Very low binding affinities were obtained for the other ribohomopolymers, poly(G), poly(A) and poly(C). In addition, no specific binding of CS1, either in the 30S complex or as a recombinant purified protein, was obtained to the 5′-untranslated region of the mRNA in comparison to the other parts. RNA-binding experiments, in which the N- and C-termini of the protein were analyzed, revealed that the RNA-binding site is located in the C-terminus half of the protein. These results suggest that CS1 does not direct the 30S complex to the initiation codon of the translation site by specific binding to the 5′-untranslated region. In bacteria, specific binding is derived by base pairing between 16S rRNA and the Shine–Dalagarno sequences. In the chloroplast, nuclear encoded and gene-specific translation factors may be involved in the determination of specific binding of the 30S subunit to the initiator codon.     

Involvement of 30S ribosomal protein S1 in poly(U)-directed polyphenylalanine synthesis.

The effect of 30S ribosomal protein S1 on poly(U)-directed polyphenylalanine synthesis was studied using a highly purified cell-free system which was devoid of endogenous S1. The system consisted of homogeneous preparations of EF-Tu, EF-Ts, and EF-G, and 70S ribosomes from which protein S1 had been removed by poly(U)-cellulose column chromatography. It was found that protein S1 was indispensable for translation of poly(U) by an S1-depleted system at low concentrations of poly(U). On the other hand, at higher concentrations of poly(U), a considerable amount of polyphenylalanine was synthesized in the absence of added S1. The stimulatory effect of S1 was observed at all Mg2+ concentrations examined but was most pronounced at 10 mM Mg2+. Some physicochemical properties of the protein were also studied. It was demonstrated that the protein has an elongated shape with an axial ratio of approximately 8.5.     

Identification of an Escherichia coli S1-like protein in the spinach chloroplast ribosome

Antibodies directed against E. coli ribosomal protein S1 were used in immunoblotting assays to search for an S1-like protein in the ribosome of spinach chloroplast. An immunological cross-reaction was reproducibly detected on the blots and inhibition experiments have demonstrated its specificity. The chloroplastic ribosomal protein which has epitopes common to antigenic determinants of the E. coli protein S1 was identified as being protein S2/S3.     

Effects of ribosomal proteins S1, S2 and the DeaD/CsdA DEAD-box helicase on translation of leaderless and canonical mRNAs in Escherichia coli

Leaderless mRNAs beginning with the AUG initiating codon occur in all kingdoms of life. It has been previously reported that translation of the leaderless cI mRNA is stimulated in an Escherichia coli rpsB mutant deficient in ribosomal protein S2. Here, we have studied this phenomenon at the molecular level by making use of an E. coli rpsB(ts) mutant. The analysis of the ribosomes isolated under the non-permissive conditions revealed that in addition to ribosomal protein S2, ribosomal protein S1 was absent, demonstrating that S2 is essential for binding of S1 to the 30S ribosomal subunit. In vitro translation assays and the selective translation of a leaderless mRNA in vivo at the non-permissive temperature corroborate and extend previous in vitro ribosome binding studies in that S1 is indeed dispensable for translation of leaderless mRNAs. The deaD/csdA gene, encoding the "DeaD/CsdA" DEAD-box helicase, has been isolated as a multicopy suppressor of rpsB(ts) mutations. Here, we show that expression of a plasmid-borne DeaD/CsdA gene restores both S1 and S2 on the ribosome at the non-permissive temperature in the rpsB(ts) strain, which in turn leads to suppression of the translational defect affecting canonical mRNSa. These data are discussed in terms of a model, wherein DeaD/CsdA is involved in ribosome biogenesis rather than acting directly on mRNA.     

Qsr1p, a 60S ribosomal subunit protein, is required for joining of 40S and 60S subunits.

QSR1 is a recently discovered, essential Saccharomyces cerevisiae gene, which encodes a 60S ribosomal subunit protein. Thirty-one unique temperature-sensitive alleles of QSR1 were generated by regional codon randomization within a conserved 20-amino-acid sequence of the QSR1-encoded protein. The temperature-sensitive mutants arrest as viable, large, unbudded cells 24 to 48 h after a shift to 37 degrees C. Polysome and ribosomal subunit analysis by velocity gradient centrifugation of lysates from temperature-sensitive qsr1 mutants and from cells in which Qsr1p was depleted by down regulation of an inducible promoter revealed the presence of half-mer polysomes and a large pool of free 60S subunits that lack Qsr1p. In vitro subunit-joining assays and analysis of a mutant conditional for the synthesis of Qsr1p demonstrate that 60S subunits devoid of Qsr1p are unable to join with 40S subunits whereas 60S subunits that contain either wild-type or mutant forms of the protein are capable of subunit joining. The defective 60S subunits result from a reduced association of mutant Qsr1p with 60S subunits. These results indicate that Qsr1p is required for ribosomal subunit joining.     

Position of protein S1 in the 30 S ribosomal subunit of Escherichia coli

The results of neutron distance measurement involving ribosomal protein S1 from Escherichia coli are reported. These data provide a position for S1 on the small ribosomal subunit. They also indicate that S1, bound to the ribosome, has a radius of gyration of 60 to 65 Å, suggesting that its axial ratio in the bound state is similar to that it has as a free molecule in solution; namely, 10: 1. The implications of these results for our understanding of the mode of action of S1 are discussed.     

Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.     

Regulation of ribosomal protein S6 phosphorylation by casein kinase 1 and protein phosphatase 1

Ribosomal protein S6 (rpS6) is a critical component of the 40 S ribosomal subunit that mediates translation initiation at the 5'-m(7)GpppG cap of mRNA. In response to mitogenic stimuli, rpS6 undergoes ordered C-terminal phosphorylation by p70 S6 kinases and p90 ribosomal S6 kinases on four conserved Ser residues (Ser-235, Ser-236, Ser-240, and Ser-244) whose modification potentiates rpS6 cap binding activity. A fifth site, Ser-247, is also known to be phosphorylated, but its function and regulation are not well characterized. In this study, we employed phospho-specific antibodies to show that Ser-247 is a target of the casein kinase 1 (CK1) family of protein kinases. CK1-dependent phosphorylation of Ser-247 was induced by mitogenic stimuli and required prior phosphorylation of upstream S6 kinase/ribosomal S6 kinase residues. CK1-mediated phosphorylation of Ser-247 also enhanced the phosphorylation of upstream sites, which implies that bidirectional synergy between C-terminal phospho-residues is required to sustain rpS6 phosphorylation. Consistent with this idea, CK1-dependent phosphorylation of rpS6 promotes its association with the mRNA cap-binding complex in vitro. Additionally, we show that protein phosphatase 1 (PP1) antagonizes rpS6 C terminus phosphorylation and cap binding in intact cells. These findings further our understanding of rpS6 phospho-regulation and define a direct link between CK1 and translation initiation.     

Translation-competent 48S complex formation on HCV IRES requires the RNA-binding protein NSAP1

Translation of many cellular and viral mRNAs is directed by internal ribosomal entry sites (IRESs). Several proteins that enhance IRES activity through interactions with IRES elements have been discovered. However, the molecular basis for the IRES-activating function of the IRES-binding proteins remains unknown. Here, we report that NS1-associated protein 1 (NSAP1), which augments several cellular and viral IRES activities, enhances hepatitis C viral (HCV) IRES function by facilitating the formation of translation-competent 48S ribosome-mRNA complex. NSAP1, which is associated with the solvent side of the 40S ribosomal subunit, enhances 80S complex formation through correct positioning of HCV mRNA on the 40S ribosomal subunit. NSAP1 seems to accomplish this positioning function by directly binding to both a specific site in the mRNA downstream of the initiation codon and a 40S ribosomal protein (or proteins).     

Restoration by ribosomal protein S1 of the defective translation in a temperature-sensitive mutant of Escherichia coli K-12: characterization and genetic studies.

A temperature-sensitive mutant of Escherichia coli was isolated that had a temperature-sensitive defect in ribosomal-wash protein(s) required for translation in vitro of E. coli endogenous messenger ribonucleic acid. It was found that 30S ribosomal protein S1 rescued the defect in the ribosomal-wash protein(s) of the mutant and that the complete restoration to the wild-type level was attained when 1 mol of protein S1 was added to 1 mol of 70S ribosome. The mutation, tss, causing such a defect was mapped at 21 min and was closely linked to the pyrD locus, the region of which was entirely different from that of the other genes coding for the many ribosomal proteins of E. coli. These results indicate that the gene specified by this mutation is involved in the function of the 30S ribosomal protein S1.     

The novel ATP-binding cassette protein ARB1 is a shuttling factor that stimulates 40S and 60S ribosome biogenesis

ARB1 is an essential yeast protein closely related to members of a subclass of the ATP-binding cassette (ABC) superfamily of proteins that are known to interact with ribosomes and function in protein synthesis or ribosome biogenesis. We show that depletion of ARB1 from Saccharomyces cerevisiae cells leads to a deficit in 18S rRNA and 40S subunits that can be attributed to slower cleavage at the A0, A1, and A2 processing sites in 35S pre-rRNA, delayed processing of 20S rRNA to mature 18S rRNA, and a possible defect in nuclear export of pre-40S subunits. Depletion of ARB1 also delays rRNA processing events in the 60S biogenesis pathway. We further demonstrate that ARB1 shuttles from nucleus to cytoplasm, cosediments with 40S, 60S, and 80S/90S ribosomal species, and is physically associated in vivo with TIF6, LSG1, and other proteins implicated previously in different aspects of 60S or 40S biogenesis. Mutations of conserved ARB1 residues expected to function in ATP hydrolysis were lethal. We propose that ARB1 functions as a mechanochemical ATPase to stimulate multiple steps in the 40S and 60S ribosomal biogenesis pathways.     

Protein-protein proximity in the association of ribosomal subunits of Escherichia coli: crosslinking of 30 S protein S16 to 50 S proteins by glutaraldehyde or formaldehyde

The interaction of ribosomal subunits from Escherichia coli has been studied using crosslinking reagents. Radioactive ³⁵S-labeled 50 S subunits and non-radioactive 30 S subunits were allowed to reassociate to form 70 S ribosomes. The 70 S particles, containing radioactivity only in the 50 S protein moiety, were incubated with glutaraldehyde or formaldehyde. As a result of this treatment a substantial fraction of the 70 S particles did not dissociate at 1 mm-Mg²⁺. This fraction was isolated and the ribosomal proteins were extracted. The protein mixture was analyzed by the Ouchterlony double diffusion technique by using eighteen antisera prepared against single 30 S ribosomal proteins (all except those against S3, S15 and S17). As a result of the crosslinking procedure it was found that only anti-S16 co-precipitated ³⁵S-labeled 50 S protein. It is concluded that the 30 S protein S16 is at or near the site of interaction between subunits and can become crosslinked to one or more 50 S ribosomal proteins.     

Phosphorylation and degradation of S6K1 (p70S6K1) in response to persistent JNK1 Activation

S6K (ribosomal S6 kinase p70, p70S6K) activation requires phosphorylation at two stages. The first phosphorylation is independent of insulin stimulation and mediated by an unknown kinase. The second phosphorylation is mediated by mTOR in insulin dependent manner. In this study, we identified JNK1 (c-Jun N-terminal kinase 1) as a kinase in the first phosphorylation. S6K protein was phosphorylated by JNK1 at S411 and S424 in the carboxyl terminal autoinhibitory domain. The phosphorylation was observed in kinase assay with purified S6K as a substrate, and in cells after JNK1 activation by TNF-α or MEKK1 expression. The phosphorylation was detected in JNK2 null cells, but not in JNK1 null cells after TNF-α treatment. When JNK1 activation was inhibited by MKK7 knockdown, the phosphorylation was blocked in cells. The phosphorylation led to S6K protein degradation in NF-κB deficient cells. The degradation was blocked by inhibition of proteasome activity with MG132. In wide type cells, the phosphorylation did not promote S6K degradation when IKK2 (IKKβ, IκB kinase beta) was activated. Instead, the phosphorylation allowed S6K activation by mTOR, which stabilizes S6K protein. In IKK2 null cells or cells treated by IKK2 inhibitor, the phosphorylation led to S6K degradation. These data suggest that S6K is phosphorylated by JNK1 and the phosphorylation makes S6K protein unstable in the absence of IKK2 activation. This study provides a mechanism for regulation of S6K protein stability.     

Synergistic defect in 60S ribosomal subunit assembly caused by a mutation of Rrs1p, a ribosomal protein L11-binding protein, and 3'-extension of 5S rRNA in Saccharomyces cerevisiae

Rrs1p, a ribosomal protein L11-binding protein, has an essential role in biogenesis of 60S ribosomal subunits. We obtained conditionally synthetic lethal allele with the rrs1-5 mutation and determined that the mutation is in REX1, which encodes an exonuclease. The highly conserved leucine at 305 was substituted with tryptophan in rex1-1. The rex1-1 allele resulted in 3′-extended 5S rRNA. Polysome analysis revealed that rex1-1 and rrs1-5 caused a synergistic defect in the assembly of 60S ribosomal subunits. In vivo and in vitro binding assays indicate that Rrs1p interacts with the ribosomal protein L5–5S rRNA complex. The rrs1-5 mutation weakens the interaction between Rrs1p with both L5 and L11. These data suggest that the assembly of L5–5S rRNA on 60S ribosomal subunits coordinates with assembly of L11 via Rrs1p.     

Cross-linking of mRNA to initiation factor eIF-3, 24 kDa cap binding protein and ribosomal proteins S1, S3/3a, S6 and S11 within the 48S pre-initiation complex

Native small ribosomal subunits from rabbit reticulocytes contain all initiation factors necessary for the formation of the mRNA-containing 48S pre-initiation complex. The complex formed in the presence of Met-tRNAf and 125I-labelled globin mRNA was cross-linked with diepoxybutane, and the covalent mRNA-protein complexes were isolated under denaturating conditions. The proteins of the covalent complex were identified as the 110, 95 and 66/64 kDa subunits of eIF-3. In addition, the 24 kDa cap binding protein and the ribosomal proteins S1, S3/3a, S6 and S11 were found covalently linked to the mRNA. Ribosomal proteins S3/3a and S6 were also involved in the ribosomal mRNA-binding domain of reticulocyte polysomes.