Recognition of human telomeric G‐quadruplex DNA by berberine analogs: effect of substitution at the 9 and 13 positions of the isoquinoline moiety

G‐quadruplex forming sequences are widely distributed in human genome and serve as novel targets for regulating gene expression and chromosomal maintenance. They offer unique targets for anticancer drug development. Here, the interaction of berberine (BC) and two of its analogs bearing substitution at 9 and 13‐position with human telomeric G‐quadruplex DNA sequence has been investigated by biophysical techniques. Both the analogs exhibited several‐fold higher binding affinity than berberine. The Scatchard binding isotherms revealed non‐cooperative binding. 9‐ω‐amino hexyl ether analog (BC1) showed highest affinity (1.8 × 10⁶ M^?1) while the affinity of the 13‐phenylpropyl analog (BC2) was 1.09 × 10⁶ M^?1. Comparative fluorescence quenching and polarization anisotropy of the emission spectra gave evidence for a stronger stacking interaction of the analogs compared to berberine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberine. However, the binding of the analogs did not induce any major structural perturbation in the G‐quadruplex structure, but led to higher thermal stability. Energetics of the binding indicated that the association of the analogs was exothermic and predominantly entropy driven phenomenon. Increasing the temperature resulted in weaker binding; the enthalpic contribution increased and the entropic contribution decreased. A small negative heat capacity change with significant enthalpy–entropy compensation established the involvement of multiple weak noncovalent interactions in the binding process. The 9‐ω‐amino hexyl ether analog stabilized the G‐quadruplex structure better than the 13‐phenyl alkyl analog. Copyright © 2015 John Wiley & Sons, Ltd.     

Interaction of aloe active compounds with calf thymus DNA

Natural anthraquinone compounds have emerged as potent anticancer chemotherapeutic agents because of their promising DNA‐binding properties. Aloe vera is among one of the very well‐known medicinal plants, and the anthraquinone derivatives like aloe emodin (ALM), aloins (ALN), and aloe emodin‐8‐glucoside (ALMG) are known to have immense biological activities. Here, we have used biophysical methods to elucidate the comparative DNA‐binding abilities of these three molecules. Steady‐state fluorescence study indicated complexation between calf thymus DNA (ctDNA) and both the molecules ALM and ALMG whereas ALN showed very weak interaction with DNA. Displacement assays with ctDNA‐bound intercalator (ethidium bromide) and a groove binder (Hoechst 33258) indicated preferential binding of both ALM and ALMG to minor groove of DNA. Isothermal titration calorimetric (ITC) data suggested spontaneous exothermic single binding mode of both the molecules: ALM and ALMG. Entropy is the most important factor which contributed to the standard molar Gibbs energy associated with relatively small favorable enthalpic contribution. The equilibrium constants of binding to ctDNA were (6.02 ± 0.10) × 10⁴ M^?1 and (4.90 ± 0.11) × 10⁴ M^?1 at 298.15 K, for ALM and ALMG, respectively. The enthalpy vs temperature plot yielded negative standard molar heat capacity value, and a strong negative correlation between enthalpy and entropy terms was observed which indicates the enthalpy entropy compensation behavior in both systems. All these thermodynamic phenomena indicate that hydrophobic force is the key factor which is involved in the binding process. Moreover, the enhancement of thermal stability of DNA helix by ALM and ALMG fully agreed to the complexation of these molecules with DNA.     

Biophysical probing of the binding properties of a Cu(II) complex with G‐quadruplex DNA: an experimental and computational study

Telomerase inhibition through G‐quadruplex stabilization by small molecules is of great interest as a novel anticancer therapeutic strategy. Here, we show that newly synthesized Cu‐complex binds to G‐quadruplex DNA and induces changes in its stability. This biophysical interaction was investigated in vitro using spectroscopic, voltammetric and computational techniques. The binding constant for this complex to G‐quadruplex using spectroscopic and electrochemical methods is in the order of 10⁵. The binding stoichiometry was investigated using spectroscopic techniques and corresponded to a ratio of 1: 1. Fluorescence titration results reveal that Cu‐complex is quenched in the presence of G‐quadruplex DNA. Analysis of the fluorescence emission at different temperatures shows that ΔH° > 0, ΔS° > 0 and ΔG° < 0, and indicates that hydrophobic interactions played a major role in the binding processes. MD simulation results suggested that this ligand could stabilize the G‐quadruplex structure. An optimized docked model of the G‐quadruplex–ligand mixture confirmed the experimental results. Based on the results, we conclude that Cu‐complex as an anticancer candidate can bind and stabilize the G‐quadruplex DNA structure. Copyright © 2015 John Wiley & Sons, Ltd.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Binding of the alkaloid aristololactam-β-D-glucoside and daunomycin to human hemoglobin: spectroscopy and calorimetry studies

The interaction of the plant alkaloid aristololactam-β-D-glucoside (ADG) and the anticancer agent daunomycin (DAN) with human hemoglobin was studied by different spectroscopic and calorimetric methods. The binding affinity values of ADG and DAN, estimated from spectroscopic experiments, were 3.79 × 10⁴ and 6.68 × 10⁴ M^?1, respectively. From circular dichroism, 3D fluorescence, and FTIR studies it was observed that, DAN induced stronger conformational changes than ADG in the protein. From synchronous fluorescence spectroscopy results, a pronounced shift in the maximum emission wavelength of tyrosine residues was observed in both cases suggesting that the drugs changed the polarity around tyrosine residues with marginal change around the tryptophan residues. The thermodynamics of the binding interaction analyzed using microcalorimetry presented single binding events that were exothermic in nature in both cases. The binding was driven by large positive standard molar entropy changes with small favorable enthalpy contributions. Negative heat capacity changes in both cases are correlated to the involvement of significant hydrophobic forces in the complexation process. The affinity of DAN to Hb was higher than that of ADG.     

Folding thermodynamics of the hybrid‐1 type intramolecular human telomeric G‐quadruplex

Guanine‐rich DNA sequences that may form G‐quadruplexes are located in strategic DNA loci with the ability to regulate biological events. G‐quadruplexes have been under intensive scrutiny owing to their potential to serve as novel drug targets in emerging anticancer strategies. Thermodynamic characterization of G‐quadruplexes is an important and necessary step in developing predictive algorithms for evaluating the conformational preferences of G‐rich sequences in the presence or the absence of their complementary C‐rich strands. We use a combination of spectroscopic, calorimetric, and volumetric techniques to characterize the folding/unfolding transitions of the 26‐meric human telomeric sequence d[A₃G₃(T₂AG₃)₃A₂]. In the presence of K⁺ ions, the latter adopts the hybrid‐1 G‐quadruplex conformation, a tightly packed structure with an unusually small number of solvent‐exposed atomic groups. The K⁺‐induced folding of the G‐quadruplex at room temperature is a slow process that involves significant accumulation of an intermediate at the early stages of the transition. The G‐quadruplex state of the oligomeric sequence is characterized by a larger volume and compressibility and a smaller expansibility than the coil state. These results are in qualitative agreement with each other all suggesting significant dehydration to accompany the G‐quadruplex formation. Based on our volume data, 432 ± 19 water molecules become released to the bulk upon the G‐quadruplex formation. This large number is consistent with a picture in which DNA dehydration is not limited to water molecules in direct contact with the regions that become buried but involves a general decrease in solute–solvent interactions all over the surface of the folded structure. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 216–227, 2014.     

Confirming therapeutic target of protopine using immobilized β2‐adrenoceptor coupled with site‐directed molecular docking and the target‐drug interaction by frontal analysis and injection amount–dependent method

Drug‐protein interaction analysis is pregnant in designing new leads during drug discovery. We prepared the stationary phase containing immobilized β₂‐adrenoceptor (β ₂‐ AR) by linkage of the receptor on macroporous silica gel surface through N ,N ′‐carbonyldiimidazole method. The stationary phase was applied in identifying antiasthmatic target of protopine guided by the prediction of site‐directed molecular docking. Subsequent application of immobilized β ₂‐ AR in exploring the binding of protopine to the receptor was realized by frontal analysis and injection amount–dependent method. The association constants of protopine to β ₂‐ AR by the 2 methods were (1.00 ± 0.06) × 10⁵M⁻¹ and (1.52 ± 0.14) × 10⁴M⁻¹. The numbers of binding sites were (1.23 ± 0.07) × 10⁻⁷M and (9.09 ± 0.06) × 10⁻⁷M, respectively. These results indicated that β ₂‐ AR is the specific target for therapeutic action of protopine in vivo. The target‐drug binding occurred on Ser¹⁶⁹ in crystal structure of the receptor. Compared with frontal analysis, injection amount–dependent method is advantageous to drug saving, improvement of sampling efficiency, and performing speed. It has grave potential in high‐throughput drug‐receptor interaction analysis.     

Diverse modes of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐bifuran]‐5‐carboximidamide (DB832) interaction with multi‐stranded DNA structures

The modes of binding of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐Bifuran]‐5‐carboximidamide (DB832) to multi‐stranded DNAs: human telomere quadruplex, monomolecular R‐triplex, pyr/pur/pyr triplex consisting of 12 T*(T·A) triplets, and DNA double helical hairpin were studied. The optical adsorption of the ligand was used for monitoring the binding and for determination of the association constants and the numbers of binding sites. CD spectra of DB832 complexes with the oligonucleotides and the data on the energy transfer from DNA bases to the bound DB832 assisted in elucidating the binding modes. The affinity of DB832 to the studied multi‐stranded DNAs was found to be greater (K_ass ≈ 10⁷M^?1) than to the duplex DNA (K_ass ≈ 2 × 10⁵M^?1). A considerable stabilizing effect of DB832 binding on R‐triplex conformation was detected. The nature of the ligand tight binding differed for the studied multi‐stranded DNA depending on their specific conformational features: recombination‐type R‐triplex demonstrated the highest affinity for DB832 groove binding, while pyr/pur/pyr TTA triplex favored DB832 intercalation at the end stacking contacts and the human telomere quadruplex d[AG₃(T₂AG₃)₃] accommodated the ligand in a capping mode. Additionally, the pyr/pur/pyr TTA triplex and d[AG₃(T₂AG₃)₃] quadruplex bound DB832 into their grooves, though with a markedly lesser affinity. DB832 may be useful for discrimination of the multi‐sranded DNA conformations and for R‐triplex stabilization. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 8–20, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

A cytotoxicity,optical spectroscopy and computational binding analysis of 4‐[3‐acetyl‐5‐(acetylamino)‐2‐methyl‐2,3‐dihydro‐1,3,4‐thiadiazole‐2‐yl]phenyl benzoate in calf thymus DNA

In this study the interaction mechanism between newly synthesized 4‐(3‐acetyl‐5‐(acetylamino)‐2‐methyl‐2, 3‐dihydro‐1,3,4‐thiadiazole‐2‐yl) phenyl benzoate (thiadiazole derivative) anticancer active drug with calf thymus DNA was investigated by using various optical spectroscopy techniques along with computational technique. The absorption spectrum shows a clear shift in the lower wavelength region, which may be due to strong hypochromic effect in the ctDNA and the drug. The results of steady state fluorescence spectroscopy show that there is static quenching occurring while increasing the thiadiazole drug concentration in the ethidium bromide‐ctDNA system. Also the binding constant (K), thermo dynamical parameters of enthalpy change (ΔH°), entropy change (ΔS°) Gibbs free energy change (ΔG°) were calculated at different temperature (293 K, 298 K) and the results are in good agreement with theoretically calculated MMGBSA binding analysis. Time resolved emission spectroscopy analysis clearly explains the thiadiazole derivative competitive intercalation in the ethidium bromide‐ctDNA system. Further, molecular docking studies was carried out to understand the hydrogen bonding and hydrophobic interaction between ctDNA and thiadiazole derivative molecule. In addition the docking and molecular dynamics charge distribution analysis was done to understand the internal stability of thiadiazole derivative drug binding sites of ctDNA. The global reactivity of thiadiazole derivative such as electronegativity, electrophilicity and chemical hardness has been calculated.     

RPA prevents G‐rich structure formation at lagging‐strand telomeres to allow maintenance of chromosome ends

Replication protein A (RPA) is a highly conserved heterotrimeric single‐stranded DNA‐binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1‐D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging‐strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G‐quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G‐quadruplex. We propose that RPA prevents the formation of G‐quadruplex structures at lagging‐strand telomeres to promote shelterin association and facilitate telomerase action at telomeres.     

Revealing binding interaction between seven drugs and immobilized β2‐adrenoceptor by high‐performance affinity chromatography using frontal analysis

The development of new approaches to study the affinity between ligands and G‐protein‐coupled receptors proves to be of growing interest for pharmacologists, chemists, and biologists. The aim of this work was to determine the binding of seven drugs to β₂‐adrenoceptors by frontal analysis using immobilized receptor stationary phase. The dissociation constants (K_d) were determined to be (3.16 ± 0.09) × 10^?4 M for salbutamol, (4.29 ± 0.12) × 10^?4 M for terbutaline, (6.19 ± 0.16) × 10^?4 M for methoxyphenamine, (2.11 ± 0.07) × 10^?4 M for tulobuterol, (1.82 ± 0.11) × 10^?4 M for fenoterol, (9.75 ± 0.24) × 10^?6 M formoterol, and (9.84 ± 0.26) × 10^?5 M for clenbuterol. These results showed a good correlation with the data determined by radioligand binding assay. Further investigations revealed that the dissociation constant mainly attributed to the number of hydrogen bonds in the structures of ligands. This study indicates that affinity chromatography using immobilized receptor stationary phase can be used for the direct determination of drug‐receptor binding interactions and has the potential to become a reliable alternative for quantitative studies of ligand–receptor interactions. Copyright © 2013 John Wiley & Sons, Ltd.     

Relative stability of G‐quadruplex structures: Interactions between the human Bcl2 promoter region and derivatives of carbazole and diphenylamine

The bcl2 promoter region forms a G‐quadruplex structure, which is a crucial target for anticancer drug development. In this study, we provide theoretical predictions of the stability of different G‐quadruplex folds of the 23‐mer bcl2 promoter region and G‐quadruplex ligand. We take into account the whole G‐quadruplex structure, including bound‐cations and solvent effects, in order to compute the ligand binding free energy using molecular dynamics simulation. Two series of the carbazole and diphenylamine derivatives are used to screen for the most potent drug in terms of stabilization. The energy analysis identifies the predominant energy components affecting the stability of the various different G‐quadruplex folds. The energy associated with the stability of the G‐quadruplex‐K⁺ structures obtained displays good correlation with experimental T_m measurements. We found that loop orientation has an intrinsic influence on G‐quadruplex stability and that the basket structure is the most stable. Furthermore, parallel loops are the most effective drug binding site. Our studies also demonstrate that rigidity and planarity are the key structural elements of a drug that stabilizes the G‐quadruplex structure. BMVC‐4 is the most potential G‐quadruplex ligand. This approach demonstrates significant promise and should benefit drug design. © 2014 Wiley Periodicals, Inc. Biopolymers 101: 1038–1050, 2014.     

Characterization of intermolecular interaction between cyanidin‐3‐glucoside and bovine serum albumin: Spectroscopic and molecular docking methods

The intermolecular interaction between cyanidin‐3‐glucoside (Cy‐3‐G) and bovine serum albumin (BSA) was investigated using fluorescence, circular dichroism and molecular docking methods. The experimental results revealed that the fluorescence quenching of BSA at 338 nm by Cy‐3‐G resulted from the formation of Cy‐3‐G–BSA complex. The number of binding sites (n) for Cy‐3‐G binding on BSA was approximately equal to 1. The experimental and molecular docking results revealed that after binding Cy‐3‐G to BSA, Cy‐3‐G is closer to the Tyr residue than the Trp residue, the secondary structure of BSA almost not change, the binding process of Cy‐3‐G with BSA is spontaneous, and Cy‐3‐G can be inserted into the hydrophobic cavity of BSA (site II′) in the binding process of Cy‐3‐G with BSA. Moreover, based on the sign and magnitude of the enthalpy and entropy changes (ΔH⁰ = – 29.64 kcal/mol and ΔS⁰ = – 69.51 cal/mol K) and the molecular docking results, it can be suggested that the main interaction forces of Cy‐3‐G with BSA are Van der Waals and hydrogen bonding interactions. Copyright © 2013 John Wiley & Sons, Ltd.     

ILPR repeats adopt diverse G‐quadruplex conformations that determine insulin binding

The insulin‐linked polymorphic region (ILPR) is a VNTR region located upstream of the insulin (INS) gene consisting of the repeat 5′‐ACAGGGGTGTGGGG (repeat a) and several less abundant sequence repeats (b–n). Here, we have investigated the structural polymorphism of G‐quadruplexes formed from the most common repeat sequences (a–c) and their effect on insulin protein binding. We first established that the ILPR repeats “b” and “c” can form quadruplex structures. Insulin has previously been shown to bind a G‐quadruplex formed by a dimer of the repeat “a”. Our findings show that insulin binds preferentially to the repeat “a” G‐quadruplex (K_d = 0.17 ± 0.03 μM) over G‐quadruplexes formed from other ILPR repeats that were tested (K_ds from 0.71 ± 0.15 to 1.07 ± 0.09 μM). Additionally, the Watson‐Crick complementary relationship between the loop regions of repeat “a” (ACA and TGT) seemingly play an important role in favoring a specific G‐quadruplex conformation, which based on our data is critical for insulin binding. Affinity for insulin is reduced in sequences lacking the putative WC complementarity, however upon engineered restoration of complementarity, insulin binding is recovered. A DMS footprinting assay on the repeat “a” G‐quadruplex in the presence of insulin, combined with binding affinities for ILPR mutants led to identification of a loop nucleotide critical for binding. Uniquely, insulin shows clear preference for binding to the G‐quadruplexes with the more antiparallel feature. Collectively, our results illustrate the specific nature of insulin binding to the ILPR G‐quadruplexes and begin to provide molecular details on such interactions. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 21–31, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

2‐Hydroxynaphthalene‐1‐carbaldehyde‐ and 2‐(Aminomethyl)pyridine‐Based Schiff Base CuII Complexes for DNA Binding and Cleavage

Three mononuclear Cu^II complexes, [CuCl(naph‐pa)] ( 1 ), [Cu(bipy)(naph‐pa)]Cl ( 2 ), and [Cu(naph‐pa)(phen)]Cl ( 3 ) ((naph‐pa)=Schiff base derived from the condensation of 2‐hydroxynaphthalene‐1‐carbaldehyde and 2‐picolylamine (=2‐(aminomethyl)pyridine), bipy=2,2′‐bypiridine, and phen=1,10‐phenanthroline) were synthesized and characterized. Complex 1 exhibits square‐planar geometry, and 2 and 3 exhibit square pyramidal geometry, where Schiff base and bipy/phen act as NNO and as NN donor ligands, respectively. CT (Calf thymus)‐DNA‐binding studies revealed that the complexes bind through intercalative mode and show good binding propensity (intrinsic binding constant K_b: 0.98×10⁵, 2.22×10⁵, and 2.67×10⁵ M ^?1 for 1 – 3 , resp.). The oxidative and hydrolytic DNA‐cleavage activity of these complexes has been studied by gel electrophoresis: all the complexes displayed chemical nuclease activity in the presence and absence of H₂O₂. From the kinetic experiments, hydrolytic DNA cleavage rate constants were determined as 2.48, 3.32, and 4.10 h^?1 for 1 – 3 , respectively. It amounts to (0.68–1.14)×10⁸‐fold rate enhancement compared to non‐catalyzed DNA cleavage, which is impressive. The complexes display binding and cleavage propensity to DNA in the order of 3 > 2 > 1 .     

Chemiluminescence method for the determination of piroxicam by the enhancement of the tris‐(4,7‐diphenyl‐1,10‐phenanthrolinedisulphonic acid) ruthenium(II) (RuBPS)–cerium(IV) system and its application

A simple, rapid chemiluminescence (CL) method was described for the determination of piroxicam, a commonly used analgesic agent drug. A strong CL signal was detected when cerium(IV) sulphate was injected into tris‐(4,7‐diphenyl‐1,10‐phenanthrolinedisulphonic acid) ruthenium(II) (RuBPS)–piroxicam solution. The CL signal was proportional to the concentration of piroxicam in the range 2.8 × 10^–8–1.2 × 10^–5 mol/L. The detection limit was 2 × 10^–8 mol/L and the relative standard deviation (RSD) was 3.7% (c = 7.0 × 10^–7 mol/L piroxicam; n = 11). The proposed method was applied to the determination of piroxicam in pharmaceutical preparations in capsules, spiked serum and urine samples with satisfactory results. Copyright © 2008 John Wiley & Sons, Ltd.     

Evaluation of Staphylococcus aureus DNA aptamer by enzyme‐linked aptamer assay and isothermal titration calorimetry

To monitor the specificity of Staphylococcus aureus aptamer (SA‐31) against its target cell, we used enzyme‐linked aptamer assay. In the presence of target cell, horseradish peroxidase–conjugated streptavidin bound to biotin‐labeled SA‐31 showed specific binding to S   aureus among 3 different bacteria with limit of detection of 10³ colony‐forming unit per milliliter. The apparent K _a was 1.39 μM⁻¹ ± 0.3 μM⁻¹. The binding of SA‐31 to membrane proteins extracted from cell surface was characterized using isothermal titration calorimetry, and the effect of changes in binding temperature and salt concentrations of binding buffer was evaluated based on thermodynamic parameters (K _a, ΔH , and ΔG ). Since binding of aptamer to its targets solely depends on its 3‐dimensional structure under experimental conditions used in selection process, the change in temperature and ion concentration changed the affinity of SA‐31 to its target on surface of bacteria. At 4°C, SA‐31 did not show an affinity to its target with poor heat change upon injection of membrane fraction to aptamer solution. However, the apparent association constants of SA‐31 slightly varied from K _a = 1.56 μM⁻¹ ± 0.69 μM⁻¹ at 25°C to K _a = 1.03 μM⁻¹ ± 0.9 μM⁻¹ at 37°C. At spontaneously occurring exothermic binding reactions, affinities of S  aureus aptamer to its target were also 9.44 μM⁻¹ ± 0.38 μM⁻¹ at 50mM, 1.60 μM⁻¹ ± 0.11 μM⁻¹ at 137mM, and 3.28 μM⁻¹ ± 0.46 μM⁻¹ at 200 mM of salt concentration. In this study, it was demonstrated that enzyme‐linked aptamer assay and isothermal titration calorimetry were useful tools for studying the fundamental binding mechanism between a DNA aptamer and its target on the outer surface of S  aureus .     

Binding properties of human telomeric quadruplex multimers: a new route for drug design

Human telomeric G-quadruplex structures are known to be promising targets for an anticancer therapy. In the past decade, several research groups have been focused on the design of new ligands trying to optimize the interactions between these small molecules and the G-quadruplex motif. In most of these studies, the target structures were the single quadruplex units formed by short human DNA telomeric sequences (typically 21-26 nt). However, the 3′-terminal single-stranded human telomeric DNA is actually 100-200 bases long and can form higher-order structures by clustering several consecutive quadruplex units (multimers). Despite the increasing number of structural information on longer DNA telomeric sequences, very few data are available on the binding properties of these sequences compared with the shorter DNA telomeric sequences.In this paper we use a combination of spectroscopic (CD, UV and fluorescence) and calorimetric techniques (ITC) to compare the binding properties of the (TTAGGG)₈TT structure formed by two adjacent quadruplex units with the binding properties of the (AG₃TT)₄ single quadruplex structure. The three side-chained triazatruxene derivative azatrux and TMPyP4 cationic porphyrin were used as quadruplex ligands. We found that, depending on the drug, the number of binding sites per quadruplex unit available in the multimer structure was smaller or greater than the one expected on the basis of the results obtained from individual quadruplex binding studies. This work suggests that the quadruplex units along a multimer structure do not behave as completely independent. The presence of adjacent quadruplexes results in a diverse binding ability not predictable from single quadruplex binding studies. The existence of quadruplex-quadruplex interfaces in the full length telomeric overhang may provide an advantageous factor in drug design to enhance both affinity and selectivity for DNA telomeric quadruplexes.