DNA-binding cytotoxic alkaloids: comparative study of the energetics of binding of berberine, palmatine, and coralyne

Deoxyribonucleic acid is the site of storage and retrieval of genetic information through interaction with proteins and other small molecules. In the present study, the interaction of two natural cytotoxic protoberberine plant alkaloids, berberine and palmatine, and a synthetic derivative, coralyne, with mammalian herring testis DNA was investigated using a combination of isothermal titration calorimetry, differential scanning calorimetry, and optical melting experiments to characterize the energetics of their binding. The binding constants of these alkaloids to DNA under identical conditions were evaluated from the UV melting data, and the enthalpy of binding was elucidated from isothermal titration studies. The binding constants of berberine, palmatine, and coralyne to DNA were found to be 1.15 x 10(4), 2.84 x 10(4), and 3.5 x 10(6) M(-1) at 20 degrees C in buffer of 20 mM [Na+]. Parsing of the free energy change of the interaction observed into polyelectrolytic and nonpolyelectrolytic components suggested that although these alkaloids are charged, the major contributor of about 75% of the binding free energy arises from the nonpolyelectrolytic forces. The binding in case of palmatine and coralyne was predominantly enthalpy driven with favoring smaller entropy terms, while that of berberine was favored by both negative enthalpy and positive entropy changes. Temperature dependence of the binding enthalpies determined from ITC studies in the range 20-40 degrees C was used to calculate the binding-induced change in heat capacity (DeltaC(o)(p)) values as -117, -135, and -157 cal/mol K, respectively, for berberine, palmatine, and coralyne. Taken together, the results suggest that the DNA binding of the planar synthetic coralyne is stronger and thermodynamically more favored compared to the buckled natural berberine and palmatine.     

Structural analysis of DNA interactions with biogenic polyamines and cobalt(III)hexamine studied by Fourier transform infrared and capillary electrophoresis

Biogenic polyamines, such as putrescine, spermidine, and spermine are small organic polycations involved in numerous diverse biological processes. These compounds play an important role in nucleic acid function due to their binding to DNA and RNA. It has been shown that biogenic polyamines cause DNA condensation and aggregation similar to that of inorganic cobalt(III)hexamine cation, which has the ability to induce DNA conformational changes. However, the nature of the polyamine.DNA binding at the molecular level is not clearly established and is the subject of much controversy. In the present study the effects of spermine, spermidine, putrescine, and cobalt(III)hexamine on the solution structure of calf-thymus DNA were investigated using affinity capillary electrophoresis, Fourier transform infrared, and circular dichroism spectroscopic methods. At low polycation concentrations, putrescine binds preferentially through the minor and major grooves of double strand DNA, whereas spermine, spermidine, and cobalt(III)hexamine bind to the major groove. At high polycation concentrations, putrescine interaction with the bases is weak, whereas strong base binding occurred for spermidine in the major and minor grooves of DNA duplex. However, major groove binding is preferred by spermine and cobalt(III)hexamine cations. Electrostatic attractions between polycation and the backbone phosphate group were also observed. No major alterations of B-DNA were observed for biogenic polyamines, whereas cobalt(III)hexamine induced a partial B --> A transition. DNA condensation was also observed for cobalt(III)hexamine cation, whereas organic polyamines induced duplex stabilization. The binding constants calculated for biogenic polyamines are K(Spm) = 2.3 x 10(5) M(-1), K(Spd) = 1.4 x 10(5) M(-1), and K(Put) = 1.02 x 10(5) M(-1). Two binding constants have been found for cobalt(III)hexamine with K(1) = 1.8 x 10(5) M(-1) and K(2) = 9.2 x 10(4) M(-1). The Hill coefficients indicate a positive cooperativity binding for biogenic polyamines and a negative cooperativity for cobalt(III)hexamine.     

Interaction study between double-stranded DNA and berberine using capillary zone electrophoresis

Two non-self-complementary 17-mer double-stranded DNA (dsDNA) with four different central base pairs were designed to systematically investigate the binding affinity and sequence specificity of berberine with dsDNA by capillary zone electrophoresis (CZE). The data analysis with the Kenndler model proved only low affinity between dsDNA and berberine and suggested some weak binding preference of berberine for AATT-containing to GGCC-containing dsDNA. The binding constant, Ka, between berberine and dsDNA(AB) was about (1.0 +/- 0.7) x 10(3) M(-1). In addition, the separation of single-stranded DNA (ssDNA) from dsDNA under simple electrophoretic conditions enabled CZE to be a potentially alternative tool to check the extent of DNA annealing, which is usually done by the time-consuming and labor-intensive slab electrophoresis.     

A comparative study of DNA complexation with Mg(II) and Ca(II) in aqueous solution: major and minor grooves bindings

Although structural differences for the Mg-DNA and Ca-DNA complexes are provided in the solid state, such comparative study in aqueous solution has been less investigated. The aim of this study was to examine the bindings of Mg and Ca cations with calf thymus DNA in aqueous solution at physiological pH, using constant concentration of DNA (1.25 or 12.5 mM) and various concentrations of metal ions (2 microM-650 microM). Capillary electrophoresis, UV-visible, and Fourier transform infrared spectroscopic methods were used to determine the cation-binding modes, the binding constants, and DNA structural variations in aqueous solution. Direct Ca-PO(2) binding was evident by major spectral changes (shifting and splitting) of the backbone PO(2) asymmetric stretching at 1222 cm(-1) with K = 4.80 x 10(5) M(-1), whereas an indirect Mg-phosphate interaction occurred (due to the lack of shifting and splitting of the phosphate band at 1222 cm(-1)) with K = 5.6 x 10(4) M(-1). The metal-base bindings were directly for the Mg with K = 3.20 x 10(5) M(-1) and indirectly for the Ca cation with K = 3.0 x 10(4) M(-1). Both major and minor groove bindings were observed with no alteration of the B-DNA conformation.     

Tuning of intercalation and electron-transfer processes between DNA and acridinium derivatives through steric effects

A series of acridinium derivatives 1-6, wherein steric factors have been varied systematically through substitution at the 9 position of the acridine ring, have been synthesized and their DNA interactions have been investigated by various biophysical techniques. The unsubstituted and methylacridinium derivatives 1 and 2 and the o-tolylacridinium derivative 6 exhibited high fluorescence quantum yields (Phi(f)() congruent with 1) and lifetimes (tau = 35, 34, and 25 ns, respectively), when compared with the arylacridinium derivatives 3-5. The acridinium derivatives 1 and 2 showed high DNA binding affinity (K = 7.3-7.7 x 10(5) M(-)(1)), when compared to the arylacridinium derivatives 3-5 (K = 6.9-10 x 10(4) M(-)(1)). DNA melting and viscosity studies establish that in the case of the aryl-substituted systems, the efficiency of DNA binding is in the order, phenyl > p-tolyl > m-tolyl > o-tolyl derivative. The increase in steric crowding around the acridine ring hinders the DNA binding interactions and thereby leads to negligible binding as observed in the case of 6 (o-tolyl derivative). These results indicate that a subtle variation in the substitution pattern has a profound influence on the photophysical and DNA interactions. Further, they demonstrate that pi-stacking interactions of the ligands with DNA are essential for efficient electron transfer between the DNA bases and the ligands. These water soluble and highly fluorescent molecules which differ in their DNA binding mode can act as models to study various DNA-ligand interactions.     

DNA interaction with saffron's secondary metabolites safranal, crocetin, and dimethylcrocetin

Saffron comes from the dried red stigmas of the Crocus sativus L. flower. Except for its use in cooking and in traditional medicine, it has numerous applications as an antitoxic, antioxidant, and anticancer agent due to its secondary metabolites and their derivatives (safranal, crocins, crocetin, dimethylcrocetin). However, there has been no information on the interactions of these secondary metabolites with individual DNA at molecular level. This study was designed to examine the interaction of safranal, crocetin (CRT), and dimethylcrocetin (DMCRT) with calf-thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.25 mM) and various drug/DNA(phosphate) molar ratios from 1/48 to 1/2. FTIR and UV-visible difference spectroscopic methods are used to determine the drug binding sites, the binding constants, and the effects of carotenoids and safranal complexation on the stability and conformation of DNA duplex. Both intercalative and external binding modes were observed, with overall binding constants K(safranal) = 1.24 x 10(3) M(-1), K(CRT) = 6.2 x 10(3) M(-1) and K(DMCRT) = 1.85 x 10(5) M(-1) A partial B- to A-DNA transition occurs at high carotenoids and safranal concentrations.     

The two modes of binding of Ru(phen)(2)dppz(2+) to DNA: thermodynamic evidence and kinetic studies

The binding of Ru(phen)(2)dppz(2+) (dppz=dipyrido[3,2-a:2',3'-c]phenazine) to DNA was investigated at pH 7.0 and 25 degrees C using stopped-flow and spectrophotometric methods. Equilibrium measurements show that two modes of binding, whose characteristics depend on the polymer to dye ratio (C(P)/C(D)), are operative. The binding mode occurring for values of C(P)/C(D) higher than 3 exhibits positive cooperativity, which is confirmed by kinetic experiments. The reaction parameters are K=2 x 10(3)M(-1), omega=550, n=1, k(r)=(1.9+/-0.5) x 10(7)M(-1)s(-1) and k(d)=(9.5+/-2.5)x10(3)s(-1) at I=0.012 M. The results are discussed in terms of prevailing surface interaction with DNA grooves accompanied by partial intercalation of the dppz residue. The other binding mode becomes operative for C(P)/C(D)<3 and the equilibria analysis shows this is an ordinary intercalation mode (K=1.3 x 10(6) M(-1), n=1.5 at I=0.012 M and K=2 x 10(5) M(-1), n=1.2 at I=0.21 M). Similar behaviour is displayed by double-stranded poly(A).     

DNA adducts with antioxidant flavonoids: morin, apigenin, and naringin

Flavonoids have recently attracted a great interest as potential therapeutic drugs against a wide range of free-radical-mediated diseases. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. While the antioxidant activity of these natural polyphenolic compounds is well known, their bindings to DNA are not fully investigated. This study was designed to examine the interactions of morin (Mor), naringin (Nar), and apigenin (Api) with calf thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.25 mM) and various drug/DNA(phosphate) ratios of 1/40 to 1. FTIR and UV-Vis spectroscopic methods were used to determine the ligand binding modes, the binding constant, and the stability of DNA in flavonoid-DNA complexes in aqueous solution. Spectroscopic evidence shows both intercalation and external binding of flavonoids to DNA duplex with overall binding constants of K(morin) = 5.99 x 10(3) M(-1), K(apigenin) = 7.10 x 10(4) M(-1), and K(naringin) = 3.10 x 10(3) M(-1). The affinity of ligand-DNA binding is in the order of apigenin > morin > naringin. DNA aggregation and a partial B- to A-DNA transition occurs upon morin, apigenin, and naringin complexation.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Cleavage of DNA by electrochemically activated MnIII and FeIII complexes of meso-tetrakis (N-methyl-4-pyridiniumyl)porphine

Electrochemical methods were used to activate MnIII and FeIII complexes of meso-tetrakis(N-methyl-4-pyridiniumyl)porphine (H2TMPyP) to cause cleavage of pBR322 DNA and to study their interaction with sonicated calf thymus DNA. Electrochemical reduction of MnIIITMPyP and FeIIITMPyP (at low concentrations) in the presence of O2 was required to activate these complexes. However, FeIIITMPyP at 1 x 10(-6) M produced DNA strand breakage without being electrochemically reduced. At low concentrations, FeIITMPyP was more efficient at cleaving DNA than MnIITMPyP. Reduction of O2 at a platinum electrode also produced some cleavage but to a much smaller extent. The oxidized form of MnIIITMPyP (charge 5+) has higher affinity for sonicated calf thymus (CT) DNA than the reduced form (charge 4+), as determined by the negative shift in E degrees' for the voltammetric wave in the presence of DNA. Both forms of FeIIITMPyP (charge 4+) interact with DNA to about the same extent. Differential pulse voltammetry was used to determine binding constants (K) and binding-site sizes (s) of the interaction of these metalloporphyrins with sonicated CT DNA. The data were analyzed assuming both mobile and static equilibria. MnIIITMPyP binds to DNA (5 mM Tris, 50 mM NaCl, pH 7) with K = 5 (+/- 2) x 10(6) M-1, s = 3 bp (mobile) or K = 3.6 (+/- 0.3) x 10(6) M-1, s = 4 bp (static). FeIIITMPyP at that ionic strength caused DNA precipitation. At higher ionic strength (0.1 M Tris, 0.1 M NaCl, pH 7), FeIIITMPyP associates to DNA with K = 4.4 (+/- 0.2) x 10(4) M-1, s = 5 bp (mobile) or K = 1.9 (+/- 0.1) x 10(4) M-1, s = 6 bp (static).     

Electrochemical investigation on interaction between DNA with quercetin and Eu-Qu3 complex

The interactions of quercetin (Qu) and Eu-Qu3 complex with calf thymus DNA were studied using cyclic voltammetry (CV) and double potential step chronocoulometry (DPSCC) at glass carbon electrode (GCE) for the surface method. The method is simple, convenient, reliable, reagent saving. Information such as intrinsic binding constant (K), and binding numbers (n) of bound species per DNA (bp), ratio (K(Ox)/K(Red)) of the binding constants for the oxidized and reduced forms of a bound species and interaction mode was obtained using dsDNA-modified GCE. Quercetin and Eu-Qu3 can both bind to DNA, but quercetin binds to DNA mainly by electrostatic attraction and the complex bind to DNA by both intercalation and electrostatic attraction. For the quercetin/dsDNA-modified GCE systems, a K of (3.80+/-0.3) x 10(4) M(-1), saturation coverage value (Gammas) of (2.28+/-0.2) x 10(-10) mol/cm2 and n of 1.2 were obtained. For the complex system, a saturation coverage value (Gammas) of 1.65 x 10(-10) mol/cm2 and n of 1.8 were obtained.     

Study of DNA interactions with steroidal and nonsteroidal estrogen-platinum (II)-based anticancer drugs

The interactions of the steroidal and nonsteroidal estrogen-platinum (Pt) (II)-based anticancer drugs 16beta-hydroxymethyl-16alpha-[8-(2-pyridin-2-yl-ethylamino)-3,6-dioxaoctyl]-1,3,5(10)-estratrien-3,17betadiol dichloroplatinum (II) (JPM-39), 4-[6-(2'-pyridylethylamino)-butyloxy)-phenyl]-7-methoxy-2,2-dimethyl-3-phenyl-chroman dichloroplatinum (II) (ATG-99), and 1-[(2-aminoethyl)amino]-9,10,10-tris(4-hydroxyphenyl)-9-decene dichloroplatinum (II) (GEB-28) with calf-thymus DNA in vitro using constant DNA concentration and various drug levels were studied. Fourier transform infrared (FTIR) and circular dichroism (CD) were studied with calf-thymus DNA in vitro using constant DNA concentration and various drug levels. FTIR, UV-visible, and CD spectroscopic methods were used to characterize the drug binding mode, the binding constant, and structural variations of DNA in aqueous solution. Spectroscopic evidence showed that the various Pt-based drugs bind indirectly to the major and minor grooves of DNA duplex with some degree of drug-phosphate interaction. The overall binding constants for JPM-39, GEB-28, and ATG-99 are K(JPM-39) = 4.2 (+/-0.75) x 10(3) M(-1), K(GEB-28) = 3.4 (+/-0.65) x 10(3) M(-1), and K(ATG-99) = 2.1 (+/-0.45) x 10(3) M(-1). DNA aggregation occurs at high drug concentration, while DNA remains in the B-family structure.     

DNA interaction with antitumor polyamine analogues: a comparison with biogenic polyamines

Biogenic polyamines, putrescine, spermidine, and spermine, are ubiquitous cellular cations and exert multiple biological functions. Polyamine analogues mimic biogenic polyamines at macromolecular level but are unable to substitute for natural polyamines and maintain cell proliferation, indicating biomedical applications. The mechanistic differences in DNA binding mode between natural and synthetic polyamines have not been explored. The aim of this study was to examine the interaction of calf thymus DNA with three polyamine analogues, 1,11-diamino-4,8-diazaundecane (333), 3,7,11,15-tetrazaheptadecane x 4 HCl (BE-333), and 3,7,11,15,19-pentazahenicosane x 5 HCl (BE-3333), using FTIR, UV-visible, and CD spectroscopy. Polyamine analogues bind with guanine and backbone PO2 group as major targets in DNA, whereas biogenic polyamines bind to major and minor grooves as well as to phosphate groups. Weaker interaction with DNA was observed for analogues with respect to biogenic polyamines, with K(333) = 1.90 (+/-0.5) x 10(4) M(-1), K(BE-333) = 6.4 (+/-1.7) x 10(4) M(-1), K(BE-3333) = 4.7 (+/-1.4) x 10(4) M(-1) compared to K(Spm) = 2.3 (+/-1.1) x 10(5) M(-1), K(Spd) = 1.4 (+/-0.6) x 10(5) M(-1), and K(Put) = 1.02 (+/-0.5) x 10(5) M(-1). A partial B- to A-DNA transition was also provoked by analogues. These data suggest distinct differences in the binding of natural and synthetic polyamines with DNA.     

The binding of polyamines and magnesium to DNA.

1. The binding of spermine and Mg2+ to DNA has been investigated using the dye arsenazo III to measure unbound cations. 2. The apparent dissociation constant, Kd, of DNA for spermine has been found to be 7.4 +/- 3.9 x 10(-8) M and that for Mg2+, 6.5 +/- 3.3 x 10(-7) M. 3. Binding of spermine in the presence of 1 mM Mg2+ has been shown to have a Kd of about 4 x 10(-6) M. 4. Magnesium ion (2 mM) halves the concentration of spermine needed to cause DNA aggregation. 5. Spermidine binds to DNA with a similar affinity to spermine but 3,3'-iminobispropylamine and 1,5,9,13-tetra-azatridecane bind with a lower affinity. The naturally occurring polyamines thus have a higher affinity for DNA than the related polyamines which do not occur naturally. 6. Binding of spermine or spermidine to DNA alters the spectrophotometric absorbance of DNA at 260 nm.     

Binding of Cu2+ to S-adenosyl-L-homocysteine hydrolase

S-Adenosylhomocysteine (AdoHcy) hydrolase regulates biomethylation and homocysteine metabolism. It has been proposed to be a copper binding protein playing an important role in copper transport and distribution. In the present work, the kinetics of binding and releasing of copper ions was studied using fluorescence method. The dissociation constant for copper ions with AdoHcy hydrolase was determined by fluorescence quenching titration and activity titration methods using ethylenediaminetetraacetic acid (EDTA), nitrilotriacetic acid (NTA), and glycine as competitive chelators. The experimental results showed that copper ions bind to AdoHcy hydrolase with a K(d) of approximately 10(-11) M. The association rate constant was determined to be 7 x 10(6) M(-1)s(-1). The releasing of copper ions from the enzyme was found to be biphasic with a k(1) of 2.8 x 10(-3) s(-1) and k(2) of 1.7x10(-5) s(-1). It is suggested that copper ions do not bind to the substrate binding sites because the addition of adenine substrate did not compete with the binding of copper to AdoHcy hydrolase. Interestingly, it was observed that EDTA could bind to AdoHcy hydrolase with a dissociation constant of K(1) = 8.0 x 10(-5) M and result in an increased affinity (K(d) = approximately 10(-17) M) of binding of copper ions to the enzyme.     

Thymol and carvacrol binding to DNA: model for drug-DNA interaction

Thymol and carvacrol can bind to major and minor grooves of B-DNA. The aim of this study was to examine the interaction of calf thymus DNA with thymol and carvacrol in aqueous solution and physiological pH with thymol/DNA and carvacrol/DNA (phosphate) molar ratios of 1/20, 1/10, 1/5, and 1/1. Fourier transform infrared and UV-visible difference spectroscopy were used to determine the thymol and carvacrol binding mode, binding constant, sequence selectivity, DNA secondary structure, and structural variations of thymol/DNA and carvacrol/DNA complexes in aqueous solution. Spectroscopic evidence showed that the thymol and carvacrol interaction occurred mainly through H-bonding of the thymol and carvacrol OH group to the guanine N7, cytosine N3, and backbone phosphate group with overall binding constant of K(thymol-DNA) = 2.43 x 10(3) M(-1), K(carvacrol-DNA) = 1.55 x 10(3) M(-1). In thymol and carvacrol-DNA complexes, DNA remains in the B-family structure.     

Enantioselective plasma protein binding of propafenone: mechanism, drug interaction, and species difference

The interaction of propafenone (PPF) enantiomers with human plasma, human serum albumin (HSA), alpha(1)-acid glycoprotein (AGP), as well as with plasma from rat, rabbit, and cow was investigated using indirect chiral high performance liquid chromatography (HPLC) and ultrafiltration techniques. The stronger binding of the S-PPF found in human plasma was due to AGP. Two classes of binding sites in AGP were identified: one with high-affinity and small binding capacity (K(1(S)) = 7.65 x 10(6) M(-1), n(1(S)) = 0.50; K(1(R)) = 2.81 x 10(6) M(-1), n(1(R)) = 0.46), which revealed stereoselectivity; the other with low-affinity and high-binding capacity (n(2(S)) K(2(S)) = 9.95 x 10(3) M(-1); n(2(R)) K(2(R)) = 9.74 x 10(3) M(-1)). The binding to HSA was found to be weak and not enantioselective (nK(S) = 2.08 x 10(3) M(-1), nK(R) = 2.05 x 10(3) M(-1)). The interaction between enantiomers observed in human plasma was confirmed as a competitive type interacting at the high-affinity site in AGP. The binding mode of both enantiomers with AGP was mainly hydrophobic bond. PPF enantiomers had higher-binding affinity for the F-S variant of human AGP. Drug-drug binding interaction studies showed that verapamil, diazepam, nifedipine, furosemide, nitrendipine, and nimodipine did not affect the binding of PPF enantiomers except quinidine and aprindine at the therapeutic concentration. Comparative studies indicated considerable species-dependent binding stereoselectivity between plasma of the four species investigated.