Binding of mammalian ribosomes to MS2 phage RNA reveals an overlapping gene encoding a lysis function.

The main binding site for mammalian ribosomes on the single-stranded RNA of bacteriophage MS2 is located nine tenths of the way through the coat protein gene. Translation initiated at an AUG triplet in the +1 frame yields a 75 amino acid polypeptide which terminates within the synthetase gene at a UAA codon, also in the +1 frame. Partial amino acid sequence analysis of the product synthesized in relatively large amounts by mammalian ribosomes confirms this assignment of the overlapping cistron. The same protein is made in an E. coli cell-free system, but only in very small amounts. Analysis of the translation products directed by RNA from op3, a UGA nonsense mutant of phage f2, identifies the overlapping cistron as a lysis gene. In this paper we show that the op3 mutation is a C yield U transition occurring in the second codon of the synthetase cistron, which explains the lowered production of phage replicase (as well as lack of lysis) upon op3 infection of nonpermissive cells. We discuss the properties of the overlapping gene in relation to its lysis function, recognition of the lysis initiator region by E. coli versus eucaryotic ribosomes and op3 as a ribosome binding site mutant for the f2 synthetase cistron.     

Differential stimulation by polyamines of phage RNA-directed synthesis of proteins

The effect of polyamines on Q beta and MS2 phage RNA-directed synthesis of three kinds of protein in an Escherichia coli cell-free system has been studied. With both phage RNAs, the degree of stimulation of protein synthesis by spermidine was in the order RNA replicase greater than A protein, while the synthesis of coat protein was not stimulated significantly by spermidine. The synthesis of RNA replicase was stimulated by 1 mM spermidine approx. 8-fold. From the results of Q beta RNA direct alanyl-tRNA and seryl-tRNA binding to ribosomes and initiation dipeptide synthesis, it is suggested that the preferential stimulation of the synthesis of RNA replicase by spermidine is due at least partially to the stimulation of the initiation of RNA replicase synthesis.     

Studies on the bacteriophage MS2. XVI. The termination signal of the A protein cistron

The RNA of bacteriophage MS2 codes for three viral proteins: the coat protein, the A protein and the replicase. Upon infection of various amber suppressor strains of Escherichia coli, we found a fourth viral protein, the synthesis of which was specifically dependent on the presence of an amber suppressor gene. It is shown that this polypeptide is formed by reading through the natural termination signal of the A protein cistron. This cistron therefore terminates with the nonsense codon UAG. The observed prolongation accounts for the addition of some 30 amino acids. Unlike the normal A protein, the longer polypeptide is probably not incorporated into mature phage particles.     

Interference with viral infection by RNA replicase deleted at the carboxy-terminal region

Escherichia coli cells harboring an altered Q beta RNA replicase which has amino acid substitutions of the glycine residue at position 357 in the conserved sequence Tyr356-Gly357-Asp358-Asp359 of the beta-subunit protein lost the replicase activity but interfered with proliferation of Q beta phage [Inokuchi and Hirashima (1987) J. Virol. 61, 3946-3949]. To examine the mechanism of the interference, we further analyzed various mutants lacking the carboxy-terminal region of the beta-subunit protein. The cells expressing the beta-subunit gene with up to 17% deletion from the carboxy-terminus of the protein prevented the proliferation of Q beta phage. However, in the case that the deletion extended beyond 25% from the carboxy-terminus, the cells showed no interference. In addition, when the interference took place, the phage coat protein synthesis was inhibited. These results indicate that the region between amino acids 440 and 487 of the beta-subunit protein is involved in the interference and suggest that the defective replicase inhibits the phage coat protein synthesis by competing with the ribosomes at the initiation site of the coat gene.     

The ratio of coat protein to bacteriophage f2 RNA in the translational repressor complex]

One of the mechanisms underlying the regulation of the bacteriophage f2 RNA translation is the repression of the phage RNA-replicase formation by coat protein. This repression is due to the formation of a complex between f2 RNA and coat protein (complex I). In this work the mechanism of complex I formation as well as the effect of this complex on the f2 RNA-replicase formation was followed by inhibition of alanine incorporation into RNA-replicase polypeptide which was separated by polyacrylamide gel electrophoresis. The molar ratios of protein to f2 RNA in complex I were analyzed by sucrose gradient sedimentation. It was been found that complex I consists of six molecules of coat protein bound per one molecule of RNA. Ribonuclease digestion of the glutaraldehyde-fixed complex resulted in a mixture of products in which the hexamers of coat protein molecules were predominant. This indicates that the six molecules of coat protein bound to f2 RNA are neighbouring. It has been also shown that under conditions required for phage protein synthesis, coat protein occurs in solution is dimer. The results show that the translational repression of the RNA-replicase cistron is due to the cooperative attachment of three dimers of coat protein to phage template, forming a hexameric cluster on the RNA strand. The proposed mechanism of the complex I formation seems to be in good agreement with the sequence of events in the phage F2 life cycle. It is known that shortly after infection of the host cell the coat protein and phage RNA-replicase begin to be synthesised. According to our findings, the first portions of coat protein do not affect the translation of the RNA-replicase gene since at low concentration the coat protein occure in the form of monomers. At a later period of phage development, when the concentration of coat protein is sufficiently high to promote the formation of protein dimers, the translational repressor complex is formed and the RNA-replicase gene becomes inoperative.     

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.     

Long-range translational coupling in single-stranded RNA bacteriophages: an evolutionary analysis.

In coliphage MS2 RNA a long-distance interaction (LDI) between an internal segment of the upstream coat gene and the start region of the replicase gene prevents initiation of replicase synthesis in the absence of coat gene translation. Elongating ribosomes break up the repressor LDI and thus activate the hidden initiation site. Expression studies on partial MS2 cDNA clones identified base pairing between 1427-1433 and 1738-1744, the so-called Min Jou (MJ) interaction, as the molecular basis for the long-range coupling mechanism. Here, we examine the biological significance of this interaction for the control of replicase gene translation. The LDI was disrupted by mutations in the 3'-side and the evolutionary adaptation was monitored upon phage passaging. Two categories of pseudorevertants emerged. The first type had restored the MJ interaction but not necessarily the native sequence. The pseudorevertants of the second type acquired a compensatory substitution some 80 nt downstream of the MJ interaction that stabilizes an adjacent LDI. In one examined case we confirmed that the second site mutations had restored coat-replicase translational coupling. Our results show the importance of translational control for fitness of the phage. They also reveal that the structure that buries the replicase start extends to structure elements bordering the MJ interaction.     

Regulation of RNA replication in RNA-containing bacteriphages. RNA synthesis in coat protein polar mutants]

The synthesis of RNA by polar coat protein mutants f2sus3 and Qbetaam12 under suppressor (Escherichia coli S26R1E, Su+-1; H12R8a Su+-3) and non-suppressor (E. coli AB259; S26) conditions was examined. It was demonstrated that the synthesis of viral RNA under non-suppressor conditions in the presence of rifamycin produced the same gaussian pattern of rates as the synthesis of RNA by wild type phage or non-polar coat protein mutants. However, the total amount of RNA was decreased approximately 10-fold and the peak of RNA synthesis was displaced 7--10 min later. The number of infective centers was reduced also 10-fold indicating that a certain time-lapse was required to overcome the polarity of the parental RNA, this process being of single occurrence, exclusively on the parental RNA, but not on the progeny strains. As a consequence, it was concluded that the initiation of translation at the replicase cistron starts on the nascent RNA chains within the replicative complexes and not on the fully-synthesized templates with their complete secondary structure. The data obtained are not in contradiction with the hypothesis concerning the role of the repressor complex II (replicase-RNA) to slow down the synthesis of replicase and RNA in the coat protein mutants. The polarity can not be responsible probably for the blocking of the replicase cistron on the nascent chain following the block of coat protein cistron. Therefore, it appears appropriate to assume the existence of two binding sites for the replicase as repressor which is in keeping with the conclusions of Weissmann and co-workers.     

The regulatory region of MS2 phage RNA replicase cistron. Functional activity of individual MS2 RNA fragments

The present work deals with the structural-functional organization of regulatory regions of messenger RNAs. Some principles of the action of a translational repressor (coat protein) and the formation of the ribosomal initiation complex at the replicase cistron have been studied with MS2 phage RNA. When the complex of MS2 RNA with the coat protein is treated with T₁ ribonuclease, the coat protein selectively protects mainly two fragments (59 and 103 nucleotides in length) from digestion; these fragments contain the intercistronic regulatory region and the beginning of the MS2 replicase cistron. These polynucleotides have been isolated in a pure state and their primary structure has been established.It has been established that both MS2 RNA fragments contain all the necessary information for specific interaction with MS2 coat protein and form a complex with it with an efficiency close to that observed in the case of native MS2 RNA. They also provide the normal polypeptide chain initiation at the replicase cistron. Enzymatic binding of the second aminoacyl-tRNA and electrophoretic analysis of N-terminal dipeptides prove that only the true initiator codon of the replicase cistron is recognized by a ribosome despite the presence of a few additional AUG triplets within the polynucleotides. Under conditions of limited hydrolysis by T₁ ribonuclease, the beginning of the replicase cistron has been removed from the shortest polynucleotide leading to a complete loss of its ability to bind both the coat protein and a ribosome.Some principles of the functioning of the regulatory region in MS2 RNA as well as the nature of the initiator signal of protein biosynthesis are discussed.     

Translational options for the pir gene of plasmid R6K: multiple forms of the replication initiator protein pi.

The autogenously controlled pir gene of plasmid R6K was believed to encode a single polypeptide that plays multiple roles in the plasmid's biology. We have isolated an opal (op) mutant at the 18th codon of the pir coding frame which does not totally abolish translation of pir mRNA. In extracts of cells containing this mutation two translational products (35 kDa and 30.2 kDa) have been detected. We propose that the 35-kDa polypeptide produced by the pir18 op mutation contains Trp substituted for Arg18 as the result of an opal readthrough. Translation, which results in the 30.2-kDa polypeptide, originates downstream from the UGA stop signal created by the mutation. Moreover, we realize now that the 30.2-kDa polypeptide is also produced in cells containing a wild-type (wt) pir gene. The shorter variant of the pi protein lacks replication initiation and inhibition functions, as well as autorepressor activity in vivo. We also show that an in-frame fusion of seven N-terminal codons of the trpE gene with a pir gene lacking the first two codons produces two polypeptides which replace the 35-kDa pi protein and are of similar molecular weight. Thus, at least three options exist in the translation of the wt pir mRNA. Start codons are most likely at codon positions 1, 6 or 7, and 36 or 38. Each of these five AUG codons is preceded by a consensus ribosome-binding site (RBS).     

Oligonucleotide Sequence of Replicase Initiation Site in Qβ RNA

THE single stranded RNA genome of bacteriophage Qβ has been variously estimated to consist of from 3,500¹ to 4,500² nucleotides. It contains three known cistrons³, which correspond to three of the four Qβ-specific proteins synthesized in vivo and in vitro^4–6. These are: (1) the gene for the maturation or A protein (molecular weight 41,000 (refs. 4, 5)), (2) that for the major coat protein of the virus (molecular weight 14,000 (ref. 9)) and (3) the gene for the phage-specific subunit of the Qβ replicase (molecular weight 64,000 (ref. 10) or 69,000 (ref. 24)), listed in the probable order^7,8 that they occur on the Qβ RNA. The fourth Qβ-specific protein, A₁ or IIb (molecular weight 36,000 (refs. 4–6, 10)), has recently been shown by Weiner and Weber to have an N-terminal sequence which is identical (for eight amino-acids) to that of the coat protein⁷. Because increased amounts of A₁ appear in virus particles grown in cells containing a UGA suppressor, Weiner and Weber postulate⁷ that this protein is the product of natural read-through at the UGA termination signal of the Qβ coat cistron. Such read-through (involving about 600 nucleotides) could occur entirely within a large “intercistronic” region between the coat and replicase genes, or could involve translation, either in or out of phase, of the replicase cistron. In hopes of distinguishing between these alternatives, I have isolated and examined the nucleotide sequence of the region surrounding the initiator codon of the Qβ replicase gene.     

Structural Constraints and Mutational Bias in the Evolutionary Restoration of a Severe Deletion in RNA Phage MS2

A 4-nucleotide (nt) deletion was made in the 36-nt-long intercistronic region separating the coat and replicase genes of the single-stranded RNA phage MS2. This region is the focus of several RNA structures conferring high fitness. One such element is the operator hairpin, which, in the course of infection, will bind a coat-protein dimer, thereby precluding further replicase synthesis and initiating encapsidation. Another structure is a long-distance base pairing (MJ) controlling replicase expression. The 4-nt deletion does not directly affect the operator hairpin but it disrupts the MJ pairing. Its main effect, however, is a frame shift in the overlapping lysis gene. This gene starts in the upstream coat gene, runs through the 36-nt-long intercistronic region, and ends in the downstream replicase cistron. Here we report and interpret the spectrum of solutions that emerges when the crippled phage is evolved. Four different solutions were obtained by sequencing 40 plaques. Three had cured the frame shift in the lysis gene by inserting one nt in the loop of the operator hairpin causing its inactivation. Yet these low-fitness revertants could further improve themselves when evolved. The inactivated operator was replaced by a substitute and thereafter these revertants found several ways to restore control over the replicase gene. To allow for the evolutionary enrichment of low-probability but high-fitness revertants, we passaged lysate samples before plating. Revertants obtained in this way also restored the frame shift, but not at the expense of the operator. By taking larger and larger lysates samples for such bulk evolution, ever higher-fitness and lower-frequency revertants surfaced. Only one made it back to wild type. As a rule, however, revertants moved further and further away from the wild-type sequence because restorative mutations are, in the majority of cases, selected for their capacity to improve the phenotype by optimizing one of several potential alternative RNA foldings that emerge as a result of the initial deletion. This illustrates the role of structural constraints which limit the path of subsequent restorative mutations. [Reviewing Editor: Dr. John Hulsenbeck]     

Control of Replication in RNA Bacteriophages

The rates of viral RNA and protein syntheses for wild-type RNA bacteriophages and their nonpolar, coat protein amber mutants were determined in amber suppressor (S26R1E, Su-1 and H12R8a, Su-3) and nonsuppressor (AB259, S26, and Q13) strains of Escherichia coli in the presence of rifamycin. It was demonstrated that the rates of synthesis of phage-specific replicase and RNA minus strands drop off concurrently in both wild-type and coat protein mutant-infected Su(-) and Su(+) cells after 10 and 15 min postinfection, respectively. The rate of synthesis of RNA plus strands started to decline 5 to 10 min later in both cases. Excessive synthesis of replicase in the coat protein mutant-infected cells was accompanied by a similar overproduction of RNA minus strands, but not of plus strands. Partial suppression of protein synthesis in wild-type phage-infected cells abolishing coat protein control over replicase accumulation led to prolongation of replicase synthesis. Such an effect was observed also in coat protein mutant-infected cells, indicating that the excess of replicase itself may be capable of suppression of replicase synthesis in the absence of coat protein. The prolongation of replicase synthesis was followed by the prolonged synthesis of RNA minus strands in both cases. Moreover, replicase and minus strands were formed in nearly equal amounts when protein synthesis was partially inhibited. Assuming functional instability of phage RNAs, the observed coupling of replicase and minus-strand RNA synthesis offers a possibility for control of viral RNA replication by means of control of replicase synthesis on the translational level. A hypothesis is put forward to explain the molecular mechanism of such coupling between the syntheses of replicase and RNA minus strands.     

Crystal Structure of the Bacteriophage Qβ Coat Protein in Complex with the RNA Operator of the Replicase Gene

The coat proteins of single-stranded RNA bacteriophages specifically recognize and bind to a hairpin structure in their genome at the beginning of the replicase gene. The interaction serves to repress the synthesis of the replicase enzyme late in infection and contributes to the specific encapsidation of phage RNA. While this mechanism is conserved throughout the Leviviridae family, the coat protein and operator sequences from different phages show remarkable variation, serving as prime examples for the co-evolution of protein and RNA structure. To better understand the protein–RNA interactions in this virus family, we have determined the three-dimensional structure of the coat protein from bacteriophage Qβ bound to its cognate translational operator. The RNA binding mode of Qβ coat protein shares several features with that of the widely studied phage MS2, but only one nucleotide base in the hairpin loop makes sequence-specific contacts with the protein. Unlike in other RNA phages, the Qβ coat protein does not utilize an adenine-recognition pocket for binding a bulged adenine base in the hairpin stem but instead uses a stacking interaction with a tyrosine side chain to accommodate the base. The extended loop between β strands E and F of Qβ coat protein makes contacts with the lower part of the RNA stem, explaining the greater length dependence of the RNA helix for optimal binding to the protein. Consequently, the complex structure allows the proposal of a mechanism by which the Qβ coat protein recognizes and discriminates in favor of its cognate RNA.     

Defective lysis of streptomycin-resistant escherichia coli cells infected with bacteriophage f2

A lysis defect was found to account for the failure of a streptomycin-resistant strain of Escherichia coli to form plaques when infected with the male-specific bacteriophage f2. The lysis defect was associated with the mutation to streptomycin resistance. Large amounts of apparently normal bacteriophage accumulated in these cells. Cell-free extracts from both the parental and mutant strains synthesized a potential lysis protein in considerable amounts in response to formaldehyde-treated f2 RNA but not in response to untreated RNA. As predicted from the nucleotide sequence of the analogous MS2 phage, the protein synthesized in vitro had the expected molecular weight and lacked glycine. The cistron for the lysis protein overlapped portions of the coat and replicase cistrons and was translated in the +1 reading frame. Initiation at the lysis protein cistron may be favored by translation errors that expose the normally masked initiation site, and streptomycin-resistant ribosomes, known to have more faithful translation properties, may be unable to efficiently synthesize the lysis protein.     

Genome structure of caulobacter phage phiCb5

The complete genome sequence of caulobacter phage phiCb5 has been determined, and four open reading frames (ORFs) have been identified and characterized. As for related phages, the ORFs code for maturation, coat, replicase, and lysis proteins, but unlike other Leviviridae members, the lysis protein gene of phiCb5 entirely overlaps with the replicase in a different reading frame. The lysis protein of phiCb5 is about two times longer than that of the distantly related MS2 phage and presumably contains two transmembrane helices. Analysis of the proposed genome secondary structure revealed a stable 5' stem-loop, similar to other phages, and a substantially shorter 3' untranslated region (UTR) structure with only three stem-loops.     

The lysis function of RNA bacteriophage Qbeta is mediated by the maturation (A2) protein

Complete or partial cDNA sequences of the RNA bacteriophage Qbeta were cloned in plasmids under the control of the lambdaP(L) promoter to allow regulated expression in Escherichia coli harbouring the gene for the temperature-sensitive lambdaCI857 repressor. Induction of the complete Qbeta sequence leads to a 100-fold increase in phage production, accompanied by cell lysis. Induction of the 5'-terminal sequence containing the intact maturation protein (A2) cistron also causes cell lysis. Alterations of the A2 cistron, leading to proteins either devoid of approximately 20% of the C-terminal region or of six internal amino acids, abolish the lysis function. Expression of other cistrons in addition to the A2 cistron does not enhance host lysis. Thus, in Qbeta, the A2 protein, in addition to its functions as maturation protein, appears to trigger cell lysis. This contrasts with the situation in the distantly related group I RNA phages such as f2 and MS2 where a small lysis polypeptide is coded for by a region overlapping the end of the coat gene and the beginning of the replicase gene.     

Inhibition of Replication of Ribonucleic Acid Bacteriophage f2 by Superinfection with Bacteriophage T4

Superinfection by phage T4 of cells infected by the ribonucleic acid (RNA) phage f2 results in inhibition of further f2 production. Experiments using rifampin show that the exclusion of f2 requires T4 gene function soon after T4 infection. By using a sensitive new peptide-mapping procedure to identify f2 coat protein in infected cells, we show that synthesis of the f2 coat occurs at a reduced level until 4 min after T4 superinfection and then ceases abruptly. Within 4 min after T4 superinfection, there are also several changes in f2 RNA metabolism, all of which require T4 gene function: preexisting f2 replicative intermediate RNA and f2 single-stranded RNA are degraded to small but still acid-precipitable fragments, and most f2-specific RNA is released from polyribosomes. We favor the hypothesis that T4 induces the synthesis of a specific endoribonuclease which degrades f2 RNA and that the inhibition of f2 protein synthesis may be a consequence of this degradation, rather than a direct effect of T4 upon translation.     

Regulatory region of fr phage replicase cistron. II. Isolation and structure of specific fr RNA fragments

A new set of short RNA templates has been prepared for functional studies in initiation of translation in vitro. Number of individual RNA fragments which contain complete or part of the initiatory region of phage fr replicase cistron were isolated from complex fr RNA--fr coat protein. Their primary structure were determined by using standard fingerprint technique and rapid gel sequencing. Secondary structure of several RNA fragments and their binding activity with phage fr and MS2 coat proteins has been also studied.