On the role of E-ring oxygen atoms in the binding of camptothecin to the topoisomerase I-DNA covalent binary complex

A recent X-ray crystallographic analysis of the binding of a water soluble camptothecin analogue to the human topoisomerase I-DNA covalent binary complex has suggested the existence of some novel features in the way that camptothecin is bound to the binary complex. Four additional models based on chemical and biochemical data have also been proposed. Presently we describe S-containing analogues of camptothecin prepared on the basis of these models, and report their ability to form stable ternary complexes with human topoisomerase I, and to mediate cytotoxicity at the locus of topoisomerase I. The results indicate that replacement of the 20-OH group of CPT with a SH functionality results in diminution of the potency of CPT as a topoisomerase I poison, while replacement of the O atoms at positions 20 and 21 with S atoms results in essentially complete loss of topoisomerase I inhibitory activity.     

Differential induction of Leishmania donovani bi-subunit topoisomerase I-DNA cleavage complex by selected flavones and camptothecin: activity of flavones against camptothecin-resistant topoisomerase I

Emergence of the bi-subunit topoisomerase I in the kinetoplastid family (Trypanosoma and Leishmania) has brought a new twist in topoisomerase research related to evolution, functional conservation and preferential sensitivities to the specific inhibitors of type IB topoisomerase family. In the present study, we describe that naturally occurring flavones baicalein, luteolin and quercetin are potent inhibitors of the recombinant Leishmania donovani topoisomerase I. These compounds bind to the free enzyme and also intercalate into the DNA at a very high concentration (300 µM) without binding to the minor grove. Here, we show that inhibition of topoisomerase I by these flavones is due to stabilization of topoisomerase I–DNA cleavage complexes, which subsequently inhibit the religation step. Their ability to stabilize the covalent topoisomerase I–DNA complex in vitro and in living cells is similar to that of the known topoisomerase I inhibitor camptothecin (CPT). However, in contrast to CPT, baicalein and luteolin failed to inhibit the religation step when the drugs were added to pre-formed enzyme substrate binary complex. This differential mechanism to induce the stabilization of cleavable complex with topoisomerase I and DNA by these selected flavones and CPT led us to investigate the effect of baicalein and luteolin on CPT-resistant mutant enzyme LdTOP1Δ39LS lacking 1–39 amino acids of the large subunit [B. B. Das, N. Sen, S. B. Dasgupta, A. Ganguly and H. K. Majumder (2005) J. Biol. Chem. 280, 16335–16344]. Baicalein and luteolin stabilize duplex oligonucleotide cleavage with LdTOP1Δ39LS. This observation was further supported by the stabilization of in vivo cleavable complex by baicalein and luteolin with highly CPT-resistant L.donovani strain. Taken together, our data suggest that the interacting amino acid residues of topoisomerase I may be partially overlapping or different for flavones and CPT. This study illuminates new properties of the flavones and provide additional insights into the ligand binding properties of L.donovani topoisomerase I.     

Processing of nucleopeptides mimicking the topoisomerase I-DNA covalent complex by tyrosyl-DNA phosphodiesterase

Tyrosyl-DNA phosphodiesterase-1 (Tdp1) is the only known enzyme to remove tyrosine from complexes in which the amino acid is linked to the 3′-end of DNA fragments. Such complexes can be produced following DNA processing by topoisomerase I, and recent studies in yeast have demonstrated the importance of TDP1 for cell survival following topoisomerase I-mediated DNA damage. In the present study, we used synthetic oligodeoxynucleotide–peptide conjugates (nucleopeptides) and recombinant yeast Tdp1 to investigate the molecular determinants for Tdp1 activity. We find that Tdp1 can process nucleopeptides with up to 13 amino acid residues but is poorly active with a 70 kDa fragment of topoisomerase I covalently linked to a suicide DNA substrate. Furthermore, Tdp1 was more effective with nucleopeptides with one to four amino acids than 15 amino acids. Tdp1 was also more effective with nucleopeptides containing 15 nt than with homolog nucleopeptides containing 4 nt. These results suggest that DNA binding contributes to the activity of Tdp1 and that Tdp1 would be most effective after topoisomerase I has been proteolyzed in vivo.     

On the mechanism of topoisomerase I inhibition by camptothecin: evidence for binding to an enzyme-DNA complex

Camptothecin, a cytotoxic antitumor compound, has been shown to produce protein-linked DNA breaks mediated by mammalian topoisomerase I. We have investigated the mechanism by which camptothecin disrupts DNA processing by topoisomerase I and have examined the effect of certain structurally related compounds on the formation of a DNA-topoisomerase I covalent complex. Enzyme-mediated cleavage of supercoiled plasmid DNA in the presence of camptothecin was completely reversed upon the addition of exogenous linear DNA or upon dilution of the reaction mixture. Camptothecin and topoisomerase I produced the same amount of cleavage from supercoiled DNA or relaxed DNA. In addition, the alkaloid decreased the initial velocity of supercoiled DNA relaxation mediated by catalytic quantities of topoisomerase I. Inhibition occurred under conditions favoring processive catalysis as well as under conditions favoring distributive catalysis. By use of [3H]camptothecin and an equilibrium dialysis assay, the alkaloid was shown to bind reversibly to a DNA-topoisomerase I complex, but not to isolated enzyme or isolated DNA. These results are consistent with a model in which camptothecin reversibly traps an intermediate involved in DNA unwinding by topoisomerase I and thereby perturbs a set of equilibria, resulting in increased DNA cleavage. By examining certain compounds that are structurally related to camptothecin, it was found that the 20-hydroxy group, which has been shown to be essential for antitumor activity, was also necessary for stabilization of the covalent complex between DNA and topoisomerase I. In contrast, no such correlation existed for UV-light-induced cleavage of DNA by Cu(II)-camptothecin derivatives.     

Structural impact of the leukemia drug 1-beta-D-arabinofuranosylcytosine (Ara-C) on the covalent human topoisomerase I-DNA complex

1-beta-d-Arabinofuranosylcytosine (Ara-C) is a potent antineoplastic drug used in the treatment of acute leukemia. Previous biochemical studies indicated the incorporation of Ara-C into DNA reduced the catalytic activity of human topoisomerase I by decreasing the rate of single DNA strand religation by the enzyme by 2-3-fold. We present the 3.1 A crystal structure of human topoisomerase I in covalent complex with an oligonucleotide containing Ara-C at the +1 position of the non-scissile DNA strand. The structure reveals that a hydrogen bond formed between the 2'-hydroxyl of Ara-C and the O4' of the adjacent -1 base 5' to the damage site stabilizes a C3'-endo pucker in the Ara-C arabinose ring. The structural distortions at the site of damage are translated across the DNA double helix to the active site of human topoisomerase I. The free sulfhydryl at the 5'-end of the nicked DNA strand in this trapped covalent complex is shifted out of alignment with the 3'-phosphotyrosine linkage at the catalytic tyrosine 723 residue, producing a geometry not optimal for religation. The subtle structural changes caused by the presence of Ara-C in the DNA duplex may contribute to the cytotoxicity of this leukemia drug by prolonging the lifetime of the covalent human topoisomerase I-DNA complex.     

Substituents on etoposide that interact with human topoisomerase IIalpha in the binary enzyme-drug complex: contributions to etoposide binding and activity

Etoposide is a widely prescribed anticancer agent that stabilizes topoisomerase II-mediated DNA strand breaks. The drug contains a polycyclic ring system (rings A-D), a glycosidic moiety at C4, and a pendant ring (E-ring) at C1. A recent study that focused on yeast topoisomerase II demonstrated that the H15 geminal protons of the etoposide A-ring, the H5 and H8 protons of the B-ring, and the H2', H6', 3'-methoxyl, and 5'-methoxyl protons of the E-ring contact topoisomerase II in the binary enzyme-drug complex [ Wilstermann et al. (2007) Biochemistry 46, 8217-8225 ]. No interactions with the C4 sugar were observed. The present study used DNA cleavage assays, saturation transfer difference [ (1)H] NMR spectroscopy, and enzyme-drug binding studies to further define interactions between etoposide and human topoisomerase IIalpha. Etoposide and three derivatives that lacked the C4 sugar were analyzed. Except for the sugar, 4'-demethyl epipodophyllotoxin is identical to etoposide, epipodophyllotoxin contains a 4'-methoxyl group on the E-ring, and 6,7- O, O-demethylenepipodophyllotoxin replaces the A-ring with a diol. Results suggest that etoposide-topoisomerase IIalpha binding is driven by interactions with the A- and B-rings and potentially by stacking interactions with the E-ring. We propose that the E-ring pocket on the enzyme is confined, because the addition of bulk to this ring adversely affects drug function. The A- and E-rings do not appear to contact DNA in the enzyme-drug-DNA complex. Conversely, the sugar moiety subtly alters DNA interactions. The identification of etoposide substituents that contact topoisomerase IIalpha in the binary complex has predictive value for drug behavior in the enzyme-etoposide-DNA complex.     

Platinated DNA adducts enhance poisoning of DNA topoisomerase I by camptothecin

Camptothecins constitute a novel class of chemotherapeutics that selectively target DNA topoisomerase I (Top1) by reversibly stabilizing a covalent enzyme-DNA intermediate. This cytotoxic mechanism contrasts with that of platinum drugs, such as cisplatin, which induce inter- and intrastrand DNA adducts. In vitro combination studies using platinum drugs combined with Top1 poisons, such as topotecan, showed a schedule-dependent synergistic activity, with promising results in the clinic. However, whereas the molecular mechanism of these single agents may be relatively well understood, the mode of action of these chemotherapeutic agents in combination necessitates a more complete understanding. Indeed, we recently reported that a functional homologous recombination pathway is required for cisplatin and topotecan synergy yet represses the synergistic toxicity of 1-beta-D-arabinofuranosyl cytidine in combination with topotecan (van Waardenburg, R. C., de Jong, L. A., van Delft, F., van Eijndhoven, M. A., Bohlander, M., Bjornsti, M. A., Brouwer, J., and Schellens, J. H. (2004) Mol. Cancer Ther. 3, 393-402). Here we provide direct evidence for Pt-1,3-d(GTG) poisoning of Top1 in vitro and demonstrate that persistent Pt-DNA adducts correlate with increased covalent Top1-DNA complexes in vivo. This contrasts with a lack of persistent lesions induced by the alkylating agent bis[chloroethyl]nitrosourea, which exhibits only additive activity with topotecan in a range of cell lines. In human IGROV-1 ovarian cancer cells, the synergistic activity of cisplatin with topotecan requires processive DNA polymerization, whereas overexpression of Top1 enhances yeast cell sensitivity to cisplatin. These results indicate that the cytotoxic activity of cisplatin is due, in part, to poisoning of Top1, which is exacerbated in the presence of topotecan.     

Role of the protein in the DNA sequence specificity of the cleavage site stabilized by the camptothecin topoisomerase IB inhibitor: a metadynamics study

Camptothecin (CPT) is a topoisomerase IB (TopIB) selective inhibitor whose derivatives are currently used in cancer therapy. TopIB cleaves DNA at any sequence, but in the presence of CPT the only stabilized protein–DNA covalent complex is the one having a thymine in position −1 with respect to the cleavage site. A metadynamics simulation of two TopIB–DNA–CPT ternary complexes differing for the presence of a thymine or a cytosine in position −1 indicates the occurrence of two different drug’s unbinding pathways. The free-energy difference between the bound state and the transition state is large when a thymine is present in position −1 and is strongly reduced in presence of a cytosine, in line with the different drug stabilization properties of the two systems. Such a difference is strictly related to the changes in the hydrogen bond network between the protein, the DNA and the drug in the two systems, indicating a direct role of the protein in determining the specificity of the cleavage site sequence stabilized by the CPT. Calculations carried out in presence of one compound of the indenoisoquinoline family (NSC314622) indicate a comparable energy difference between the bound and the transition state independently of the presence of a thymine or a cytosine in position −1, in line with the experimental results.     

Inhibition of Flp recombinase by the topoisomerase I-targeting drugs, camptothecin and NSC-314622

Recombinases of the lambda-Int family and type IB topoisomerases act by introducing transient single strand breaks in DNA using chemically identical reaction schemes. Recent structural data have supported the relationship between the two enzyme groups by revealing considerable similarities in the architecture of their catalytic pockets. In this study we show that the Int-type recombinase Flp is inhibited by the two structurally unrelated topoisomerase I-directed anti-cancer drugs, camptothecin (CPT) and NSC-314622. The interaction of these drugs with topoisomerase I is very specific with several single amino acid substitutions conferring drug resistance to the enzyme. Thus, the observed interaction of CPT and NSC-314622 with Flp, which is comparable to their interaction with the cleavage complex formed by topoisomerase I, strongly supports a close mechanistic and evolutionary relationship between the two enzymes. The results suggest that Flp and other Int family recombinases may provide model systems for dissecting the molecular mechanisms of topoisomerase I-directed anti-cancer therapeutic agents.     

A structural model for the ternary cleavable complex formed between human topoisomerase I, DNA, and camptothecin

Using the X-ray crystal structure of the human topoisomerase I (TOP1)-DNA cleavable complex, we have developed a general model for the ternary drug-DNA-TOP1 cleavable complex formed with camptothecin (CPT) and its analogues. This model has the drug intercalated between the -1 and +1 base pairs, with the E-ring pointing into the minor groove and the A-ring directed toward the major groove. The ternary complex is stabilized by an array of hydrogen bonding and hydrophobic interactions between the drug and both the enzyme and the DNA. Significantly, the proposed model is consistent with the current body of experimental mutation, cross-linking, and structure-activity data. In addition, the model reveals potential sites of interaction that can provide a rational basis for the design of next generation compounds as well as for de novo drug design.     

The basis for camptothecin enhancement of DNA breakage by eukaryotic topoisomerase I.

The eukaryotic topoisomerase I (topo I) is the target of the cytotoxic alkaloid camptothecin (CTT). In vitro, CTT enhances the breakage of DNA by topo I when the reaction is stopped with detergent. Although breakage at some sites is enhanced to a great extent while breakage at others is enhanced only minimally, CTT does not significantly change the breakage specificity of topo I in vitro. It has been suggested that CTT acts by slowing the reclosure step of the nicking-closing reaction. To test this hypothesis, we have measured the rate of reclosure for different break sites in the presence of CTT after adding 0.5 M NaCl to a standard low salt reaction. In support of the hypothesis, we find that topo I-mediated DNA breakage is enhanced the greatest at those sites where closure of the break is the slowest. These results suggest a mechanism for the toxicity of CTT in vivo.     

Irreversible trapping of the DNA-topoisomerase I covalent complex. Affinity labeling of the camptothecin binding site

Camptothecin (CPT) binds reversibly to, and thereby stabilizes, the cleavable complex formed between DNA and topoisomerase I. The nature of the interaction of CPT with the DNA-topoisomerase I binary complex was studied by the use of two affinity labeling reagents structurally related to camptothecin: 10-bromoacetamidomethylcamptothecin (BrCPT) and 7-methyl-10-bromoacetamidomethylcamptothecin (BrCPTMe). These compounds have been shown to trap the DNA-topoisomerase I complex irreversibly. Although cleavage of DNA plasmid mediated by topoisomerase I and camptothecin was reduced significantly by treatment with high salt or excess competitor DNA, enzyme-mediated DNA cleavage stabilized by BrCTPMe persisted for at least 4 h after similar treatment. The production of irreversible topoisomerase I-DNA cleavage was time-dependent, suggesting that BrCPTMe first bound noncovalently to the enzyme-DNA complex and, in a second slower step, alkylated the enzyme or DNA in a manner that prevented DNA ligation. The formation of a covalent linkage was supported by experiments that employed [3H]BrCPT, which was shown to label topoisomerase I within the enzyme-DNA complex. [3H]BrCPT labeling of topoisomerase I was enhanced greatly by the presence of DNA; very little labeling of isolated topoisomerase I or isolated DNA occurred. Even in the presence of DNA, [3H]BrCPT labeling of topoisomerase I was inhibited by camptothecin, suggesting that both CPT and BrCPT bound to the same site on the DNA-topoisomerase I binary complex. These studies provide further evidence that a binding site for camptothecin is created as the DNA-topoisomerase I complex is formed and suggest that the A-ring of camptothecin is proximate to an enzyme residue.     

Analysis of the 3-hydroxyl group in Drosophila siRNA function

Members of the RNA-dependent RNA polymerase (RdRP) gene family have been shown to be essential for dsRNA-mediated gene silencing based on genetic screens in a variety of organisms, including Caenorhabditis elegans, Arabidopsis, Neurospora, and Dictyostelium. A hallmark of this process is the formation of small 21- to 25-bp dsRNAs, termed siRNAs for small interfering RNAs, which are derived from the dsRNA that initiates gene silencing. We have developed methods to demonstrate that these siRNAs produced in Drosophila embryo extract can be uniformly incorporated into dsRNA in a template-specific manner that is subsequently degraded by RNase III-related enzyme activity to create a second generation of siRNAs. SiRNA function in dsRNA synthesis and mRNA degradation depends upon the integrity of the 3^′-hydroxyl of the siRNA, consistent with the interpretation that siRNAs serve as primers for RdRP activity in the formation of dsRNA. This process of siRNA incorporation into dsRNA followed by degradation and the formation of new siRNAs has been termed “degradative PCR” and the proposed mechanism is consistent with the genetic and biochemical data derived from studies in C. elegans, Arabidopsis, Drosophila, and Dictyostelium. The methods used to study the function of both natural and synthetic siRNAs in RNA interference in Drosophila embryo extracts are detailed. The importance of the 3^′-hydroxyl group for siRNA function and its incorporation into dsRNA is emphasized and the results support a model that places RNA-dependent RNA polymerase as a key mediator in the RNA interference mechanism in Drosophila.     

Induction of cleavage in topoisomerase I c-DNA by topoisomerase I enzymes from calf thymus and wheat germ in the presence and absence of camptothecin.

In this study, we further examined the sequence selectivity of camptothecin in mammalian topoisomerase I cDNA from human and Chinese hamster. In the absence of camptothecin, almost all the bases at the 3'-terminus of cleavage sites are T for calf thymus and wheat germ topoisomerase I. In addition, wheat germ topoisomerase I exhibits preference for C (or not T) at -3 and for T at -2 position. As for camptothecin-stimulated cleavage with topoisomerase I, G (or not T) at +1 is an additional strong preference. This sequence selectivity of camptothecin is similar to that previously found in SV40 DNA, suggesting that camptothecin preferentially interacts with topoisomerase I-mediated cleavage sites where G is the base at the 5'-terminus. These results support the stacking model of camptothecin (Jaxel et al. (1991) J. Biol. Chem. 266, 20418-20423). Comparison of calf thymus and wheat germ topoisomerase I-mediated cleavage sites in the presence of camptothecin shows that many major cleavage sites are similar. However, the relative intensities are often different. One of the differences was attributable to a bias at position -3 where calf thymus topoisomerase I prefers G and wheat germ topoisomerase I prefers C. This difference may explain the unique patterns of cleavage sites induced by the two enzymes. Sequencing analysis of camptothecin-stimulated cleavage sites in the surrounding regions of point mutations in topoisomerase I cDNA, which were found in camptothecin-resistant cell lines, reveals no direct relationship between DNA cleavage sites in vitro and mutation sites.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.